ID: 998823389

View in Genome Browser
Species Human (GRCh38)
Location 5:146077045-146077067
Sequence CTAAAAGGATGATGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998823389_998823393 3 Left 998823389 5:146077045-146077067 CCAATTTCCCATCATCCTTTTAG 0: 1
1: 0
2: 0
3: 27
4: 314
Right 998823393 5:146077071-146077093 TCTCCTTTCCTCCTCCAGCATGG No data
998823389_998823396 12 Left 998823389 5:146077045-146077067 CCAATTTCCCATCATCCTTTTAG 0: 1
1: 0
2: 0
3: 27
4: 314
Right 998823396 5:146077080-146077102 CTCCTCCAGCATGGTTAGTTTGG 0: 1
1: 0
2: 3
3: 3
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998823389 Original CRISPR CTAAAAGGATGATGGGAAAT TGG (reversed) Intronic
901220513 1:7580959-7580981 CTAAAAGGTTGTTGAGAAAATGG + Intronic
901373564 1:8820839-8820861 ATTAAAGGAAGATGGAAAATGGG + Intergenic
901986043 1:13076026-13076048 TTAAGAAGATGATGGGAAGTAGG + Intronic
901995766 1:13150741-13150763 TTAAGAAGATGATGGGAAGTAGG - Intergenic
902017597 1:13320737-13320759 TTAAGAAGATGATGGGAAGTAGG + Intronic
902030657 1:13419739-13419761 TTAACAAGATGATGGGAAGTAGG + Intronic
902752233 1:18524985-18525007 CTAAAAGTATCATGGGCCATAGG + Intergenic
903790375 1:25888839-25888861 GAAAAAGGAGGATGGGAAAAGGG + Intronic
905437592 1:37968151-37968173 GCAAAAGGATCATGTGAAATGGG + Intronic
907861605 1:58358977-58358999 CTCAAAGGATGCTGGGATCTAGG + Intronic
908298188 1:62734282-62734304 TTAAAAGGATCTGGGGAAATAGG + Intergenic
910200853 1:84697144-84697166 CTGAAAGGAGGATGGGGAACAGG - Intergenic
912144637 1:106778097-106778119 CATAAATGGTGATGGGAAATAGG + Intergenic
912943130 1:114062217-114062239 ATTAAAGGATGATGGGAAAACGG + Intergenic
913068848 1:115282104-115282126 CTAAAAGGATGTTGGAATAGTGG - Intergenic
913737766 1:121805034-121805056 CCAAAAGGTTGTTGGAAAATGGG + Intergenic
914431213 1:147621272-147621294 TTAAAAGGAAGAGGGGAAATGGG + Intronic
914522486 1:148430310-148430332 CAAAGAGAATGGTGGGAAATAGG + Intergenic
916491154 1:165303672-165303694 CGCAAAGCATGATGGGAAGTAGG + Intronic
916544555 1:165790753-165790775 CTAAAAGTATGATAGGACAATGG + Intronic
916819244 1:168382026-168382048 CTAAAATGATTATGAGAAAATGG + Intergenic
917088365 1:171327210-171327232 GTTAAAGGATGATTAGAAATTGG - Intronic
917089712 1:171340738-171340760 AACAAAGGATGATGGGAAAATGG - Intronic
917110754 1:171544869-171544891 TGAAAATGATCATGGGAAATGGG - Intronic
917186061 1:172357223-172357245 GTAAAAGTATGATGAGAAACAGG + Intronic
919074104 1:192793540-192793562 CTAAAAGGCTGAGTGGAAAGTGG - Intergenic
919667408 1:200305208-200305230 CTAATAGGAAGAGGGGGAATAGG + Intergenic
920681398 1:208075587-208075609 ATGAAAGTATGATGAGAAATAGG - Intronic
921727848 1:218543571-218543593 CTGAAAGGATGACAAGAAATAGG + Intergenic
922514636 1:226197885-226197907 CTGAAAGGATGATCAGAAAGGGG + Intergenic
922996401 1:229965774-229965796 CTGGAAGGATGATGGGTAAAGGG - Intergenic
923493366 1:234504102-234504124 CTAAAAGGACAATGGGAACAAGG - Intergenic
923634198 1:235679305-235679327 CTCAAAGCATGATCTGAAATGGG - Intronic
924672174 1:246140202-246140224 GTAAAAGGATGATGGGTTCTGGG + Intronic
1064626540 10:17267057-17267079 CAAAAAGGATAGTGGGAGATAGG - Intergenic
1065338153 10:24676230-24676252 CTTGAAGAATGATGGGAGATAGG - Intronic
1065650689 10:27887396-27887418 TTCAATGCATGATGGGAAATGGG - Intronic
1067363101 10:45600481-45600503 GTGAGAGGACGATGGGAAATAGG - Intergenic
1068408342 10:56623107-56623129 ATAAAAGATTGATGGGAAAGGGG - Intergenic
1068453140 10:57219489-57219511 ATAAAAGGATTATCTGAAATGGG + Intergenic
1068604891 10:58993986-58994008 CTAAAAGTGTCATGGGAGATTGG + Intergenic
1071296048 10:84220798-84220820 CTAAAAGGATGATTAGGAATGGG + Intronic
1072012729 10:91317722-91317744 GTTAGGGGATGATGGGAAATTGG + Intergenic
1072993207 10:100218174-100218196 CTAACAGTATAAAGGGAAATTGG - Intronic
1073534931 10:104268315-104268337 CTACAAGGTTGATGAGTAATAGG + Intergenic
1073630724 10:105146053-105146075 GTAAAAGGATGATGGGGGAGTGG - Intronic
1074524769 10:114253818-114253840 ATGAAAGGAAGATGGGAAAGGGG - Intronic
1076078080 10:127553471-127553493 TTAAAAGGATAATGCGACATTGG + Intergenic
1078554419 11:12309305-12309327 CTAAAGGGAAGCTGGGTAATGGG - Intronic
1079630786 11:22671990-22672012 AAAAAAGGATCATGAGAAATTGG + Intronic
1080752805 11:35166423-35166445 CTAATGGGATGATGGGGACTTGG - Intronic
1080912933 11:36623457-36623479 GAAAAAGGATGATGGGTTATAGG + Intronic
1081262296 11:40975469-40975491 TTTAAAGGATGAAGAGAAATTGG - Intronic
1081594124 11:44447439-44447461 CTGAAGGGCTGATGGGAAACAGG + Intergenic
1082213133 11:49530816-49530838 CAAAAAGGATGCAGAGAAATTGG - Intergenic
1084895047 11:72260145-72260167 CTAAAGAAATGATGGGAAAATGG - Intergenic
1085034304 11:73290976-73290998 CTAAAAGGCCGGTGGGTAATGGG + Intronic
1085227846 11:74938485-74938507 GTAAAAGTATGATGAGAAACAGG - Intronic
1086070975 11:82798649-82798671 CAAAAAGGAAGAAGAGAAATCGG + Intergenic
1086543437 11:87940402-87940424 CTAAAATGATCATTGGAAATAGG + Intergenic
1087609626 11:100418429-100418451 GTAAAAAGAAGATGGGAAAATGG + Intergenic
1088344851 11:108811381-108811403 CTAAAAGGATCATGGGGCACAGG + Intronic
1089633380 11:119797101-119797123 CTAAAGAGAGGATGGGGAATGGG - Intergenic
1089652564 11:119923913-119923935 CTAAATGGTAGATAGGAAATGGG - Intergenic
1090190022 11:124761403-124761425 CCAAAGGGAAGAGGGGAAATTGG - Intronic
1090215221 11:124956085-124956107 CTGACAGGATTATGGAAAATAGG + Intronic
1090563116 11:127955159-127955181 GTAAAAGTATGATGAGAAATGGG + Intergenic
1090653370 11:128825049-128825071 CTGAAAAGATGATGGTAATTCGG + Intergenic
1091382498 12:71178-71200 CTAAGATGCTGATGGGAACTGGG + Intronic
1092248230 12:6875629-6875651 CTAAAAGGATGACCAGGAATTGG + Intronic
1092726234 12:11488202-11488224 CTACTAGGAAGAAGGGAAATGGG + Intronic
1092807439 12:12237461-12237483 ATAAAAGTATGATGAGAAACAGG + Intronic
1093475382 12:19548938-19548960 CTAAAAGGAGGAAGGGAAGAAGG - Intronic
1093871035 12:24290858-24290880 CTTAAAGGATGATTAGAAGTAGG + Intergenic
1094032754 12:26031922-26031944 CTAACATGATGATGAGAAACAGG - Intronic
1094386554 12:29900719-29900741 CTGAAAGGAAGGTGGGAAACTGG + Intergenic
1095284434 12:40391309-40391331 AGAAAGGGATGATGGGAAAGAGG + Intergenic
1095505072 12:42888031-42888053 CAAAGAGGAGGATGTGAAATGGG + Intergenic
1095627825 12:44338491-44338513 CGAAAAAGATGGTGGAAAATAGG + Intronic
1095640171 12:44478130-44478152 CTGAAAGGAAAAGGGGAAATAGG + Intergenic
1096528028 12:52224927-52224949 CTATCAGGATGAAGGGAGATGGG + Intergenic
1097257698 12:57693050-57693072 CTAAAAAGCTGATTGGAAAGTGG + Intergenic
1097721016 12:63021545-63021567 CTCAAATGGTAATGGGAAATGGG + Intergenic
1097887743 12:64746812-64746834 TGAAAAGGATCATGAGAAATAGG - Intronic
1098972093 12:76867641-76867663 CAAAAAAGATGATGGGGAAAGGG - Intronic
1101542030 12:105673990-105674012 TGTAAAGGATTATGGGAAATTGG - Intergenic
1105807511 13:23964256-23964278 CTAATATGATGATGGGAGTTAGG + Intergenic
1107261020 13:38491332-38491354 CTTAAAGAATGATGATAAATAGG + Intergenic
1107521854 13:41190897-41190919 CTAAGTGGATGATGGGATTTGGG - Exonic
1110659513 13:78043099-78043121 TTAAAATTCTGATGGGAAATGGG + Intergenic
1110802036 13:79709378-79709400 ATAAAAGGCAGATGGCAAATTGG - Intergenic
1111673767 13:91361406-91361428 TTAAAATGATGATGGAATATTGG + Intergenic
1111724503 13:91988740-91988762 CTTAAAGCTTGATGGAAAATGGG - Intronic
1111835869 13:93387583-93387605 CTAAAAATAAGATGGGAAAATGG + Intronic
1111970021 13:94902266-94902288 CAAAAATGCTGATGGGATATGGG - Intergenic
1113357833 13:109600335-109600357 CTATAAAGATGATGGGAAGACGG + Intergenic
1114422072 14:22592683-22592705 CTGAAAGGATGAAGGGATATGGG - Intergenic
1114452861 14:22837973-22837995 CTAGAAGGGGGATGGGATATGGG + Intronic
1116997056 14:51335313-51335335 GTAGAGGGATGATGGGAACTGGG + Intergenic
1117626817 14:57649025-57649047 CTTGAAAGATGATGAGAAATAGG - Intronic
1119847836 14:77843905-77843927 CTAAAAGGAAGGTGGCAGATGGG - Intronic
1120673145 14:87387536-87387558 GTGAAAGGCTGATGGGAAATTGG + Intergenic
1123904196 15:24906048-24906070 CTAAAAGTATTATGTGACATGGG + Intronic
1124037842 15:26072767-26072789 ATATAAGGATAATGGGAAATAGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124692333 15:31834822-31834844 CTAAAAGGGTAATTGCAAATAGG + Intronic
1124868044 15:33513438-33513460 CTAAAATGATGACGTGGAATCGG + Intronic
1125081170 15:35675275-35675297 CTAAAAGGATTCAGGGAAAAAGG + Intergenic
1125859016 15:42980143-42980165 CTGAAAAGATGATGGAAATTAGG - Intronic
1126734651 15:51718616-51718638 CTTAAAGGATCAAGGGAAAATGG + Intronic
1129535172 15:76308266-76308288 GTAAAAGTCTGATGAGAAATAGG + Intronic
1131849532 15:96524209-96524231 CTAAAAGGAAGACCGGAGATAGG - Intergenic
1132162959 15:99560384-99560406 GTGAAAGGATGATGAGAAACAGG - Intergenic
1132776367 16:1597007-1597029 CTAAGGGGCTGATGGGAAAGTGG + Intronic
1132997905 16:2832871-2832893 CTTAAAGGATGAAGGACAATTGG + Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1135991615 16:27222033-27222055 CTAGAAGGGGGATGGGAAAGTGG + Intergenic
1139066776 16:63325400-63325422 CTAAGAGGAGGAGGGGAAGTTGG + Intergenic
1140337872 16:74128094-74128116 CTAAAACAATGATGGTAACTAGG + Intergenic
1141347757 16:83262973-83262995 CTAAATGACTGATAGGAAATGGG + Intronic
1143687305 17:8528278-8528300 CTAAAGGGGTGATGGGTAATAGG - Intronic
1143998943 17:11034550-11034572 CTAAGAGGATGTGGAGAAATAGG + Intergenic
1144223932 17:13126391-13126413 GTAAAAGTTTGAGGGGAAATAGG - Intergenic
1145074734 17:19842857-19842879 CTAACAGCCTGGTGGGAAATGGG - Intronic
1147967998 17:44204362-44204384 CTCAAAGGATGGTGGTAAGTGGG + Intergenic
1148154505 17:45415131-45415153 CAAAAAGGAGGAAGGGAAAAAGG - Intronic
1148578852 17:48729313-48729335 GTAAGAGGAGGCTGGGAAATGGG + Intergenic
1148752609 17:49954113-49954135 GTAAATGGATGATGCAAAATGGG - Intergenic
1149222330 17:54429346-54429368 CTCACAGGATAATGGGAAAATGG + Intergenic
1149787259 17:59446457-59446479 GTGAAAGGATGTTGGGGAATAGG + Intergenic
1149825808 17:59827065-59827087 CTAGAAGGATGCTGGGAGAGGGG - Intronic
1150386326 17:64764645-64764667 CGAAAAGGAGGAAGGGAAAAAGG - Intergenic
1153417760 18:4868071-4868093 CCAAAAAGATGAGAGGAAATGGG + Intergenic
1155040398 18:22060593-22060615 AGTAAAGGATGAAGGGAAATGGG - Intergenic
1156577338 18:38333206-38333228 GCAAAAGTATGATGAGAAATAGG - Intergenic
1157131541 18:45012257-45012279 GCAAAAGGATGAAGGGAAAGTGG + Intronic
1157851712 18:51059898-51059920 TTACCAGGATGATTGGAAATGGG - Exonic
1159159358 18:64623440-64623462 CTAAAATGATGATGGAGGATGGG + Intergenic
1159491053 18:69135056-69135078 GTAAAAGGATGAGGGCACATTGG - Intergenic
1163197781 19:15735914-15735936 TTAACAGGCAGATGGGAAATGGG - Intergenic
1163224082 19:15943043-15943065 TTAACAGGCAGATGGGAAATGGG - Intergenic
1164004666 19:21137432-21137454 CTAAAAGGAAGGTGGGCAACAGG - Intergenic
1165929127 19:39344671-39344693 CTGAAGGGATAATGGGAAAAGGG - Intronic
1168639311 19:58020219-58020241 CTGAAAGAAGGATGGGAACTGGG + Intergenic
925072357 2:980123-980145 CTATAAGGAGGATGGTAATTTGG - Intronic
926022124 2:9505560-9505582 CTAAATGGCTGATGTGAACTTGG + Intronic
926481125 2:13397116-13397138 CTAAAAGGATCATGGGTCAGGGG + Intergenic
928042826 2:27895675-27895697 ACAAAAGGATGATGAGAAACCGG - Intronic
928739548 2:34334034-34334056 ATAAATGCATGATGGGGAATGGG - Intergenic
929706674 2:44220057-44220079 CTAAAAGGATGGTGGTAATTTGG + Intronic
930686370 2:54312777-54312799 GCAAAAGCATGATGGGAAACAGG - Intergenic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
932123758 2:69125036-69125058 CTAAAGGGATGCAGGAAAATGGG + Intronic
932147575 2:69336509-69336531 CTAATAAGATGTTGGGATATTGG - Intronic
932461113 2:71882639-71882661 CTAAAAGGAAGATGGGTCCTGGG + Intergenic
937179307 2:119975930-119975952 ATAAAGGGATGGAGGGAAATGGG - Intronic
937624530 2:124027726-124027748 TTAAAATGTTGATTGGAAATAGG - Intronic
938235074 2:129699390-129699412 CTAAAAGGAGGAAGGAACATTGG + Intergenic
939831369 2:147075938-147075960 CCAAGAGGATGTTTGGAAATTGG - Intergenic
941247823 2:163122752-163122774 CTTAAATGATGATGAGAAAGAGG + Intergenic
941373547 2:164698906-164698928 CTAATATGAGGATGGGAACTGGG + Intronic
941884939 2:170518383-170518405 CTAAAATAAGGATGGCAAATAGG + Intronic
945918594 2:215731201-215731223 CTCAGATGATGCTGGGAAATAGG + Intergenic
945925807 2:215803244-215803266 CAAAAAGGATGTGGAGAAATTGG + Intergenic
946153567 2:217792439-217792461 ATAAAATGATTGTGGGAAATAGG - Intergenic
946159660 2:217828397-217828419 GTCAAAGGAAAATGGGAAATAGG + Intronic
947103556 2:226646550-226646572 CTGAAAGGAGGAAGGGAAAAGGG + Intergenic
947354326 2:229276342-229276364 CTGAAAAGAAGATGGGAATTGGG + Intergenic
947790612 2:232865863-232865885 CTCAAAGAATGATGGGAATATGG - Intronic
1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG + Intronic
1169786421 20:9364084-9364106 CTAAAAGGGTGAAAGAAAATTGG - Intronic
1170187529 20:13607580-13607602 GTTAAAGGAAGATTGGAAATTGG - Intronic
1170718726 20:18856187-18856209 CTCAGAGGAAGTTGGGAAATGGG + Intergenic
1172074673 20:32285550-32285572 CTGAAAGGATGGTGGGAACTGGG + Intronic
1173219917 20:41124073-41124095 AACAAAGGATGATGGGAAAATGG - Exonic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1175471001 20:59228326-59228348 CTGGCAGGTTGATGGGAAATTGG + Intronic
1176201608 20:63863304-63863326 ACAAAAGGATGATGGGAACGGGG + Exonic
1177647535 21:23918358-23918380 CCAAAAGGATGCTGGGCATTTGG - Intergenic
1178121042 21:29470493-29470515 CTAAAAGGAGGGTGAGTAATTGG + Intronic
1178288837 21:31349289-31349311 CTGAAAGGGTGAAGGGAAAAGGG + Intronic
1180196638 21:46200334-46200356 GTATAAGTATGATGAGAAATAGG + Intronic
1181719878 22:24765635-24765657 AACAAAGGATGATGGGAAAATGG - Intronic
1182582380 22:31322068-31322090 CTAAAAAGATGATGCAAAAGTGG + Intergenic
1183285666 22:36961269-36961291 CAAAAAGGATGATTGGAAACAGG + Intergenic
1183341719 22:37285171-37285193 CTAAAAATACGATGGGAAAGAGG + Intronic
1183578863 22:38710818-38710840 ATAAAAGGATGAGGGGAAAGAGG - Intronic
949164255 3:919098-919120 GTAAAAAGAGGATTGGAAATAGG - Intergenic
949798282 3:7875297-7875319 GTAAAAGGTTGATGGGTAACAGG + Intergenic
949950899 3:9227943-9227965 TTGAAAGGATGATGGTAAGTCGG + Intronic
950633484 3:14299288-14299310 TGAGAAGGATGATGGGAATTGGG + Intergenic
951043677 3:18015312-18015334 CAAAAAGGAAGAAGGGAGATGGG - Intronic
951896764 3:27616911-27616933 ATAAAAGGATGCTGAGATATTGG - Intergenic
953432132 3:42848662-42848684 ACAAAAGCATGATGAGAAATAGG + Intronic
953671822 3:44969393-44969415 CTAAAAGCAGGATGGGGAAGTGG - Intronic
954561080 3:51557011-51557033 CAGCAAGGATGATGGGAAAGGGG - Intronic
955668310 3:61374189-61374211 ATGAAAGGAAGATGGGAAAGGGG - Intergenic
958433556 3:94070674-94070696 TGAAAAGGGTGAAGGGAAATTGG - Intronic
959122973 3:102254715-102254737 CTTAAAGGATGATGTGAAGAGGG - Intronic
959274942 3:104266684-104266706 CTTAAAGTATGATTTGAAATTGG + Intergenic
959526377 3:107381872-107381894 TAAAAAAGATGATGGGAAATTGG - Intergenic
959663481 3:108895711-108895733 CTGAAGTGATGAAGGGAAATTGG + Intergenic
960064200 3:113353073-113353095 CTCAAAGGAGGATGGGCAAGTGG + Intronic
961612870 3:128154306-128154328 CTAAAAGGATGAGGGAAAGAGGG - Intronic
963224716 3:142850706-142850728 ATAAAAGGATCATGAGAAAATGG + Intronic
964598235 3:158463051-158463073 TTAAAAGAATAAAGGGAAATTGG - Intronic
964850584 3:161091915-161091937 ATAAAAGGTTGATGGACAATTGG + Intronic
964948910 3:162262759-162262781 GTAAAAGGTTTAGGGGAAATGGG + Intergenic
964985724 3:162735242-162735264 TTTCAAGTATGATGGGAAATGGG + Intergenic
965123506 3:164594511-164594533 CTAAAACCATGAAGGGAAAGAGG - Intergenic
969924533 4:10573887-10573909 CTGAAAGGATGATGAGCATTTGG - Intronic
970452724 4:16187802-16187824 CTAAAAGTGTAATGTGAAATTGG - Intronic
970470936 4:16378828-16378850 CTTAAAAGACCATGGGAAATAGG - Intergenic
970659280 4:18265620-18265642 ATAAAGAGATGATTGGAAATTGG - Intergenic
971443333 4:26714441-26714463 TTAAAAGGAGGATGGATAATTGG - Intronic
972091895 4:35297034-35297056 CTCAGAGGATGATGAGCAATAGG + Intergenic
974303066 4:60095167-60095189 ATAAATGGATGGTGGGAATTAGG - Intergenic
974991645 4:69098779-69098801 CTGAAAGAAAGATGGGAAATGGG + Intronic
975000011 4:69212460-69212482 CTGAAAGAAAGATGGGAAGTAGG - Intronic
975005761 4:69282753-69282775 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975014170 4:69391702-69391724 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975015427 4:69411088-69411110 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975037506 4:69702536-69702558 CAAAAATGAAGATGAGAAATAGG - Intergenic
975207745 4:71663931-71663953 CTAAAAGGATGATGCCAATCAGG + Intergenic
975860498 4:78671677-78671699 CTATAAGGCTGATGGGATATTGG - Intergenic
975891923 4:79039889-79039911 CTAAAAGCATGTGTGGAAATAGG - Intergenic
977208398 4:94190138-94190160 CTGAAAGGATGAGTTGAAATAGG - Intergenic
977698700 4:99996187-99996209 AAAATAGGAAGATGGGAAATAGG + Intergenic
978674686 4:111297951-111297973 CTTGAAGGATGAGGGGAATTTGG - Intergenic
978924516 4:114226782-114226804 CTGAAAGGATGAGTGGAGATGGG - Intergenic
979229735 4:118334432-118334454 CTTCAAGGATGATGTGAACTGGG - Intronic
979290191 4:118971404-118971426 CTAAAAGGATGGTGGGATGTAGG - Intronic
979396942 4:120200100-120200122 CTAAAACGAAGATAGGAAGTAGG + Intergenic
979456919 4:120936749-120936771 CTAAAAGAATGATAGGAGTTAGG - Intergenic
979539822 4:121869257-121869279 CTAAAAATATGATGAGGAATTGG + Intronic
981628868 4:146794429-146794451 CTAACAGGATTATGGAAAAGGGG - Intronic
981652027 4:147070995-147071017 CAAAAAGGATAAAGGAAAATAGG - Intergenic
981697140 4:147570283-147570305 CTTAAAGGAAGATGGAAACTTGG - Intergenic
984114017 4:175656293-175656315 CTAAAATGATTATGGGATAATGG - Intronic
984387556 4:179082032-179082054 ATAAAAGGATGATGAAAGATTGG - Intergenic
986302454 5:6489083-6489105 CTAAAAGGATGAAGGAAGATCGG - Intronic
988322072 5:29711785-29711807 CTAAAAGTAAGGTGGTAAATTGG - Intergenic
988819343 5:34865353-34865375 CTAGAAGTCAGATGGGAAATGGG + Intronic
991245885 5:64507455-64507477 CTGAAAGGGTGAGGGGAAGTAGG + Intronic
992572634 5:78075577-78075599 ATCAAAGGAATATGGGAAATTGG - Intronic
992767112 5:80011445-80011467 CTAAAAGGAAGAAGGGAGAAGGG + Intronic
993332494 5:86617925-86617947 TGAAAAGAAAGATGGGAAATGGG - Intronic
995433872 5:112113565-112113587 CCAAAAGCATTATGGGTAATTGG - Intergenic
995989761 5:118223284-118223306 ATGAAGAGATGATGGGAAATTGG - Intergenic
996968492 5:129333793-129333815 CTAAATGGAAGATGGGAAGAAGG + Intergenic
996999114 5:129738041-129738063 CTAAAAAGATACAGGGAAATGGG - Exonic
998823389 5:146077045-146077067 CTAAAAGGATGATGGGAAATTGG - Intronic
1000744676 5:165018210-165018232 CTAAAAGGGTGATGAGTAATAGG + Intergenic
1003213283 6:4087199-4087221 CTAAAAGGAAGAGGGGAAAGCGG - Intronic
1004123085 6:12844794-12844816 CTAAAGAAATGATGGGAAAGTGG + Intronic
1005659887 6:27986138-27986160 CTAATATGATGATGGGATAATGG - Intergenic
1005990746 6:30900227-30900249 AAAAAAGGAAGATGGGAAGTGGG - Intergenic
1006699327 6:35958984-35959006 AGAAAATGATGATGGGAGATGGG - Intronic
1008014637 6:46504603-46504625 CTAAAAAGACAATGGGAAAATGG + Intergenic
1009814945 6:68720984-68721006 CTAAATGGATGTGGAGAAATAGG + Intronic
1010073205 6:71768678-71768700 CTAAAAGGAAAAAGGGAATTAGG - Intergenic
1010532987 6:76990337-76990359 CTGAAAGAAAGAAGGGAAATGGG + Intergenic
1010958102 6:82114498-82114520 GGAAAAGGATGAAGGGAAAGAGG - Intergenic
1011190151 6:84719727-84719749 TGAAAAGGATGATGGGGAATGGG + Intronic
1011650547 6:89502521-89502543 AAAAAAGGATAAAGGGAAATAGG + Intronic
1011997731 6:93614397-93614419 CAGAATGGAGGATGGGAAATAGG - Intergenic
1012502906 6:99909422-99909444 TTAAAAGGAAAATGAGAAATTGG + Intergenic
1012952538 6:105534042-105534064 GTAAAAGGATGATGAGAATAAGG - Intergenic
1014574311 6:123051566-123051588 CTTAAAAGTTGATGGGAAACAGG + Intronic
1014736530 6:125100766-125100788 CTAAAAGAGTAATTGGAAATTGG + Intergenic
1015026024 6:128533360-128533382 CTAAAGGGAGAATGGGATATGGG + Intergenic
1015861847 6:137689587-137689609 ATCAAAGGCTCATGGGAAATGGG + Intergenic
1015892220 6:137980295-137980317 GTAAAAGGAAGAAGGGAAATGGG - Intergenic
1016228262 6:141769648-141769670 CTAAAAGGAAGACAGGAAAGAGG - Intergenic
1017254144 6:152314245-152314267 CTAAAAGTCTGTTGGGAATTTGG - Intronic
1017322086 6:153105998-153106020 GCAAGAGGATGATGGGAACTGGG + Intronic
1017910315 6:158786599-158786621 TTAAAAAGATGATGGGAGGTGGG - Intronic
1018258901 6:161949969-161949991 GTAAAAGGAAGGTGGGAGATTGG + Intronic
1018499300 6:164387900-164387922 CTACAATGATGATCTGAAATGGG - Intergenic
1022246806 7:28568171-28568193 CTAAGAGGGTGATGGAAAAGAGG + Intronic
1022355362 7:29609583-29609605 ATAAAAGCATGATGGGGAAAAGG - Intergenic
1022538333 7:31112311-31112333 CTACAAGGAAGACTGGAAATTGG + Intergenic
1023308112 7:38852849-38852871 CCAGAAGGATGATGGTAAATCGG - Intronic
1024396761 7:48878144-48878166 ATAAAAGGATGAGGAAAAATGGG + Intergenic
1025157546 7:56622023-56622045 CTTAAAGAATGATGAGAACTTGG + Intergenic
1027873531 7:83740917-83740939 CTAAAATGAAGATGAGAAACGGG + Intergenic
1028739282 7:94253548-94253570 CTTGAATGATTATGGGAAATAGG - Intergenic
1030314135 7:108097071-108097093 TGAAAGGTATGATGGGAAATTGG + Intronic
1030647691 7:112081773-112081795 CAAAAAGAAAGATGGTAAATTGG + Intronic
1031125029 7:117763901-117763923 CTAAAAGAAGATTGGGAAATAGG - Intronic
1034009820 7:147517398-147517420 CTAAAAGGATGGGGTGAACTTGG + Intronic
1037004815 8:13765055-13765077 AAAAAAGGATGCTGTGAAATTGG + Intergenic
1037112346 8:15178651-15178673 TTAAAAGGAAGATGGGGAACTGG - Intronic
1038082401 8:24153890-24153912 TTAAAAGGATGTGGAGAAATTGG + Intergenic
1039258092 8:35740879-35740901 ATAAAAGGATTCTGTGAAATAGG + Intronic
1039564281 8:38539065-38539087 ATGAAAGGATAATGGGAAGTGGG - Intergenic
1040654786 8:49494674-49494696 CTATAAAGATGATAGCAAATAGG + Intergenic
1041529951 8:58854273-58854295 CTGAAAGGATGAGAAGAAATGGG - Intronic
