ID: 998825605

View in Genome Browser
Species Human (GRCh38)
Location 5:146098309-146098331
Sequence GATGATTAACTTGGAAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998825599_998825605 19 Left 998825599 5:146098267-146098289 CCACAGCGCTGGCTGGTACATGG 0: 1
1: 0
2: 2
3: 10
4: 115
Right 998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG 0: 1
1: 0
2: 1
3: 19
4: 214
998825603_998825605 -4 Left 998825603 5:146098290-146098312 CCTCTGGAGAGTCAAGGATGATG 0: 1
1: 1
2: 1
3: 10
4: 165
Right 998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG 0: 1
1: 0
2: 1
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998825605 Original CRISPR GATGATTAACTTGGAAACAA AGG Intronic
900040097 1:453505-453527 GATGACCAACTTGGATAAAATGG - Intergenic
900061528 1:688481-688503 GATGACCAACTTGGATAAAATGG - Intergenic
901690429 1:10969725-10969747 GATGACAAGCTTGGGAACAATGG + Intronic
902057387 1:13612876-13612898 GATGATTAACTTCTAAATCAAGG + Intronic
902296951 1:15474163-15474185 GATGGTTATCTAGGAAACTAAGG + Intronic
903069957 1:20722183-20722205 GATGTTTAGCTTGGAAGTAAGGG + Intronic
903311167 1:22457614-22457636 GATGAGGAAATTAGAAACAAAGG + Intronic
904175004 1:28620980-28621002 GAGGATTAACTTGGCAGTAAGGG - Intronic
904390581 1:30183026-30183048 AATGATTAACTTGCAAAAGATGG - Intergenic
907652485 1:56309094-56309116 CATGATTGACATGAAAACAAAGG + Intergenic
908666899 1:66503208-66503230 GATGATAAACTGAGAAACAAAGG + Intergenic
918901459 1:190425536-190425558 AATTTTTAACTTGGAAAGAATGG + Intronic
919528449 1:198683592-198683614 GGTGATTATGATGGAAACAAGGG - Intronic
920241623 1:204556139-204556161 GATAATTAACTTTGGAACTAAGG - Exonic
921570076 1:216767198-216767220 TATGAGTAACTAGGAAAGAAAGG - Intronic
921996355 1:221423567-221423589 TAAGATTAACCTGGAAAAAAAGG + Intergenic
923818035 1:237402514-237402536 AATAAATAACTTAGAAACAATGG + Intronic
1064619657 10:17201957-17201979 GTTAATTCACTTGGAAACCAAGG - Intronic
1065279741 10:24123047-24123069 GATAATTATCTTGGAAAGGAAGG - Intronic
1067406016 10:46023841-46023863 GAGGATTATCTTGGAGAAAAGGG - Intronic
1068116178 10:52740016-52740038 GGTGATTAAATTTGAGACAAAGG - Intergenic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1071408708 10:85364640-85364662 GATTATGAACTAGGAACCAAGGG - Intergenic
1076966320 11:89412-89434 GATGACCAACTTGGATAAAATGG - Intergenic
1077947768 11:6921069-6921091 GAAGATAAACTTGGACACAAAGG - Exonic
1080319019 11:30984834-30984856 GCTGATACATTTGGAAACAACGG + Intronic
1080354220 11:31422993-31423015 GGTGATTAACTTGGGAAAATTGG - Intronic
1080517165 11:33035123-33035145 AATGATTAACTTGGTTAAAAAGG - Intergenic
1081392939 11:42550870-42550892 GAAGATTATCCTTGAAACAAAGG + Intergenic
1084163972 11:67366608-67366630 GATGTATAACTGGGAAAGAAGGG + Intronic
1085862009 11:80245445-80245467 AATGATGAACTGGGAAGCAAAGG - Intergenic
