ID: 998834382

View in Genome Browser
Species Human (GRCh38)
Location 5:146189910-146189932
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998834380_998834382 26 Left 998834380 5:146189861-146189883 CCTGAATGGCAAACAGATTTCTT No data
Right 998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr