ID: 998822211

View in Genome Browser
Species Human (GRCh38)
Location 5:146067255-146067277
Sequence CGGGGAAGGCAGGCCTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 523}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998822211_998822221 0 Left 998822211 5:146067255-146067277 CCACACCAGGCCTGCCTTCCCCG 0: 1
1: 0
2: 1
3: 68
4: 523
Right 998822221 5:146067278-146067300 GCAGCAGCAACCCAGGCGGCTGG No data
998822211_998822219 -4 Left 998822211 5:146067255-146067277 CCACACCAGGCCTGCCTTCCCCG 0: 1
1: 0
2: 1
3: 68
4: 523
Right 998822219 5:146067274-146067296 CCCGGCAGCAGCAACCCAGGCGG 0: 1
1: 0
2: 0
3: 23
4: 283
998822211_998822222 6 Left 998822211 5:146067255-146067277 CCACACCAGGCCTGCCTTCCCCG 0: 1
1: 0
2: 1
3: 68
4: 523
Right 998822222 5:146067284-146067306 GCAACCCAGGCGGCTGGATCAGG 0: 1
1: 0
2: 0
3: 23
4: 462
998822211_998822223 7 Left 998822211 5:146067255-146067277 CCACACCAGGCCTGCCTTCCCCG 0: 1
1: 0
2: 1
3: 68
4: 523
Right 998822223 5:146067285-146067307 CAACCCAGGCGGCTGGATCAGGG 0: 1
1: 0
2: 1
3: 9
4: 114
998822211_998822216 -7 Left 998822211 5:146067255-146067277 CCACACCAGGCCTGCCTTCCCCG 0: 1
1: 0
2: 1
3: 68
4: 523
Right 998822216 5:146067271-146067293 TTCCCCGGCAGCAGCAACCCAGG 0: 1
1: 0
2: 2
3: 13
4: 175
998822211_998822226 13 Left 998822211 5:146067255-146067277 CCACACCAGGCCTGCCTTCCCCG 0: 1
1: 0
2: 1
3: 68
4: 523
Right 998822226 5:146067291-146067313 AGGCGGCTGGATCAGGGTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 189
998822211_998822227 16 Left 998822211 5:146067255-146067277 CCACACCAGGCCTGCCTTCCCCG 0: 1
1: 0
2: 1
3: 68
4: 523
Right 998822227 5:146067294-146067316 CGGCTGGATCAGGGTCAAGGCGG 0: 1
1: 0
2: 0
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998822211 Original CRISPR CGGGGAAGGCAGGCCTGGTG TGG (reversed) Intronic
900124855 1:1064791-1064813 CGGGGCAGGGTGGCCAGGTGCGG + Intergenic
900772164 1:4553938-4553960 CAGGGAAGGCAGCCCCAGTGTGG - Intergenic
901040386 1:6359744-6359766 CTGGGAAAGCAGCCCTGGTGGGG - Intronic
901059450 1:6465389-6465411 TGGGGCAGGCAGGGCTGGAGAGG - Intronic
901422816 1:9162405-9162427 CGTGGAGGTCAGGCCAGGTGGGG + Intergenic
901977353 1:13005607-13005629 TGGGGAAGGCCTGCCTAGTGGGG + Intronic
902004732 1:13223327-13223349 TGGGGAAGGCCTGCCTAGTGGGG - Intergenic
902023951 1:13369062-13369084 CGGGGAAGGCCTGCCTAGTGGGG - Exonic
902446210 1:16466248-16466270 ATGGGAAGGGAGGCCGGGTGTGG + Intergenic
902616114 1:17624470-17624492 CGAGGAAGGCAGGCTTGGTGAGG - Exonic
902992573 1:20199500-20199522 CTTGGCTGGCAGGCCTGGTGGGG - Intergenic
903189486 1:21648873-21648895 CTGGGAAGCCAGGCCTGGGGTGG - Intronic
903275054 1:22216286-22216308 CGGGGAAGCTGGCCCTGGTGCGG + Intergenic
903354782 1:22740019-22740041 TGAGGCAGGGAGGCCTGGTGAGG + Intronic
904134229 1:28298798-28298820 AAGAGAAGGCAGGCCGGGTGCGG + Intergenic
904208495 1:28870701-28870723 CTGAGAGGGCAGTCCTGGTGAGG - Intergenic
904354925 1:29932841-29932863 CTGGGAAGGGAGGCTTGGTGGGG - Intergenic
904625832 1:31801546-31801568 GGGGGAGGGCAGGCTGGGTGGGG + Intronic
905106508 1:35566240-35566262 TGGGGCAGACAGGCCTGGTGGGG + Exonic
905175205 1:36130994-36131016 AGGGGAAGGATGGCCTAGTGTGG - Intergenic
905375309 1:37516207-37516229 AGGGGAATGCAGGCCGGGCGCGG + Intergenic
905467272 1:38164728-38164750 CTGAGAAGGCATGCCTGGAGAGG - Intergenic
905825515 1:41023466-41023488 AGGGGATGGCATGCCTGCTGTGG - Intergenic
906167292 1:43696212-43696234 CAGAGAAGGCAGGGCTGGTGTGG + Intronic
906310837 1:44753136-44753158 CAGGGCAGGAAGGCCTAGTGGGG - Exonic
906612993 1:47216126-47216148 CCCTGAAGGCAGGCCTGGTGGGG - Intergenic
906641880 1:47445815-47445837 CGGGGAAGGAAGGCGTGGGCCGG - Intergenic
910931124 1:92443447-92443469 CAGAGGAGGCAGGCCGGGTGCGG + Intergenic
911711992 1:101084597-101084619 TGGGGAAGGCAGGCCTGTTTTGG - Intergenic
911740719 1:101384297-101384319 CAGGGAAGGATGGCCTAGTGGGG + Intergenic
912793359 1:112674742-112674764 CGGAGGAGGGAAGCCTGGTGGGG + Intronic
912801543 1:112722742-112722764 CTGGGGAGGCGGGGCTGGTGCGG + Intronic
913228708 1:116723052-116723074 AGGGCAGGGCAGGCTTGGTGGGG - Intergenic
913528103 1:119712748-119712770 AGGGGAAGGCAGCCCTCGTAAGG + Intronic
915523713 1:156463667-156463689 ATGGGAAGGAAGGACTGGTGTGG - Intergenic
915549831 1:156625493-156625515 CTGGGAAGGCAGGTCTGGAGAGG - Exonic
915912230 1:159922440-159922462 TGGGGAAGGCAGGCGGGGTGGGG + Intronic
916812310 1:168316402-168316424 CAGGGAAGGGAGGGCTGGTGAGG - Intergenic
916823761 1:168425337-168425359 CGGGGCAGAGAGGCCTGTTGGGG + Intergenic
919816294 1:201442709-201442731 AGGCAAATGCAGGCCTGGTGTGG + Intergenic
919928023 1:202202709-202202731 CGGTGGAGGCAGGCCTGCAGTGG + Intronic
919974179 1:202600155-202600177 CTGGGAAGGCAGCTCTGATGGGG + Intronic
920051683 1:203168187-203168209 TGAGGGAGGGAGGCCTGGTGAGG - Intronic
920399498 1:205668316-205668338 CAGGGAAGGCGGCCCTGGAGCGG - Intronic
920441809 1:205985782-205985804 TGGGGATGGTGGGCCTGGTGGGG - Intronic
920672590 1:208015775-208015797 AGGTCAAGGGAGGCCTGGTGTGG + Intergenic
921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG + Intergenic
922503038 1:226110573-226110595 TGGGGAAGGCAGGGCCGGCGCGG + Intergenic
922725879 1:227922767-227922789 CTGCAAAGACAGGCCTGGTGGGG + Intronic
922768964 1:228171663-228171685 GGGGCAAGGCAGGCAGGGTGGGG - Intronic
923363062 1:233231732-233231754 CTGGGAAGGCAGGGTTGGTAGGG + Intronic
1063112001 10:3046024-3046046 GGGGGAGGGCAGCCCTGGAGCGG + Intergenic
1063949864 10:11212337-11212359 CTGTGAAGGCAGGCCCGGGGGGG - Intronic
1065189453 10:23196634-23196656 CGGGGGAGGGAGCCCTGGAGTGG + Intergenic
1065313737 10:24441532-24441554 CGTGGAATGCATGCTTGGTGGGG + Intronic
1065481205 10:26195611-26195633 CTGGGAAGGAAGGGCTGGAGTGG - Intronic
1065754528 10:28919118-28919140 GGGGGAGGGCTGGCCTGGTGAGG - Intergenic
1066727573 10:38409251-38409273 GGGGGTAGGTAGTCCTGGTGGGG + Intergenic
1067802101 10:49366081-49366103 GGGGGAGGGCAGGCCGGGCGGGG + Exonic
1069612269 10:69782302-69782324 GGGAGAAGGCAGATCTGGTGAGG - Intergenic
1069615938 10:69806234-69806256 TGGGGAGGGCAAGCCTGGTGAGG + Intronic
1069744024 10:70703526-70703548 TGGGGAGGGCAGGGCTGGCGGGG + Intronic
1070365900 10:75736932-75736954 TGGGGAAGGCAGGGCTGGGATGG + Intronic
1070796066 10:79217068-79217090 CTGGGAAGGCAGGAATGGTAAGG + Intronic
1070982071 10:80657151-80657173 CGTGGAGAGCAGGCCTTGTGAGG - Intergenic
1071457440 10:85861710-85861732 TGGGGAAGGCAGGCAGGGTATGG + Intronic
1071603492 10:86970251-86970273 CGGGGCAGAAAGGTCTGGTGGGG + Exonic
1073020419 10:100438971-100438993 CTGGGAAGACTGGCATGGTGGGG - Intergenic
1073022421 10:100456406-100456428 TTTGTAAGGCAGGCCTGGTGGGG - Intergenic
1073646193 10:105306712-105306734 GAGGAAAGGCAGGCCTGCTGTGG - Intergenic
1074814905 10:117136269-117136291 TGGGGATGGCAGGAATGGTGGGG + Intronic
1075332053 10:121580999-121581021 CAGGGGAGTCAGGCCAGGTGTGG - Intronic
1075585771 10:123657004-123657026 CTGGGAAAACAGTCCTGGTGGGG - Intergenic
1075970680 10:126649784-126649806 AGGGGGAGGCAGACCTGGTTGGG - Intronic
1076175859 10:128367240-128367262 GGGGGAGGGCAGGGCCGGTGTGG + Intergenic
1076288189 10:129321971-129321993 CCGGGAATGCAGCCTTGGTGTGG - Intergenic
1076343874 10:129767388-129767410 CCAGGAAGGGAGGCATGGTGGGG - Exonic
1076453081 10:130570393-130570415 TGGGGAAGCCTGGCCTGGCGTGG - Intergenic
1076470255 10:130713735-130713757 CTGGGAAGGTAGGCCCAGTGGGG + Intergenic
1076570041 10:131426519-131426541 CAGGGAAGGCATCCCTGTTGTGG + Intergenic
1076722938 10:132400615-132400637 CGGGCAGGTCAGGCCTGCTGGGG - Intronic
1076729393 10:132430954-132430976 AGGGCCCGGCAGGCCTGGTGGGG + Intergenic
1077051870 11:570260-570282 CAGGGAAAACAGGCCGGGTGTGG + Intergenic
1077162100 11:1118376-1118398 AGGGCAAGGCAGGCCTGCTGGGG + Intergenic
1077223092 11:1426006-1426028 GGGGGAAGGCTGGACAGGTGAGG - Intronic
1077334492 11:1997365-1997387 TGGGGAAGCGAGGCCTGGGGAGG + Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1078190455 11:9089707-9089729 AGGGGAAGGCAGGCAGTGTGAGG - Exonic
1078449150 11:11427454-11427476 CTGGGAAGGAAGGCTTAGTGAGG + Intronic
1079076598 11:17388741-17388763 CTGGGAAGGCAGGCTGGGCGGGG - Intronic
1079128120 11:17733083-17733105 CAAGGAAGCCTGGCCTGGTGTGG - Intergenic
1080324968 11:31061013-31061035 CTGGGAAGGAAGGGCTGGTTAGG + Intronic
1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG + Intergenic
1082001182 11:47394520-47394542 AGAGGAAGGCGGGCCTGGAGCGG + Intergenic
1082067401 11:47911759-47911781 TTGGGAAGGCAGGCCAGGCGTGG + Intergenic
1083368551 11:62158757-62158779 CTTGTAAAGCAGGCCTGGTGGGG - Intergenic
1083435088 11:62637291-62637313 TAGGGAAGGCTGGCCGGGTGTGG + Intronic
1083878996 11:65539093-65539115 TGGGGAACGCAGGCCCCGTGCGG + Exonic
1084118645 11:67056421-67056443 GGGGCAGGCCAGGCCTGGTGGGG + Intergenic
1084129412 11:67121260-67121282 AGAGGAAGGCAGCCCTGGAGTGG + Exonic
1084371988 11:68750875-68750897 CGGGGAAGGGCGACCAGGTGAGG + Intronic
1084758085 11:71251781-71251803 CGGGGCCGGCGCGCCTGGTGCGG - Intronic
1084944195 11:72630111-72630133 CAGGGAAGGAAGGCATGGTCGGG + Intronic
1085016848 11:73179305-73179327 GGGGGTAGGCAGCCCAGGTGGGG - Intergenic
1085049272 11:73371772-73371794 AGAGGAGGGCTGGCCTGGTGTGG + Intergenic
1085143419 11:74170865-74170887 CGGGGAACGCAGGCGCCGTGGGG - Exonic
1085228266 11:74942241-74942263 CAGGGAAGTCAGGCAAGGTGGGG + Intronic
1085402188 11:76241757-76241779 CCTGGAAGGAAGGCCTGGAGTGG - Intergenic
1085442267 11:76575962-76575984 CGAGGAAGGCAGGTCACGTGAGG - Intergenic
1085456185 11:76666547-76666569 CGGGGCAGCCAGGCCTCCTGTGG - Intronic
1085464526 11:76714905-76714927 CGAGGAAGGCAGGGCTGTAGAGG - Intergenic
1085496733 11:76977684-76977706 CAGGGGAGGCAGTGCTGGTGGGG + Intronic
1086420693 11:86634307-86634329 AGGAGAAGACAGTCCTGGTGGGG - Intronic
1086573818 11:88315177-88315199 CTGGTAAGGCAGGCCAGGTAGGG + Intronic
1089500578 11:118929321-118929343 CGGGGAAGGCGGCAGTGGTGAGG - Intronic
1089557251 11:119321238-119321260 CGGGGATGGCAGAGCTGGGGTGG + Intronic
1089655991 11:119947473-119947495 GGGTGAAGTCAGGCTTGGTGTGG + Intergenic
1089692990 11:120198151-120198173 CGCTGGAGGCAGGCCTGGGGAGG + Intergenic
1089697628 11:120225803-120225825 TGGGCCAGGCAGGCCTGGTGGGG - Intronic
1090216128 11:124966820-124966842 CTTGTAAGGCAGGCCTGGTGGGG + Intronic
1090663119 11:128895680-128895702 GAGGGCAGGCAGGCCCGGTGTGG - Intronic
1090696364 11:129247012-129247034 CGTGGAAGGTAGACCTAGTGAGG - Intronic
1202817475 11_KI270721v1_random:52547-52569 TGGGGAAGCGAGGCCTGGGGAGG + Intergenic
1091731787 12:2886358-2886380 CTGGGAAGAGAGGCCGGGTGTGG + Intronic
1092147407 12:6224097-6224119 CTGGGAGTGCAGGGCTGGTGGGG + Intronic
1092171917 12:6378858-6378880 AGGGGAAGGCAGCCCTGGGTTGG - Intronic
1092193224 12:6534720-6534742 CTGGGCATGGAGGCCTGGTGGGG + Intronic
1092404572 12:8210005-8210027 TGGGGAAGGAAGGCCGGGCGCGG - Intergenic
1092902811 12:13075744-13075766 AAAGGAAGGCAGGCCTGGTGCGG - Intronic