1086371679 11:86161737-86161759 GATGATTAAATGAGAAAAAAAGG + Intergenic
1089090218 11:115867857-115867879 GAAAATTAACTTAGAAACATTGG - Intergenic
1089220478 11:116866863-116866885 TATGAGTAACTTGGTAAAAATGG - Intronic
1090253728 11:125268581-125268603 ATTGATTGACTTGGAAGCAAGGG - Intronic
1091814628 12:3427838-3427860 AATGATTATCTTCGAAAAAAGGG - Intronic
1093044339 12:14424855-14424877 GATGATTTTCTTGAAAAAAATGG + Exonic
1093679342 12:21982990-21983012 AATGGTTAATTTGGAAACATGGG + Intergenic
1093965976 12:25325734-25325756 GATGTTTAAATTGGACATAAAGG + Intergenic
1094188663 12:27673700-27673722 GATGTTTTACTTAGAAACAGTGG + Intronic
1095095143 12:38143303-38143325 GGTGATTCCCTAGGAAACAAGGG - Intergenic
1097162775 12:57060655-57060677 GAAGATTAACAGGAAAACAAAGG + Intronic
1099135446 12:78892693-78892715 CAAGATTAATTTGGAAATAATGG + Intronic
1099516545 12:83603488-83603510 GATTATTAACTGGGCAAAAATGG + Intergenic
1103976095 12:124703714-124703736 GATGATTAAGATGGAAAAAGGGG + Intergenic
1104917350 12:132272592-132272614 GCTGTTTAAATTGGAAATAATGG + Intronic
1106829075 13:33558911-33558933 GATGAGTAACTTGGTTAGAAAGG - Intergenic
1107072535 13:36286631-36286653 GATGATGAAGTTGGAAAAAAGGG - Intronic
1108094339 13:46884738-46884760 GATGATTAAATTAGAAAGAATGG - Intronic
1109491995 13:63114081-63114103 GAGGATTAACTGGGGGACAAAGG - Intergenic
1110174023 13:72535248-72535270 GATTCTTAACTTGTTAACAAAGG - Intergenic
1110386856 13:74922356-74922378 GCTGAGTAACTATGAAACAAGGG - Intergenic
1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG + Intergenic
1113646468 13:112000100-112000122 GAGAATTAACTTGGAAAACATGG + Intergenic
1119986402 14:79142900-79142922 GAAGATTAACTTGGATAGATGGG + Intronic
1120486171 14:85115821-85115843 GATGATGAACCTGCAAACAGAGG + Intergenic
1120599986 14:86491428-86491450 GATGTTCATCTTGGAGACAAAGG + Intergenic
1121831470 14:97055983-97056005 CCTGAATAACTTTGAAACAAGGG - Intergenic
1122668580 14:103352532-103352554 GATGATAAAGTTGGATACACGGG - Intergenic
1125224887 15:37384735-37384757 CATGGTTAACTTGGAAAATAGGG + Intergenic
1125750325 15:42023467-42023489 GATGATTGATGTTGAAACAAGGG + Intronic
1127539573 15:59923320-59923342 CTTCATTAAATTGGAAACAAAGG - Intergenic
1127544816 15:59982069-59982091 GATGATTAACTAGTATACATGGG + Intergenic
1127827900 15:62721722-62721744 GTTTATTAAATTGGAAAAAATGG + Intronic
1130702915 15:86203738-86203760 GATGAGTAACTCCGTAACAATGG - Intronic
1131006702 15:88984268-88984290 TATGATTAACTTAGGAACATTGG - Intergenic
1133475483 16:6117335-6117357 CATAATGAACTTGGAAACGAAGG - Intronic
1136639095 16:31546676-31546698 AATGTCTAAGTTGGAAACAACGG + Intergenic
1136665564 16:31808947-31808969 AATGTCTAAGTTGGAAACAATGG - Intergenic
1138034502 16:53590789-53590811 GATGATCAACTTGGTAATACAGG - Intergenic
1138709004 16:58948000-58948022 GTTGATTAAATTAAAAACAAAGG + Intergenic