1041992240 8:64007084-64007106 CTAAAAGTATGATAGGAGATAGG - Intergenic
1042520787 8:69709150-69709172 ATAAAAGGAAGAAGGGATATGGG + Intronic
1042643496 8:70960365-70960387 CAAAATGGATGATGGAAAAATGG - Intergenic
1045030602 8:98131746-98131768 TGAAAAGGATGAGGAGAAATTGG - Intronic
1046159886 8:110347583-110347605 CTAAAAGGTTGTTTGGAAACTGG - Intergenic
1047117481 8:121860556-121860578 CTAGAAGGATGATGATAAAGTGG - Intergenic
1049134427 8:140882385-140882407 CTAAAAGGATAATAGGACATGGG + Intronic
1050089558 9:2003767-2003789 CTGAAAGGATGTGGTGAAATTGG + Intergenic
1052859279 9:33426944-33426966 GTAACACGATGATGGGAACTGGG + Intergenic
1055290910 9:74780939-74780961 ATAAAAGTATGTTGGGAAAGAGG + Intronic
1055968576 9:81889115-81889137 CTAAAAGTATCATGGGAACTTGG + Intergenic
1056171088 9:83985233-83985255 ATAAAAAGATGATGTGTAATAGG - Intronic
1058856704 9:109069446-109069468 TTAAAAGGAGAATGGGAAAAAGG - Intronic
1059581796 9:115556886-115556908 CAAAAAAGATGATTTGAAATTGG - Intergenic
1059620437 9:115998777-115998799 CTATAATGATATTGGGAAATGGG + Intergenic
1059631876 9:116133706-116133728 CTAAGGGAATTATGGGAAATTGG - Intergenic
1060171562 9:121465768-121465790 CTAAAATGATGATGAGGAAGAGG + Intergenic
1186064174 X:5743679-5743701 ATAAATGGTTGATGTGAAATAGG - Intergenic
1186384746 X:9098538-9098560 ATAAAAGGAAAATGAGAAATGGG - Intronic
1186443069 X:9602672-9602694 CTAAATGGATGATGAGTATTGGG + Intronic
1186584650 X:10859757-10859779 CTAAAAGACTGATGAGGAATGGG - Intergenic
1187256340 X:17646235-17646257 CTAAAAGGAGAAAGGGAACTGGG - Intronic
1187398657 X:18940121-18940143 CTAAAAGATTCATGGGAAAGAGG - Intronic
1188052394 X:25503593-25503615 CTAGTAGGATGATGAGTAATTGG + Intergenic
1188485943 X:30682443-30682465 CTAGAAGGAGAAAGGGAAATAGG + Intronic
1188867802 X:35335529-35335551 ATAAAAGGATGATATGAAAAGGG - Intergenic
1190007738 X:46757041-46757063 CTTAAAGGACAATGTGAAATAGG - Intronic
1190107897 X:47572426-47572448 GGAAAATTATGATGGGAAATAGG + Exonic
1190559183 X:51670572-51670594 CTAAAAGCCTGGTGGGAAAGAGG + Intergenic
1190565108 X:51722749-51722771 CTAAAAGCCTGGTGGGAAAGAGG - Intergenic
1193615075 X:83677082-83677104 CTAAAAGAACTATGGGAAACTGG - Intergenic
1193777546 X:85662223-85662245 CTAAAAAGATGATAGGGACTTGG + Intergenic
1193881232 X:86923946-86923968 CAAACAGGACGGTGGGAAATAGG + Intergenic
1194650290 X:96506060-96506082 TTAAAAGAATGATGGCATATGGG - Intergenic
1195964097 X:110414411-110414433 GAAAAAGGATGAGGGGAAAGGGG + Intronic
1196310171 X:114154816-114154838 CTAAAAGGGTAATGGGGTATTGG + Intergenic
1197750936 X:129963192-129963214 CTATTAGGAGGATGTGAAATGGG - Intergenic
1197992127 X:132329591-132329613 CAAAAAGAAGGAGGGGAAATGGG + Intergenic
1197998354 X:132405243-132405265 CTATCAAGATCATGGGAAATTGG + Intronic
1198704253 X:139430485-139430507 TTTTAAGGATGATAGGAAATGGG - Intergenic
1198977850 X:142357398-142357420 CTAAAAGGAGGATGGGGAAAGGG - Intergenic
1199496774 X:148460872-148460894 CTAAAAGTAGGCTGGGAACTGGG + Intergenic
1200312594 X:155093960-155093982 AAAAAAGGATGCTGTGAAATGGG - Intronic
1201356880 Y:13106476-13106498 TGAAAAGGATGATGATAAATTGG + Intergenic