1092931170 12:13317254-13317276 CAGGGCAGGCAGGGCTGCTGAGG - Intergenic
1093765223 12:22954456-22954478 AGTGGAATGCAGGCCGGGTGAGG + Intergenic
1096214719 12:49792729-49792751 CAGGGAAGGCTGGCATGCTGGGG + Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096801346 12:54112587-54112609 GGGGGGAGGCGGGCATGGTGGGG + Intergenic
1102372697 12:112395526-112395548 CTTTTAAGGCAGGCCTGGTGGGG - Intergenic
1102465895 12:113130698-113130720 GGGGGAAGGCAGGGCTGGTCGGG + Intronic
1103446346 12:120997465-120997487 CGTGGAGGCCAGGCCTGGAGTGG - Exonic
1103599637 12:122046271-122046293 TGGGGAGGGCAGGCCAGGTCTGG + Intronic
1104724686 12:131068423-131068445 CGGGGAGGGAAGGCGTGGAGTGG + Intronic
1104761075 12:131297836-131297858 GCAGAAAGGCAGGCCTGGTGCGG + Intergenic
1104783833 12:131437415-131437437 AGGGGAGGGCAGGCCCAGTGGGG + Intergenic
1104818702 12:131662956-131662978 GCAGAAAGGCAGGCCTGGTGCGG - Intergenic
1104931617 12:132342186-132342208 AGGGGAAGGCAGGCTGGGTTTGG - Intergenic
1105202151 13:18190158-18190180 CTGGGATGGCATGCCTGCTGCGG - Intergenic
1105843455 13:24275006-24275028 GGGGGAGGGTAGTCCTGGTGAGG - Intronic
1105896139 13:24718642-24718664 ATGGGAAGGCAGGGCTGGTGCGG + Intergenic
1105930494 13:25047509-25047531 CGGGGCAGGCAGACCTGGGGTGG + Intergenic
1106480705 13:30135145-30135167 CTGGGGAGGCAGCGCTGGTGTGG + Intergenic
1106717461 13:32406197-32406219 TGGGGCAGGAAGGCCGGGTGCGG - Intronic
1106780295 13:33052305-33052327 TGAGGAAGGGAGGCCTGGGGAGG + Intronic
1108848201 13:54699974-54699996 AGGGCAAGGCAGGCATGGAGTGG + Intergenic
1110029159 13:70584161-70584183 CGGGGCAGGCAGGGCTCCTGGGG - Intergenic
1111337880 13:86846424-86846446 AGGGGAAGGGGGGGCTGGTGTGG + Intergenic
1112407753 13:99136126-99136148 CTGGGAAGGGAGGCCTGGCAGGG + Intergenic
1113388671 13:109874620-109874642 GAGGGAAGGCAGGCCTGTGGTGG - Intergenic
1113511162 13:110855733-110855755 CTGGGAAGACAGGACGGGTGTGG - Intergenic
1113616472 13:111684191-111684213 CGTGGCAGCCATGCCTGGTGGGG + Intergenic
1113622002 13:111769462-111769484 CGTGGCAGCCATGCCTGGTGGGG + Intergenic
1114633239 14:24172795-24172817 AAGGGAAGGAGGGCCTGGTGCGG + Intronic
1114663778 14:24367153-24367175 CGGGAAAGTCAGGCTTGGAGAGG - Exonic
1115780071 14:36759183-36759205 ATGTGAAGGCAGGCCTGCTGGGG - Intronic
1117299040 14:54406016-54406038 CTTGTAAGGCAGGCCTGGTGGGG + Intronic
1118592528 14:67412081-67412103 CGGGGAAGGCGCACCTGGGGTGG - Exonic
1119162229 14:72462229-72462251 CAGGGAAGAAAGGCATGGTGAGG + Intronic
1122316175 14:100827225-100827247 CTGGGCCGGCGGGCCTGGTGGGG + Intergenic
1122631328 14:103109025-103109047 CCTGGAAGACAGGCCTGCTGGGG - Intronic
1123222788 14:106872540-106872562 GGAGGACGACAGGCCTGGTGCGG - Intergenic
1123414247 15:20083454-20083476 AAGGGAAGGCAGGCAGGGTGGGG + Intergenic
1123523589 15:21090565-21090587 AAGGGAAGGCAGGCAGGGTGGGG + Intergenic
1124072684 15:26410582-26410604 TGGCCAAGGCAGGCCTTGTGAGG - Intergenic
1124187059 15:27540174-27540196 CAGGGCAGGCAGGACTGCTGGGG - Exonic
1124431689 15:29613925-29613947 GGAAGAAGGCAGTCCTGGTGGGG - Intergenic
1124453654 15:29821864-29821886 CGGGGTGGGCAGGGCTGGCGCGG - Intronic
1126211612 15:46106478-46106500 CTTGTAAGGCAGGCCTGGTGGGG - Intergenic
1127174481 15:56339090-56339112 AGGAGAATACAGGCCTGGTGTGG + Intronic
1127258095 15:57308024-57308046 TGGGGAAGGCAGGGGTGGGGCGG - Intergenic
1128142504 15:65312063-65312085 CAGGGAAGGAAGGCTTAGTGGGG + Intergenic
1128700218 15:69798531-69798553 CTGGGATGGCAGGCCTGGCAGGG + Intergenic
1129253336 15:74320451-74320473 GGTGGGAGGCAGGCCTTGTGTGG - Intronic
1129595875 15:76963761-76963783 CTGGGAAGGCAGGTCAGGCGGGG + Intergenic
1129700469 15:77765122-77765144 CTGGGAAAGCAGGCCTGGCATGG + Intronic
1130115494 15:81001670-81001692 CGGGGAAGTGCCGCCTGGTGGGG + Exonic
1130558972 15:84944099-84944121 ACAGGCAGGCAGGCCTGGTGGGG + Intronic
1130848475 15:87769537-87769559 CTTGTAAGGCAGGCCTGGTGAGG - Intergenic
1131362855 15:91809487-91809509 CGGCGAGGGCAGGCCTTGTTTGG - Intergenic
1131376897 15:91932385-91932407 CGGAGAAGGGAGGCCAGGTAGGG - Intronic
1131383420 15:91982901-91982923 CAGGGAAGGCATCCCTGGAGAGG - Intronic
1132710877 16:1266662-1266684 CGGGGAAGGCAGGCAGGGATGGG + Intergenic
1132718972 16:1306644-1306666 CAGAGAGGGCAGGGCTGGTGAGG - Intergenic
1132746487 16:1438416-1438438 CAGGGAGGGCAGGCTGGGTGAGG + Intronic
1132815943 16:1826664-1826686 CGGGGGACGCGGGCCTGGCGGGG - Intronic
1132841565 16:1980687-1980709 CGGTGGAGGCGGGCCTGCTGCGG - Exonic
1132901572 16:2257891-2257913 CTGGGCTGCCAGGCCTGGTGGGG - Intronic
1134446408 16:14334508-14334530 CGTGGAAGGCAGGATTGGTGTGG + Intergenic
1135635039 16:24068327-24068349 CAGGGAAGGCAGGACTTGAGGGG - Intronic
1136115511 16:28091872-28091894 TGGGGAAGGCAGGCATGGGTAGG + Intergenic
1136617349 16:31406583-31406605 GCTGGAAGGCAGGCTTGGTGGGG + Intronic
1136713366 16:32258194-32258216 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1136754545 16:32671237-32671259 TGGGGCAGGCAGGCAGGGTGGGG + Intergenic
1136813567 16:33199127-33199149 TGGGGCAGGCAGGCAGGGTGGGG - Intronic
1136820043 16:33309207-33309229 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1136826607 16:33365747-33365769 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1136831673 16:33464518-33464540 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1137253815 16:46759090-46759112 CAGGGAAACCTGGCCTGGTGAGG + Intronic
1137868025 16:51921543-51921565 AGGGGCACACAGGCCTGGTGAGG + Intergenic
1138450691 16:57092274-57092296 CGGGCAAAGCAGGCCTGGGGAGG + Intergenic
1138484469 16:57328960-57328982 CAATGAAGGCAGGCCAGGTGCGG - Intergenic
1138537329 16:57666977-57666999 AGGAGAAGGCTGGCCAGGTGTGG + Intergenic
1140393244 16:74606614-74606636 CGGGAGGGCCAGGCCTGGTGCGG - Intronic
1140457534 16:75113880-75113902 GGGAGATGGCAGGCCAGGTGAGG + Intronic
1141593312 16:85082729-85082751 CGGGGAGGGCGGCCCTGGGGAGG + Intronic
1141596682 16:85101159-85101181 CAGGGATGGCAGGCTTTGTGGGG + Intronic
1141954864 16:87364007-87364029 CGGGGAGGGCAGGGCTGGCGGGG + Intronic
1142138120 16:88460890-88460912 GAGGGATGGGAGGCCTGGTGAGG + Intronic
1142138245 16:88461208-88461230 CAGGGGCGGGAGGCCTGGTGAGG + Intronic
1142288280 16:89180422-89180444 CGGGGAGGAGAAGCCTGGTGGGG - Intronic
1202992144 16_KI270728v1_random:22102-22124 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1203056692 16_KI270728v1_random:931568-931590 TGGGGCAGGCAGGCAGGGTGGGG + Intergenic
1142868826 17:2807743-2807765 GGGGGAAGGCAGGCCACGTCTGG + Intronic
1142883020 17:2895866-2895888 AGGGGAGGGCAGGCCGGGCGCGG - Intronic
1143025064 17:3936644-3936666 TGGGGAAGGCAGGACTGGCCAGG - Intronic
1143479026 17:7218185-7218207 AGGGGCAGGCAGGGCTGGAGGGG - Intronic
1143724002 17:8833032-8833054 CGGCGAGGGCTGGCCTGTTGGGG + Exonic
1143765969 17:9138022-9138044 CAGGGAAGGCTGGGCTGGGGAGG - Intronic
1143867054 17:9931559-9931581 AGGGGAAGGGAGGCCTTGAGGGG + Intronic
1144586604 17:16491527-16491549 GGAGGAAGGCTGGCCGGGTGAGG - Intronic
1145246472 17:21273029-21273051 CGGGGAAGGCTGCCCTGGAGAGG + Intergenic
1145815758 17:27793846-27793868 CGGGGAAGGCAGGGAAGGAGGGG - Intronic
1146947261 17:36882396-36882418 GGGGAAAGGCAGGCCTGAAGAGG - Intergenic
1147264106 17:39224874-39224896 CGGGGAATGCAGGACTGCGGAGG + Intronic
1147726065 17:42566890-42566912 CGGGGAGGGCAGGCACGGCGGGG + Intergenic
1147731842 17:42609139-42609161 GGGTGCAGGCAGCCCTGGTGTGG - Exonic
1147755207 17:42762897-42762919 GGGAGGAGGGAGGCCTGGTGGGG - Exonic
1147991021 17:44333557-44333579 CAGGGAAAGCTGGCCTGGGGCGG + Intergenic
1148437690 17:47695701-47695723 TGGGGAAGTAAGGCCTGGGGTGG + Exonic
1148542651 17:48492702-48492724 CGTGGGAGCCAGGCCTGGGGTGG + Intergenic
1148878553 17:50707674-50707696 CGGGGCAGGCGGGCCTGGGCGGG - Exonic
1148911801 17:50946935-50946957 CAGGGGAGGAAGGCCTGGAGGGG + Intergenic
1149577348 17:57723740-57723762 CGGGGAACTCAGGCCTTCTGCGG - Intergenic
1149963282 17:61136058-61136080 CGGGGAAGGCAGGCGCGAAGGGG - Intronic
1151557146 17:74852270-74852292 CGGCGCAGGCCGGTCTGGTGGGG - Exonic
1151894229 17:76969362-76969384 AGGAGAAGGCAGGGCTGGGGCGG - Intergenic
1151969707 17:77451344-77451366 CTGGGAAGGGAGGCTCGGTGGGG - Intronic
1152637415 17:81435791-81435813 GGGGGAAGGCAGGGCTGCTGCGG - Intronic
1152872502 17:82764352-82764374 AGGAGAAAGCAGGCCGGGTGCGG + Intronic
1152925356 17:83085166-83085188 CGGGGACGGCAGGCCCGGCCGGG + Exonic
1153276663 18:3374249-3374271 CAGGGAATGCAGGCTGGGTGGGG + Intergenic
1153329878 18:3862883-3862905 CGGGGCAGGGAGGCCCAGTGAGG - Intronic
1153413750 18:4823101-4823123 ACTGGAAGGCAGGACTGGTGGGG + Intergenic
1153515224 18:5895607-5895629 CGGGGAAGGCCGGCGGCGTGGGG - Intronic
1153841434 18:9011541-9011563 CTGGGAAGGCAGGGCTGTGGTGG + Intergenic
1156368122 18:36448435-36448457 AGGGCAGGGCAGGGCTGGTGGGG - Intronic
1156505404 18:37587415-37587437 CGGGTAAGTCAGGCCTGTTTTGG + Intergenic
1156991632 18:43415762-43415784 CTGAGAAGGTAAGCCTGGTGAGG - Intergenic
1157200418 18:45654578-45654600 TGGGGAAGACAGTCCTGGGGTGG + Intronic
1157551973 18:48588399-48588421 CTCAGAAGACAGGCCTGGTGTGG - Intronic
1157582783 18:48782973-48782995 CTGGGAAGCCAGGCCTGGGCAGG - Intronic
1157750666 18:50175209-50175231 AGAGGGAGGCAGGCATGGTGTGG - Intronic
1158491173 18:57910929-57910951 TGGGGAAGGCAGGTCTGGAAGGG + Intergenic
1159076669 18:63688483-63688505 CAGGGAAGCCCTGCCTGGTGAGG - Intronic
1160536842 18:79599038-79599060 CGAGGCAGGCAGGCCTGGGAAGG + Intergenic
1160538042 18:79605742-79605764 CGGGGAACGCAGACTGGGTGTGG - Intergenic
1160538046 18:79605760-79605782 CGGGGAACGTAGACCTGGCGGGG - Intergenic
1160538051 18:79605778-79605800 CAGGGAACGCAGACCTGGCGGGG - Intergenic
1160538064 18:79605832-79605854 TGAGGAAGGCAGACCAGGTGAGG - Intergenic
1160832795 19:1111487-1111509 CGGGGTAAGCTGGGCTGGTGGGG - Exonic
1160848136 19:1175706-1175728 CGGGCAAAGAAGGCCTGGTAAGG + Intergenic
1160947199 19:1649135-1649157 CGGAGCAGGCAGGCCCGGTGGGG - Intronic
1161046497 19:2137696-2137718 CTGGGACGGCAAGGCTGGTGGGG - Intronic
1161974840 19:7602726-7602748 CGGGGTAGGGTGGCCTGGGGTGG + Intronic
1162451846 19:10759730-10759752 CGGGGAAGGAAGTCCCTGTGAGG - Exonic
1163218559 19:15897994-15898016 TGGGGGTGGCAGGCCTGGGGGGG - Intronic
1163524774 19:17814059-17814081 CAGGGAAGGCAAGCCTGGTAAGG - Intergenic
1163783300 19:19261627-19261649 TGGGGAAGGCAGGCCCGGGAGGG - Intronic
1163828205 19:19535505-19535527 TGGGGAAGGCAGGCAGGGTCAGG - Intronic
1164518559 19:28958244-28958266 GGGGGAAGCCAGTCCTGGGGAGG - Intergenic
1164616020 19:29667193-29667215 CGAGGAAGGAAGGCCTTGGGAGG - Intronic
1165110204 19:33497901-33497923 GGGGAAAGGGAGGCCTGGAGGGG + Intronic
1165733397 19:38160690-38160712 TGTGGATGTCAGGCCTGGTGCGG - Intronic
1165822250 19:38684029-38684051 CGTGGAAAGCAGACTTGGTGAGG + Intronic
1166012248 19:39951176-39951198 GGGGGAAAGCAGCCCTGGTATGG + Intergenic
1166567911 19:43776338-43776360 AGGGGAAGGCGGAGCTGGTGGGG + Intronic
1167019223 19:46861437-46861459 CGGGGACAGCAGGGCTGGGGCGG - Intergenic
1167406501 19:49312339-49312361 CAGGGAAGGCATCTCTGGTGAGG - Intronic
1167474890 19:49694338-49694360 AGGGGGTGGCAGGCCAGGTGCGG + Intronic
1168407942 19:56120625-56120647 AGGGGAAGGAAGGGCTGGGGGGG + Intronic
926101918 2:10123178-10123200 CGCGGGAGGCAGCCCTGGGGAGG - Intronic
926161730 2:10494532-10494554 CGGGGAGGCCAGGGCTGGGGCGG + Intergenic
926748710 2:16181365-16181387 CCGGGAAGCCAGGCGTGGTCTGG + Intergenic
927523891 2:23720281-23720303 CCAGGAGGGCAGGCCAGGTGTGG + Intergenic
928178758 2:29053039-29053061 CAGGCAAGGCAGGCCTGGTAAGG + Exonic
928247867 2:29646805-29646827 CAAGGAAGGCAGGAGTGGTGTGG - Intronic
928750863 2:34468471-34468493 CTTGTAAGGCAGGCCTAGTGGGG - Intergenic
929116321 2:38447402-38447424 TGGGCAAGGCAGGCCTGGTAGGG + Intergenic
929441032 2:41965921-41965943 TGGGGATGGCAGCACTGGTGAGG + Intergenic
929516151 2:42605995-42606017 CGGGGGCGGCTGGCCAGGTGGGG + Intronic
929544103 2:42844517-42844539 AGGGCAAAGCAGGCCGGGTGCGG - Intergenic
929753732 2:44745218-44745240 TGGGGAAGGCAGGTCTGGCCAGG + Intronic
929757745 2:44781355-44781377 GGGGGAAGGGAGGAGTGGTGGGG + Intergenic
930051559 2:47220013-47220035 AGGGGTAGGCAGGGCTTGTGAGG + Intergenic
930100055 2:47596449-47596471 CTGGGAAGGAAGACCTGGTGTGG + Intergenic
931629053 2:64283203-64283225 AGGGGAAGGCAGCCCAGGTGAGG + Intergenic
932338226 2:70943233-70943255 AGGGAAATGCAGTCCTGGTGAGG + Intronic
933697546 2:85231149-85231171 CCAGGAAGCCAGGCCTGTTGAGG + Intronic
933741761 2:85539362-85539384 CGGGGAAGGCCACCCAGGTGAGG + Exonic
933968490 2:87450795-87450817 GGGGGAAGTAAGGGCTGGTGAGG - Intergenic
934580518 2:95434231-95434253 CAGGGAAGGCAGGCGCTGTGTGG + Intergenic
934598930 2:95642486-95642508 CAGGGAAGGCAGGCGCTGTGTGG - Intergenic
934923674 2:98366601-98366623 CGGGGAGGCCCTGCCTGGTGAGG + Intronic
935201244 2:100858532-100858554 TGGGGAAGGCTGGCCTGATGTGG + Intronic
936061702 2:109299055-109299077 TGGGGAAGACAGGGCTGGTGTGG - Intronic
936325302 2:111499709-111499731 GGGGGAAGTAAGGGCTGGTGAGG + Intergenic
936437706 2:112522471-112522493 CTGGGCAGGCTTGCCTGGTGAGG + Intronic
936532276 2:113284480-113284502 CAGGGAAGGCAGGCACTGTGTGG - Intergenic
937218727 2:120329298-120329320 AGGGGATGGGAGGCCTGGTTGGG - Intergenic
937293247 2:120794556-120794578 CGGGAGAGGCAGTGCTGGTGAGG + Intronic
937371455 2:121300482-121300504 AAGGCAAGGCAGGCCAGGTGCGG - Intergenic
937811985 2:126209711-126209733 AGGGCAAGGGAGGCCGGGTGCGG + Intergenic
938068216 2:128293092-128293114 TTGGGGAGGGAGGCCTGGTGTGG - Intronic
938079681 2:128363067-128363089 CGGGGAAGGCAGGAGCGGTGCGG + Intergenic
938339582 2:130526728-130526750 AGGGCAGGGCAGGCCTGGTCAGG + Intronic
938350254 2:130594022-130594044 AGGGCAGGGCAGGCCTGGTCAGG - Intronic
938765616 2:134459156-134459178 AGGGGAAGCCAGGCCTGGCGTGG - Intronic
938778404 2:134561721-134561743 TGTGGGAGGCAGGCCTGGTCAGG + Intronic
938965150 2:136381645-136381667 CAGGGAGGAAAGGCCTGGTGGGG + Intergenic
939598991 2:144165079-144165101 TAGGGAAGGCTGGCCAGGTGCGG + Intronic
940764042 2:157770494-157770516 AGGGAAAGGCAGGTATGGTGAGG - Exonic
941996152 2:171603849-171603871 AGGGGAAGACAGGCCGGGTGCGG - Intergenic
942344911 2:174992718-174992740 TGGGCTATGCAGGCCTGGTGGGG - Intronic
943628669 2:190226303-190226325 AGAGGAAGTCAGGCCAGGTGCGG + Intronic
943669852 2:190649030-190649052 CGGGGAAGGCAGGGGAGGGGAGG + Intronic
946019982 2:216634108-216634130 CGCGGAAGTCAGGCCCGGGGAGG + Intronic
946035064 2:216735211-216735233 TTCGGAGGGCAGGCCTGGTGAGG + Intergenic
946184618 2:217973061-217973083 AGTGGAAGGCAGGCAGGGTGTGG + Intronic
946257648 2:218457755-218457777 TGGGGAAGGAAGGCCAGGCGTGG + Intronic
946329494 2:219001482-219001504 AGGGCAAGGCAGGGCGGGTGGGG + Intergenic
947521574 2:230849935-230849957 CGGGGAAGGCAGGGGTGCCGAGG + Intergenic
947537296 2:230948258-230948280 TGGGGAAGTCAGGCCTGGAGGGG - Intronic
947791383 2:232871254-232871276 GGGGGACGACAGGCCTGGGGAGG + Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
947929531 2:233952364-233952386 CGAGGGAGCCTGGCCTGGTGTGG + Intronic
948030570 2:234814274-234814296 TGGGGAATGCCGGCCTGGAGTGG + Intergenic
948050368 2:234975317-234975339 TGGGGAAGCCAGGCCTGGCGAGG + Intronic
948496406 2:238352540-238352562 TGGGGACGGGAGGCCAGGTGTGG + Intronic
948503567 2:238411825-238411847 CGGGGAAGGCAGGATCGGGGGGG + Intergenic
948619516 2:239225595-239225617 CGGGGAAGGCAGGTCGGCAGGGG + Intronic
948835399 2:240623906-240623928 CAGGGAGGCCAGGCCTGGTGGGG + Intronic
948897861 2:240935530-240935552 AGGGGCAGGCAGCCCTGCTGGGG + Intronic
948940810 2:241195466-241195488 TGGGGAACGGAGGCCTGGAGAGG - Intronic
949009720 2:241671615-241671637 CCGGGCAGGCAGCGCTGGTGGGG - Intronic
1169122716 20:3107003-3107025 CGGGGGAAGCAGGGCAGGTGTGG + Intergenic
1169204702 20:3733065-3733087 AGGGGCTGGCAGGACTGGTGTGG + Intronic
1169324986 20:4668397-4668419 AGAGGAAGACAGGCCGGGTGTGG - Intergenic
1170120062 20:12901762-12901784 AGGTGAAGGCAGGCCAGGTGTGG - Intergenic
1170488710 20:16847716-16847738 ATGGGAAGTCAGGCCAGGTGCGG - Intergenic
1172113340 20:32560114-32560136 AGGGGAAGGGAGCACTGGTGAGG + Intronic
1172409347 20:34710132-34710154 TGGAGAAGGCGGGCCAGGTGCGG + Exonic
1173436286 20:43034878-43034900 GGGTGAAGGCAGGCGTTGTGGGG - Intronic
1173993150 20:47318405-47318427 TGGGGAAGGGAGGCCTGTTTGGG - Intronic
1174087722 20:48020763-48020785 CGGGAAGGGCAGCCTTGGTGGGG + Intergenic
1174342176 20:49904912-49904934 GGGGGAAGTCAGTCCTGCTGTGG + Exonic
1174690239 20:52496863-52496885 CTGGGATGACAGGCCGGGTGTGG + Intergenic
1175224136 20:57434999-57435021 AGGGGAAGGCAGGAATGGCGTGG + Intergenic
1175276569 20:57774727-57774749 CCCAGAAGGCAGGCCTAGTGGGG + Intergenic
1175785443 20:61708980-61709002 CGGGGAAGGCAGGGCTGAGCAGG - Intronic
1176020263 20:62959060-62959082 AGGGGAGGACAGGCCTGGCGGGG + Intronic
1176030724 20:63009906-63009928 TGGGGAAGGGAGGTCTGGTGGGG + Intergenic
1176715801 21:10347850-10347872 CTGGGATGGCATGCCTGCTGCGG + Intergenic
1178364763 21:31980358-31980380 AGAAGAAGACAGGCCTGGTGCGG - Intronic
1179629162 21:42666085-42666107 AGGGGAAAGCAGCCCTGGGGTGG + Intronic
1180170987 21:46058079-46058101 GGGAGACGGCAGGGCTGGTGCGG + Intergenic
1180602540 22:17032103-17032125 CTGGGATGGCATGCCTGCTGCGG - Intergenic
1180831654 22:18909940-18909962 TGGGGAAGACTGGCCAGGTGGGG - Intronic
1181068205 22:20316449-20316471 TGGGGAAGACTGGCCAGGTGGGG + Intronic
1181588662 22:23869052-23869074 CTTAGAAGCCAGGCCTGGTGAGG + Intronic
1182236362 22:28880031-28880053 AGGGGAAGGCAGGCCAAGGGAGG + Intergenic
1182236748 22:28882931-28882953 CGGGGAAGGCCGGGATGGTCAGG - Intergenic
1182312304 22:29417916-29417938 CGGGGAAGGCAGACCTTGAATGG + Intronic
1182435352 22:30326511-30326533 CTAGGAAGGCAGGGGTGGTGGGG + Intronic
1182495190 22:30702022-30702044 AGGGGGAGGCAGGTTTGGTGGGG - Intronic
1182545872 22:31076114-31076136 AAGGGAAGGCAGGCAGGGTGGGG - Intronic
1182773001 22:32809389-32809411 CAGGGAAGGCATGTCTGGAGAGG - Intronic
1182773254 22:32811180-32811202 CAGGGAAGGCATGTCTGGAGAGG + Intronic
1183378805 22:37480442-37480464 CGGGGAAGGCAGACCTGCCCAGG + Intronic
1183549183 22:38471291-38471313 CCTGGGAGGCAGCCCTGGTGGGG - Intronic
1184108721 22:42383228-42383250 TGGGGGAGGCAGGCCCAGTGAGG + Exonic
1184226210 22:43130144-43130166 CCTGGGAGGGAGGCCTGGTGGGG - Intergenic
1184241270 22:43212389-43212411 CGGGGTGGGCGGGCGTGGTGGGG + Intronic
1184247301 22:43242158-43242180 CAGGACAGGCGGGCCTGGTGGGG + Intronic
1184276454 22:43411878-43411900 CGGGGAGGGCGGGCGTGGGGAGG + Intronic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
1184681408 22:46074172-46074194 CACGGAGGGCAGGCATGGTGTGG + Intronic
1184940496 22:47761327-47761349 CTGGGAAGACAGGCATGGTGAGG - Intergenic
1185081682 22:48712864-48712886 AGGGACAGGCAGGGCTGGTGGGG + Intronic
1185213876 22:49587510-49587532 TGGGGAGGGCGGGCCTGGAGGGG - Intronic
1185249262 22:49791178-49791200 CGGGGAAGTCAGCCCTGGCAGGG + Intronic
1185410242 22:50677982-50678004 TGGGGAAGTGAGGCCTTGTGGGG + Intergenic
1203281734 22_KI270734v1_random:135211-135233 TGGGGAAGACTGGCCAGGTGGGG - Intergenic
949507150 3:4738847-4738869 GGGGGAACGCAGGGGTGGTGTGG + Intronic
951375928 3:21917139-21917161 CGTGGAAGTCTGGCCTGGTGCGG + Intronic
952702243 3:36339705-36339727 CTGGCAAGGCAGGGCTGGGGTGG + Intergenic
953906527 3:46871222-46871244 CGTGCCAGGCAGGCCTGGTAGGG - Intronic
953916140 3:46922342-46922364 AGGTGAAGGCTGGCCTGATGTGG + Intronic
954221016 3:49154024-49154046 AGGGCAAGGCAGGCCTGCTCTGG + Intergenic
954238049 3:49272096-49272118 GAGGAAAGGGAGGCCTGGTGAGG - Intronic
954465511 3:50652255-50652277 GGGGGAGGGCAGGCCGTGTGTGG + Intergenic
955625729 3:60917308-60917330 CAGGGAAGGCAAGCATGGTTTGG - Intronic
956856427 3:73279697-73279719 GGATGAATGCAGGCCTGGTGTGG - Intergenic
960768851 3:121169152-121169174 CTTGTAAGGCAGGCCTGGTGGGG - Intronic
960776709 3:121264274-121264296 CTTGTAAGGCAGGCCTGGTGGGG - Intronic
961624112 3:128247744-128247766 GGTGGAAGGCTGGCATGGTGAGG + Intronic
961713573 3:128844711-128844733 AGTGGAAGCCAGGCCTGGGGAGG + Intergenic
962253998 3:133858028-133858050 TGTGGGAGGCAGGCCTGGAGGGG - Intronic
962264352 3:133934839-133934861 AGGAGGAGGCAGGACTGGTGAGG + Intronic
963980451 3:151530677-151530699 CTTGTAAGGCAGGCCTGGTGGGG - Intergenic
964155431 3:153579560-153579582 TGAGTGAGGCAGGCCTGGTGGGG + Intergenic
965041842 3:163518959-163518981 CAGGGAAGGCAGGTCAGCTGGGG - Intergenic
967875865 3:194268134-194268156 GGAGGAGGCCAGGCCTGGTGGGG - Intergenic
968069021 3:195774397-195774419 CGGGGAACACAGGACAGGTGTGG - Intronic
968470679 4:781120-781142 CGAGGAAGGCAAGGCTGGTGGGG + Intergenic
968525787 4:1056100-1056122 CGGGGGAGACAGGGCTGCTGTGG - Intergenic
968657764 4:1785970-1785992 CGGGGAAGGGAGGCCTCAGGAGG + Intergenic
968849326 4:3068013-3068035 AGTGGAAGACAGGCCAGGTGTGG + Intergenic
968950232 4:3687699-3687721 CCGCGAAGCCAGGCCGGGTGCGG + Intergenic
968970864 4:3792986-3793008 CTGGGAAGGCAAGCCTGAAGGGG + Intergenic
969532736 4:7738887-7738909 TGGGGCAGACAGGCCTGGTGAGG - Intronic
969661039 4:8527890-8527912 TGGGGGAGGAAGGCCTGGGGAGG - Intergenic
971325326 4:25638730-25638752 AGGGGGAAGCAGGCCAGGTGCGG + Intergenic
971378294 4:26073326-26073348 AGGAAAATGCAGGCCTGGTGTGG + Intergenic
972743382 4:41909888-41909910 CTGGAAATGCAGGCCAGGTGTGG + Intergenic
973034608 4:45390544-45390566 GGGGGTAGGCAGTCGTGGTGGGG + Intergenic
976760246 4:88540905-88540927 CTTGTAAGGCAGGCCTGGTGGGG - Intronic
978333471 4:107641130-107641152 TGGGCAATGCAGGCCTGGTAAGG - Intronic
979533057 4:121789388-121789410 GAAGGAAGACAGGCCTGGTGTGG - Intergenic
981113186 4:140959049-140959071 CGAGCAAGGCAGGCCAGGTTGGG - Intronic
981694102 4:147542162-147542184 CGGGTAGGGCTGGGCTGGTGGGG - Intronic
983843687 4:172488819-172488841 CTGCGAAGGCAGTCCTGGGGTGG + Intronic
985425701 4:189828393-189828415 CTGCTAAGGCATGCCTGGTGAGG + Intergenic