1141734409 16:85842681-85842703 GATGATTGACTTTGAAACCCTGG + Intergenic
1142333068 16:89468132-89468154 AATCATGAACTTGGAAAGAAGGG + Intronic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1147263474 17:39222175-39222197 GAGGATTACTATGGAAACAAGGG - Intronic
1149264836 17:54916595-54916617 GCTTCTTAACTTGGCAACAAAGG - Intronic
1149343530 17:55711417-55711439 TGTGATTAACTTGGAAAGGAAGG + Intergenic
1151070918 17:71210414-71210436 GATGAGTAAATTGGCCACAATGG - Intergenic
1154394360 18:13973342-13973364 TATGAGAAACTTGGGAACAAAGG + Intergenic
1155781471 18:29842040-29842062 GATGATTAAAATCGAAACACTGG - Intergenic
1156566879 18:38201545-38201567 ATTGATTGACTTGGCAACAAGGG - Intergenic
1156731889 18:40204410-40204432 GATTATGAAATTTGAAACAACGG + Intergenic
1160643124 19:159035-159057 GATGACCAACTTGGATAAAATGG - Intergenic
1165128375 19:33617021-33617043 TATGACTAACTTGCAAAGAAAGG - Intergenic
926923782 2:17965998-17966020 GGTGATTTACTTGAAAAAAAAGG - Intronic
928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG + Intronic
929249177 2:39733944-39733966 GATGATGAAATAGGAAAAAAGGG - Intergenic
929724093 2:44406018-44406040 CATATTTAACTTGGAACCAAGGG + Intronic
929772870 2:44907323-44907345 GATTATTATCTTGGAAGCCACGG - Intergenic
931241647 2:60459505-60459527 GATGATTAACTAGGACATAATGG + Exonic
935500132 2:103829376-103829398 AGTGTTAAACTTGGAAACAAAGG - Intergenic
939530466 2:143353728-143353750 GTTGATTGACTGGGAAACTAAGG + Intronic
942160643 2:173182562-173182584 GAAGAATAAATTTGAAACAAAGG - Intronic
944050571 2:195463983-195464005 GATGATTAAATTTGAACCAAGGG + Intergenic
944050658 2:195465295-195465317 GATGGTTAAATTTGAACCAAGGG - Intergenic
944932581 2:204535150-204535172 GATGCTTTACATGGAAACGAGGG - Intergenic
946473506 2:219985225-219985247 AATTATTAACTTGTATACAAGGG + Intergenic
947262983 2:228245611-228245633 GATGGTAATCTTGGGAACAAGGG - Intergenic
947308502 2:228774407-228774429 GATGATTACATTTGAAAGAATGG - Intergenic
947967503 2:234293952-234293974 GATGATGAAATTCTAAACAAGGG - Intergenic
948015009 2:234681391-234681413 GATGATTAACCTAGCAACATGGG - Intergenic
948450831 2:238070192-238070214 GATCATTAACTTGTAAAAATGGG + Intronic
1173219311 20:41118275-41118297 TATGATGAACTTGCAAACTAAGG + Exonic
1175532536 20:59684037-59684059 GATGAGAACCTTGGAAAGAAAGG + Intronic
1177344176 21:19847175-19847197 AATTATTAACATGGAAACCAGGG - Intergenic
1179766106 21:43574299-43574321 GGTGATTATCTTGGGAGCAATGG + Intronic
1182342417 22:29634255-29634277 GATTTTTAACTTTGACACAAAGG - Intronic
1183006828 22:34910303-34910325 GATAATGACCTTGGAAAGAAAGG + Intergenic
1183112141 22:35658236-35658258 GATAAAGAACTTGGGAACAATGG - Intronic
949601104 3:5598631-5598653 GTTGACTAACTTGCAAACACGGG + Intergenic
951111208 3:18806572-18806594 GATTATAAACATGTAAACAAAGG + Intergenic
952031570 3:29148792-29148814 AAAGATAAACTTAGAAACAAAGG - Intergenic
952052041 3:29395637-29395659 AATGATTCACTTGAAAACAATGG - Intronic
953282241 3:41570338-41570360 GAAGATTAATGTGGAAGCAATGG + Intronic
954956472 3:54524524-54524546 GAAGATTAATATGGAAATAAAGG - Intronic
954994377 3:54867989-54868011 GGTGATTAACCTGGAAAACATGG + Intronic
957381242 3:79432870-79432892 TATTATTGACTTGGAAATAATGG + Intronic
957744353 3:84319234-84319256 GATGAAAAACTTTCAAACAAAGG - Intergenic
958539061 3:95446614-95446636 CATTATTAAATTGTAAACAAGGG - Intergenic
958941480 3:100320159-100320181 GATGATTGACCTGGACTCAAAGG - Intronic
959044442 3:101457008-101457030 GAGAATAAACTTTGAAACAAAGG - Intronic
959121356 3:102236392-102236414 GATGATAAACTGGCAAACACTGG - Intronic
959578193 3:107957568-107957590 GATAATCAACATCGAAACAAAGG + Intergenic
961849603 3:129802384-129802406 GATGGTGAACTAGGAAACATAGG + Intronic
963067281 3:141273828-141273850 GATGATTAACTCTGTACCAACGG - Intronic
963425627 3:145118924-145118946 GATGATAATGTTGGAAAGAAGGG - Intergenic
964288137 3:155143708-155143730 GAAGATTTATTGGGAAACAATGG - Intronic
966166287 3:177020577-177020599 GAAGGCTAACTTGGAAAAAAAGG + Exonic
968313698 3:197704693-197704715 GCTGATGAACTGGGAAGCAAAGG + Exonic
968720487 4:2199347-2199369 AATGATTAACTTGGGGATAAAGG - Intronic
970607845 4:17697256-17697278 GATGTTCAACTTGGAAACTCAGG - Intronic
971083150 4:23239076-23239098 TTAAATTAACTTGGAAACAATGG + Intergenic
971313199 4:25544252-25544274 AATGTTTAACTTCTAAACAAGGG - Intergenic
972013040 4:34207878-34207900 GATAAGTGACTTGGAAATAAGGG + Intergenic
973222503 4:47744901-47744923 GAAAATTAACATGGAAACGAAGG + Intronic
975054907 4:69918153-69918175 GGTGATATACTTGGAAAGAAAGG - Intergenic
975367817 4:73549047-73549069 GAGAATAAACATGGAAACAAGGG - Intergenic
975930911 4:79521239-79521261 AATGATTAACTTAGAAACCAGGG - Intergenic
976161741 4:82208660-82208682 GAGAATTAACTTGCAAAGAAGGG + Intergenic
977067147 4:92332833-92332855 GATGAGCAACATGGAATCAAAGG - Intronic
978128316 4:105161608-105161630 TATGATTTACTGTGAAACAAAGG - Intronic
979303732 4:119117781-119117803 GTTAAATAACTTGGATACAATGG + Intergenic
980877896 4:138680299-138680321 AATGATTAACTTGGGAACTAAGG - Intergenic
981409645 4:144413847-144413869 AATGATTATCTTGGCAACAATGG + Intergenic
981569177 4:146133363-146133385 GATTATTCACTTGAAACCAATGG - Intergenic
981807858 4:148737879-148737901 TATGAGGAAATTGGAAACAAAGG + Intergenic
981902001 4:149877165-149877187 TAGGATTATCTTGAAAACAATGG - Intergenic
983982286 4:174013207-174013229 GATGAGAAAATTGGAAACATAGG - Intergenic
985351761 4:189071095-189071117 GATCATTAGCTTGAAAACCAAGG + Intergenic
989124138 5:38034645-38034667 GATTATTCACTTGTAAACTAAGG + Intergenic
991051340 5:62275561-62275583 GATGATTAACTCTGCAAAAATGG - Intergenic
992244088 5:74799834-74799856 AATGTCTAACTTGGAGACAAAGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994998459 5:107095806-107095828 GATATTTAACTGGGAAACAGTGG - Intergenic
997429134 5:133825463-133825485 GATAATTAACCTAGAAGCAAAGG - Intergenic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
1000078860 5:157824253-157824275 AATGTTCAACTTGCAAACAAGGG - Intronic
1000450926 5:161386043-161386065 GCTGAATAACTTGGACATAAAGG - Intronic
1001461235 5:171916536-171916558 GATGAAGAACAAGGAAACAAAGG + Intronic
1002733750 5:181365438-181365460 GATGACCAACTTGGATAAAATGG + Intergenic
1002750793 6:108682-108704 GATGACCAACTTGGATAAAATGG - Intergenic
1005640270 6:27789356-27789378 AATGGTTAATTTGAAAACAAGGG - Intergenic
1006884165 6:37366585-37366607 GAAGATAAAACTGGAAACAAGGG + Intronic
1008012491 6:46483183-46483205 GATAATTAAAGTGGAAACTAAGG - Intronic
1008013635 6:46492927-46492949 GATGCTTTACTTGGAAAGAAAGG - Intergenic
1008153160 6:47981187-47981209 GATGATTAAGATGGAGACAAAGG - Intronic
1011922245 6:92593877-92593899 GATGATTTCTTTGAAAACAAGGG + Intergenic
1011933855 6:92749872-92749894 GACAATCAACTTGGAAAGAAAGG - Intergenic
1012007943 6:93739481-93739503 AATGATTGACTTGGAAAATAAGG + Intergenic
1012639025 6:101585925-101585947 AATGATTAACTTTTGAACAAGGG + Intronic
1013576161 6:111484457-111484479 GGCTATTAAATTGGAAACAAGGG + Intergenic
1013655435 6:112241978-112242000 GATGTTTTTCTTGGTAACAAGGG - Intronic
1015980342 6:138832103-138832125 GATAATAAACTTGAAACCAAAGG - Intronic
1016324666 6:142886661-142886683 AATAATTAACTGGGTAACAATGG - Intronic
1017080943 6:150667984-150668006 GAAGATTATCTTGTATACAAGGG + Intronic
1018018351 6:159733134-159733156 GATAATAAACTGGGCAACAAGGG + Intronic
1018088717 6:160327353-160327375 AATTTTTTACTTGGAAACAAAGG - Intergenic
1018161734 6:161051290-161051312 GATAAACAACTTGGAAACTATGG + Intronic
1019237998 6:170637758-170637780 GATGACCAACTTGGATAAAATGG + Intergenic
1020370741 7:7429621-7429643 GATCATAAACTTGAAAATAAAGG - Intronic
1021328479 7:19304133-19304155 GATAGATAACTTGGAAACAGAGG + Intergenic
1021852744 7:24824584-24824606 GATGAGTGACCTGGAAAGAATGG - Intronic
1022668525 7:32433084-32433106 GGTCATTAACTTGGAATCATAGG + Intergenic
1024172739 7:46807189-46807211 GATGATGAAATTGGGAATAATGG - Intergenic
1024873365 7:53992104-53992126 GATGATAAATTTCAAAACAAAGG + Intergenic
1026157809 7:67842576-67842598 CATGATTAACCTAGAAAGAAAGG + Intergenic
1026619351 7:71936632-71936654 GAAGAATACCTTAGAAACAAGGG - Intronic
1027742342 7:82025822-82025844 GATGATCAATCTGGAAACAGAGG - Intronic
1027969041 7:85053627-85053649 GATTATTAAGTTAGAAACATGGG + Intronic
1030564756 7:111139610-111139632 GATGATTAACTTGCATATCAGGG - Intronic
1030837192 7:114303568-114303590 AGAGATTAACTAGGAAACAAAGG - Intronic
1030904042 7:115160639-115160661 GTTTCTTAACTTGTAAACAAAGG - Intergenic
1031631574 7:124049298-124049320 CATGAATAACCTGAAAACAAAGG - Intergenic
1032977485 7:137242148-137242170 GATTATTAAATGGGAAAAAAGGG - Intronic