985654348 5:1122134-1122156 CAGGGAAGACAGGGATGGTGTGG + Intergenic
986540979 5:8843507-8843529 GGGGAAAGGCAGGCGAGGTGGGG + Intergenic
986720376 5:10556809-10556831 TGGGGAAGCCAGGGATGGTGGGG + Intergenic
987627738 5:20424459-20424481 TGAGGAAGTGAGGCCTGGTGCGG + Intronic
987742463 5:21927777-21927799 TGGTGAAAACAGGCCTGGTGCGG + Intronic
988182398 5:27814330-27814352 AGGGGAAAGCAGGACTGCTGAGG + Intergenic
990803707 5:59633701-59633723 CTTGTAAGGCAGGCCTGGTGGGG - Intronic
991054565 5:62306747-62306769 CGGGGGAGGGAAGCCGGGTGGGG + Intronic
991960451 5:72039094-72039116 AGGGGGAGGCAGGCCAGGTAGGG - Intergenic
995341852 5:111069863-111069885 AGGGGAAGGCATGTCAGGTGAGG + Intergenic
996582011 5:125041519-125041541 GGGGAAAGGCAGGCTTGCTGGGG - Intergenic
996698022 5:126420477-126420499 AGTGGAAGGCAGGGCTGGTAGGG - Intronic
997530070 5:134576610-134576632 AGGGGATGGCTGGCATGGTGGGG - Intronic
997867636 5:137478956-137478978 GGGAGCAGGGAGGCCTGGTGTGG - Intronic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
998985962 5:147757094-147757116 AGGGAAAGGGAGGCATGGTGTGG + Intronic
999269349 5:150287466-150287488 GGGGCAAGGGAGCCCTGGTGTGG - Intronic
999287231 5:150401493-150401515 GGGGCCAGGCAGGCCTGGGGGGG - Intergenic
999458271 5:151736227-151736249 TGGAGAAGCCAGGCCAGGTGCGG + Intergenic
999737909 5:154526459-154526481 CGGGGAAGGAAGGGCTGTGGTGG + Intergenic
999883893 5:155898697-155898719 AGGGGATGGCTGGCATGGTGAGG - Intronic
1000502504 5:162068684-162068706 CAGGGACAGCAGTCCTGGTGAGG + Intronic
1002058538 5:176612483-176612505 GGTGGAAGGCAGCCATGGTGGGG + Intergenic
1002789496 6:426946-426968 CTGCCAAGGCAGGCCTGGGGTGG + Intergenic
1002863193 6:1097742-1097764 GGGGGAAGACAGCCCTGGCGGGG - Intergenic
1004000869 6:11595960-11595982 CTGACAAGGCAGGCCTGGTGAGG - Intergenic
1005749232 6:28867831-28867853 AGGGAAAAGCAGGCCGGGTGGGG - Intergenic
1006066874 6:31468386-31468408 CAGCCAAGGCAGGCCTGTTGTGG - Intergenic
1006105420 6:31713582-31713604 CTGGGAAGGCCAGCCTGATGAGG - Intronic
1006670343 6:35726369-35726391 TTGGGAAGGCAGGCCTGGCTTGG + Intronic
1007410068 6:41656475-41656497 TGAGGAAGGCAGGGCAGGTGTGG - Intergenic
1007432155 6:41782923-41782945 CAGGGAAGGGAGAGCTGGTGTGG + Intronic
1007775810 6:44223749-44223771 CGGAGAAGGGACGCCGGGTGGGG + Exonic
1007970014 6:46042469-46042491 TGGGGCAGGCAGGCCTTGGGAGG + Intronic
1009623042 6:66100366-66100388 GGAGGAAGGCATGCCTGGGGAGG - Intergenic
1010169842 6:72961656-72961678 TGGGGAAGGCAGGGTTGGTGGGG + Intronic
1010378949 6:75205385-75205407 CGGGGAGGGCAGGCGTGCGGCGG - Intronic
1011037178 6:82990566-82990588 AAGGAAAGGCAGGCCAGGTGTGG - Intronic
1013471930 6:110473813-110473835 AGGGGAAAACAGGCCAGGTGCGG - Intronic
1014383098 6:120768490-120768512 AGGGGAAGCCAGGCCGGGCGCGG - Intergenic
1015998176 6:139015793-139015815 AGGTGAAGGTAGGCCAGGTGCGG + Intergenic
1016103934 6:140138592-140138614 TGGCGAAGGCAGGCATGCTGAGG - Intergenic
1016373163 6:143394799-143394821 GGTGGAAGGCAGGACAGGTGAGG + Intergenic
1017666130 6:156721668-156721690 CAGGGAAGGCAGGGGTGGGGAGG - Intergenic
1018975880 6:168565325-168565347 CTGGCAGGGCTGGCCTGGTGAGG + Intronic
1019071697 6:169352046-169352068 CTTGTAAGGCAGGCCTGGTGGGG + Intergenic
1019485131 7:1285835-1285857 CCAGGAAGGCAGGGCTGGGGGGG - Intergenic
1019486680 7:1292656-1292678 CCGGGAGGGCTGGACTGGTGGGG + Intergenic
1019704405 7:2490620-2490642 GGAGGAAGTCAGGCCTGGGGAGG - Intergenic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1022471273 7:30683057-30683079 AGGGGCAGCCAGACCTGGTGAGG + Intronic
1023917549 7:44601426-44601448 CTGGCATGGCAGGACTGGTGGGG - Intergenic
1024555760 7:50602303-50602325 CGGGGACGGTAGCCTTGGTGGGG + Intronic
1025121529 7:56308062-56308084 TGTGGAAGGCAACCCTGGTGGGG + Intergenic
1026046025 7:66905744-66905766 GGGAGAAGCCGGGCCTGGTGAGG - Intergenic
1027148228 7:75713628-75713650 CAGGGATGAAAGGCCTGGTGGGG + Intronic
1027701963 7:81480401-81480423 CTTATAAGGCAGGCCTGGTGGGG - Intergenic
1028604751 7:92643594-92643616 CAGAGGAGGCAGGCCTGCTGAGG + Intronic
1029376557 7:100180546-100180568 CGGGGAAGACATGCTTGGAGAGG - Exonic
1029578656 7:101420578-101420600 GGTGAAAGGCAGGCCTCGTGAGG - Intronic
1029723014 7:102382726-102382748 TGGGGAAGACATGCTTGGTGAGG + Intronic
1031922372 7:127611635-127611657 CAGGGCAGGCAGGGCTGCTGTGG + Exonic
1032191294 7:129767389-129767411 CGGGGAGGGCAGGCCACATGAGG + Intergenic
1033513253 7:142081744-142081766 GGTGGAAGGCAGTGCTGGTGTGG + Intronic
1033583970 7:142760682-142760704 CTGGGAAGGGAGACCAGGTGGGG + Intronic
1033585438 7:142771256-142771278 CTGGGAAGGGAGACCAGGTGGGG + Intergenic
1034065741 7:148135556-148135578 AGTGGAAGACAGGCCGGGTGCGG + Intronic
1034182195 7:149147612-149147634 CGGGGAAGGCAGGGCCGGGTCGG + Exonic
1034223021 7:149460258-149460280 CGGGGAAGACAGGGCTGGGCCGG - Intronic
1034936022 7:155201533-155201555 TGAGCAAGGCAGGCGTGGTGGGG - Intergenic
1034939502 7:155221125-155221147 GGGGGAAGGCAGGGCCTGTGAGG - Intergenic
1034962476 7:155371576-155371598 CTGGGAACGCAGGGCAGGTGGGG + Intergenic
1035286535 7:157810545-157810567 CGGGGACGGCGGGACTGCTGGGG + Intronic
1035286553 7:157810593-157810615 CGGGGACGGCGGGACTGCTGGGG + Intronic
1035286622 7:157810817-157810839 CGGGGACGGCGGGACTGCTGGGG + Intronic
1035303537 7:157915437-157915459 CGGGGAAGGCGGGGGTGGGGGGG - Intronic
1035357551 7:158285613-158285635 TGGGAATGGCAGGCCTGATGAGG - Intronic
1035554337 8:554978-555000 TGGGGAAGGCTGTCCTGATGAGG - Intergenic