1033514635 7:142093899-142093921 GATGATTCACTTTGAAATAAAGG - Intronic
1035317962 7:158008963-158008985 GAAGAGCATCTTGGAAACAAAGG - Intronic
1035509771 8:168851-168873 GATGACCAACTTGGATAAAATGG - Intergenic
1035853733 8:2949805-2949827 AATGGTTAACTTGCAAAGAACGG + Intronic
1037548847 8:19950496-19950518 ATTGCTTAACTTGGAAACACTGG + Intronic
1041745829 8:61208333-61208355 GATGATTAATTTTGAAGAAAGGG + Intronic
1041941647 8:63394736-63394758 GATGATGTACTTGGGAACACTGG - Intergenic
1042832252 8:73043905-73043927 AATGCTTAACTTGGAGACCATGG + Intronic
1043510753 8:80947998-80948020 CATGATTAACTTTGGAACAAAGG + Intergenic
1043702664 8:83311125-83311147 GATGTTTAATTTTGAAACATTGG - Intergenic
1043771244 8:84204079-84204101 GATGATTAACTTTGAAATTTAGG - Intronic
1044334178 8:90958368-90958390 GATTGATAATTTGGAAACAATGG - Exonic
1045104960 8:98883509-98883531 GATGTGTTACTTGGAAACAAAGG - Intronic
1045902440 8:107299267-107299289 GAATATTGACTTTGAAACAAAGG - Intronic
1046129662 8:109951526-109951548 GAACATTAAGATGGAAACAATGG - Intergenic
1046758474 8:117995721-117995743 GATGATTAGCTTAGACACATAGG - Intronic
1049334232 8:142074144-142074166 AATGATTAAATAGAAAACAAGGG + Intergenic
1049441180 8:142610463-142610485 GCTGAAGAACTTGGAAACAAGGG - Intergenic
1055086136 9:72315873-72315895 GCTGATCAACGTGTAAACAAAGG + Intergenic
1055636747 9:78286661-78286683 GATGTTTAACCTGGAAACAAGGG + Intergenic
1056410963 9:86326512-86326534 GAGGATTAAATCAGAAACAAGGG + Intronic
1056637434 9:88342906-88342928 GATGATCAACTTGATATCAAGGG + Intergenic
1057769353 9:97953624-97953646 GTGGATTGACTTGTAAACAAAGG - Intergenic
1058546898 9:106070132-106070154 GATAATTAACATTGAAAGAAGGG - Intergenic
1059720330 9:116953507-116953529 GAAAATTAACTTGGAAACTGAGG - Intronic
1062758204 9:138318054-138318076 GATGACCAACTTGGATAAAATGG + Intergenic
1187439500 X:19305352-19305374 GATAATTAATTTGGAAACATTGG + Intergenic
1187543580 X:20224699-20224721 GATGATCAACTTGAAACAAATGG + Intronic
1188189843 X:27159637-27159659 GATGATAATCTTTGAACCAATGG + Intergenic
1189062146 X:37765988-37766010 GATGATGATCATGGAAAAAAGGG - Intronic
1191912001 X:66161196-66161218 GATGAGTAACCTGGAAATATTGG + Intergenic
1194099657 X:89688151-89688173 GAACATAAACATGGAAACAATGG - Intergenic
1194474974 X:94347255-94347277 TATGATTAACATGTAAGCAATGG - Intergenic
1195429755 X:104775595-104775617 GATGAATAGCAAGGAAACAAAGG + Intronic
1195455040 X:105058628-105058650 AATGAATATGTTGGAAACAAGGG + Intronic
1195789902 X:108572613-108572635 TATGATTAACGTGGTAACAGTGG - Intronic
1196910928 X:120483549-120483571 GAAGAGAAACTTGGAAAGAATGG - Intergenic
1197251222 X:124218132-124218154 GATTCTTATCTTGGAAACAGCGG + Intronic
1197527920 X:127584518-127584540 GATGATCTAATTAGAAACAAAGG - Intergenic
1199822850 X:151467128-151467150 GATGGATAACCTGCAAACAATGG + Intergenic
1200452662 Y:3349531-3349553 GAACATAAACATGGAAACAATGG - Intergenic