1036665542 8:10734781-10734803 CGGGGCTGGCAGGCCTGGCCGGG - Intronic
1037769634 8:21790737-21790759 CAGGGAGGGCAGGCCTGAAGGGG - Intronic
1037797655 8:22010201-22010223 CGGGGAGGTCAGGCCAGGTGGGG - Intergenic
1039134052 8:34299534-34299556 CTTGTAAGGCAGGCCTGGTGGGG - Intergenic
1039434787 8:37552608-37552630 CAGGGAAGACAGGCCTGGGCTGG - Intergenic
1039964083 8:42271406-42271428 CGGGGAAGGCGGGGCTGGGGCGG - Exonic
1040386161 8:46916317-46916339 GGGGGAACTCAGGCCTGCTGAGG + Intergenic
1041098544 8:54373498-54373520 CTGGAAAGGCAGGCCTGGGGAGG + Intergenic
1041673601 8:60516815-60516837 CGGGCAAGGCAGGCGCGGGGCGG + Intergenic
1042642405 8:70950962-70950984 AGGAGAAGGAAGGCCAGGTGCGG - Intergenic
1042689282 8:71479313-71479335 CAGGGTAGGCAGGCCTCGTGGGG - Intronic
1042951298 8:74203221-74203243 GTGGGAAAGCAGGCCTTGTGGGG + Intergenic
1043420632 8:80094912-80094934 TGGGAGAGGCAGGCCTGGTTAGG + Intronic
1044440653 8:92220245-92220267 CTTGTAAGGCAGGCCTGGTGGGG + Intergenic
1045319541 8:101071499-101071521 CGGGCAGGACAGGCCAGGTGCGG + Intergenic
1045907335 8:107362886-107362908 CTGGGAAGATAGGCATGGTGTGG - Intronic
1047292189 8:123540798-123540820 AGGGGCAGGCAGGGCTGGAGCGG - Intronic
1047591339 8:126330288-126330310 CTGGGACAGCAGGGCTGGTGTGG - Intergenic
1049241080 8:141537681-141537703 GGGGGAGGGCAGGGCTGATGGGG - Intergenic
1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG + Intergenic
1049408976 8:142464096-142464118 CGGGCAGGGCCGGCCCGGTGGGG - Exonic
1049431724 8:142568472-142568494 CAGGGAAGCCAGGCCTGGGATGG - Intergenic
1049471744 8:142777800-142777822 CGGGGAAGGCTGGGCTGCCGCGG - Exonic
1049797977 8:144505211-144505233 AGGGGAAGGCAGGGTTGGCGAGG - Intronic
1049922325 9:376947-376969 GGGAGAAGGCAGGCCTCATGGGG - Intronic
1050031972 9:1395316-1395338 CTTGTAAGGCAGGCCTGGTGTGG - Intergenic
1050442702 9:5682337-5682359 CTTTTAAGGCAGGCCTGGTGGGG + Intronic
1051408034 9:16760110-16760132 GGGGGAAGGCAGGACAGGAGAGG + Intronic
1051851597 9:21516025-21516047 CAGGCAAGACAGGGCTGGTGGGG - Intergenic
1052901148 9:33795848-33795870 CTGGGAAGGGAGACCAGGTGGGG + Intronic
1053293342 9:36896572-36896594 CAGGGAAGGGAGGGCTGGAGAGG - Intronic
1053418667 9:37963065-37963087 CGGGGAAGGCACTCCTGGGTTGG - Intronic
1056571999 9:87824691-87824713 CGGCGGAGGCGGGCGTGGTGGGG + Intergenic
1057037322 9:91820808-91820830 AGGGGAGGTCAGGCCAGGTGTGG + Intronic
1057279301 9:93698613-93698635 CAGGGAAGGCAGCCCTGGGCAGG - Intergenic
1057866515 9:98686175-98686197 TGGTGAAGGCAGGCCAGCTGGGG - Intronic
1057997069 9:99828468-99828490 GGGGGAAGGCCGGCGTGGTGGGG - Exonic
1059401174 9:114071424-114071446 CGTGGAAGGGAGGCCGAGTGGGG + Intronic
1060208245 9:121695070-121695092 CGGGGCAGGCAGGGCTGCTCAGG - Intronic
1060295562 9:122340771-122340793 AGGCTGAGGCAGGCCTGGTGGGG + Intergenic
1060418542 9:123450408-123450430 CTGTGAACTCAGGCCTGGTGGGG + Intronic
1060865170 9:126989570-126989592 AGTGGAAGGCAGGCCAGGGGTGG + Intronic
1061002684 9:127911186-127911208 CAGGGCAGGCAGGCCAGGAGTGG + Intronic
1061168058 9:128936041-128936063 CCTGGGAGGCAGGACTGGTGTGG - Intronic
1061187634 9:129063922-129063944 CAGGGAATGGAGGCCTCGTGTGG - Intronic
1061237428 9:129351149-129351171 CGGGGAAGGCGGGGCTGAAGAGG - Intergenic
1061259803 9:129473883-129473905 CGGTGAAGGGCGGCGTGGTGTGG - Intergenic
1061293842 9:129666623-129666645 CGGGGAAGAGAGGCCTGGCTGGG - Intronic
1061422707 9:130480759-130480781 TGGGGTGGGCAGGCCGGGTGTGG + Intronic
1061886964 9:133596033-133596055 GGTGCAAGGCAGGCATGGTGGGG + Intergenic
1062027410 9:134346914-134346936 GGGGGAGGGCAAGGCTGGTGGGG + Intronic
1062326110 9:136013309-136013331 CCGGAAAGGCAGGCAGGGTGAGG + Intronic
1062345377 9:136112032-136112054 CGAGGATGGCAGGTCTGCTGGGG + Intergenic
1062684452 9:137803050-137803072 CGGGGAAGGCGGCCCTAGTGTGG + Intronic
1062690156 9:137837511-137837533 CGGGGAGTGCAGGCCTGGGAAGG + Intronic
1186787045 X:12963761-12963783 ACGGGAAGGCTGGCCGGGTGGGG - Intergenic
1189255811 X:39638138-39638160 CTGGGAAGGCAGCCATGATGTGG - Intergenic
1189282452 X:39828349-39828371 CAGGCACGGCAGGCCGGGTGCGG + Intergenic
1189577926 X:42375302-42375324 CAGGGCAGGCAGGGCTGGTCAGG + Intergenic
1189649881 X:43177553-43177575 AGGGGAGGGGAGGCCAGGTGAGG - Intergenic
1190063321 X:47224347-47224369 GGGGTAGGGCAGGCCAGGTGGGG - Intronic
1190701593 X:52993323-52993345 TGGGGAAGGCATCCCTGGAGAGG - Intronic
1190815392 X:53924739-53924761 AGGGAAAGGCAGGCCGGGTGCGG - Intergenic
1191744891 X:64476129-64476151 CTTGTAGGGCAGGCCTGGTGGGG + Intergenic
1193295756 X:79829693-79829715 CCCGGAAGACATGCCTGGTGAGG + Intergenic
1195457332 X:105083778-105083800 CTTCTAAGGCAGGCCTGGTGGGG - Intronic
1195692818 X:107642230-107642252 ATGGGAAGGCAGGCCCAGTGTGG - Intronic
1195843727 X:109203650-109203672 AGGGGATGGCAGGCCAGGGGAGG - Intergenic
1196259035 X:113555844-113555866 ACCGGAAGGCAGGCCGGGTGCGG - Intergenic
1197606329 X:128589911-128589933 CAGACAAGGCAGGCCGGGTGCGG + Intergenic
1198085300 X:133276960-133276982 CGGGGAGGGCTGGGCCGGTGGGG - Intergenic
1198750327 X:139932258-139932280 CGGGTCAGGCAGGCCGGGGGCGG - Intronic
1199359893 X:146906298-146906320 AGGGCAAGTCAGGCCTGGAGTGG + Intergenic
1200036358 X:153334213-153334235 CGGCCCAGGCAGGCCTGGCGTGG - Exonic
1200089711 X:153628765-153628787 CTGGTGAGGCAGGCCTGCTGGGG - Intergenic
1200092544 X:153642648-153642670 GGGGGCAGCCAGGCCGGGTGGGG - Intronic
1200325845 X:155237920-155237942 GAGGGAAGGCAGGCCTGTTGGGG + Intronic