ID: 998836069

View in Genome Browser
Species Human (GRCh38)
Location 5:146203847-146203869
Sequence GGGCCGGCGAACGTGGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998836058_998836069 4 Left 998836058 5:146203820-146203842 CCGATGTGAGTGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 998836069 5:146203847-146203869 GGGCCGGCGAACGTGGGCGTTGG 0: 1
1: 0
2: 0
3: 9
4: 64
998836055_998836069 18 Left 998836055 5:146203806-146203828 CCAAGTTACTGGAGCCGATGTGA 0: 1
1: 0
2: 0
3: 1
4: 68
Right 998836069 5:146203847-146203869 GGGCCGGCGAACGTGGGCGTTGG 0: 1
1: 0
2: 0
3: 9
4: 64
998836065_998836069 -10 Left 998836065 5:146203834-146203856 CCGGGCTGGGCCGGGGCCGGCGA 0: 1
1: 0
2: 2
3: 47
4: 376
Right 998836069 5:146203847-146203869 GGGCCGGCGAACGTGGGCGTTGG 0: 1
1: 0
2: 0
3: 9
4: 64
998836054_998836069 27 Left 998836054 5:146203797-146203819 CCTGGCTGGCCAAGTTACTGGAG 0: 1
1: 0
2: 0
3: 13
4: 182
Right 998836069 5:146203847-146203869 GGGCCGGCGAACGTGGGCGTTGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998836069 Original CRISPR GGGCCGGCGAACGTGGGCGT TGG Intronic
900349633 1:2228406-2228428 GGGCCCGCGAGCGTTGGCGTTGG + Intergenic
900413899 1:2526384-2526406 GGGCCGGCGAGCGGGGGCGGCGG - Intronic
900638928 1:3679020-3679042 AGGCCAGCGAGCGTGGTCGTGGG - Intronic
901853214 1:12029150-12029172 GGGCGGGCGAGGGTGGGCGAGGG + Intronic
901947522 1:12715574-12715596 GGGCTGGGGAAGGTGGGCGTAGG + Intergenic
903879757 1:26500746-26500768 GGGCCGGCGCACTTGGGAGCTGG - Intergenic
904236649 1:29121455-29121477 GGGCCGGTGATCATGGGCGTCGG - Exonic
905959995 1:42035632-42035654 GGGCCGGCGCCCGGAGGCGTTGG + Intronic
912246289 1:107964957-107964979 GGGCCGGCGGCTGTTGGCGTCGG - Exonic
912246396 1:107965298-107965320 GGGCCGGCGGAGGGGGGCGGCGG + Intergenic
913654006 1:120944475-120944497 GGGCCAGTGGACGTGAGCGTGGG + Intergenic
913654086 1:120944880-120944902 GGGCCAGCGGACGCGCGCGTGGG - Intergenic
914267449 1:146050055-146050077 GGGCCGGTGGACGTGAGCGTGGG - Intergenic
914519691 1:148404570-148404592 GGGCCGGTGGACGTGAGCGTGGG + Intergenic
922416549 1:225427837-225427859 GGGCCGGGGACCCTGGGCGCGGG - Intronic
1063663534 10:8049216-8049238 GGCCCGGGGCGCGTGGGCGTGGG + Intergenic
1068845064 10:61662896-61662918 GGGCCGGCGTCCCTGGGCCTGGG - Intergenic
1079689505 11:23403955-23403977 GGGCAGCCCAAGGTGGGCGTCGG - Intergenic
1089174314 11:116537326-116537348 GGGCAGAGGAACGTGGGTGTTGG - Intergenic
1095810800 12:46372129-46372151 GGGGCGGCGGAGGTGGGCTTGGG - Intronic
1102157381 12:110742356-110742378 GGGGCGGGAAACGTGGGGGTGGG + Intronic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1105900187 13:24746491-24746513 GGGCCGGCGGGCGTTGGCGAAGG + Intergenic
1114619227 14:24085039-24085061 GGCCCGGTGAGAGTGGGCGTGGG - Intronic
1114648995 14:24271381-24271403 GAGCCGGGGCACCTGGGCGTTGG + Exonic
1123008787 14:105337274-105337296 GGGCCGGGGAAGGTGGGAATGGG + Intronic
1124240943 15:28027236-28027258 GGGACGGCGGGCGTGGGAGTGGG - Intronic
1133188632 16:4116992-4117014 GGGCGGGGGAACGTGGTCGTCGG - Intergenic
1139534483 16:67562912-67562934 GGGCGGGCGGGCGTGGGGGTGGG - Intronic
1145031613 17:19508510-19508532 GGGCGGGCAGAAGTGGGCGTGGG - Intronic
1148104761 17:45113286-45113308 GGGATGGCCAAGGTGGGCGTGGG - Intronic
1149498827 17:57136124-57136146 GGGCCCCGGAACGTGGGCGTGGG + Intergenic
1149772354 17:59331849-59331871 GGCCGGGCGCGCGTGGGCGTGGG + Intronic
1152426231 17:80220183-80220205 GGGCCACCGCAGGTGGGCGTGGG + Intronic
1152745687 17:82037620-82037642 GGGCAGGCAAAGGTGGGCGGCGG - Exonic
1153515059 18:5895052-5895074 GGGCCGGCGAACGGGCGCTCGGG + Exonic
1159586762 18:70289311-70289333 GGGCCGGGGAACGGGGGCCGGGG + Intronic
1160571132 18:79818347-79818369 GGGCTGGCCAAGGTGGGCATGGG - Intergenic
1161235029 19:3193446-3193468 GGGACGGGGCCCGTGGGCGTGGG + Intronic
1161339032 19:3730560-3730582 GGGCCGGCAGCCATGGGCGTAGG + Exonic
1162398409 19:10430961-10430983 AGGGCGGCGAACGCGGGCGGCGG - Intronic
1163629954 19:18413202-18413224 GGGACGACGAACGTGAGGGTGGG + Intergenic
1164089974 19:21940958-21940980 GGCTGGGCGACCGTGGGCGTGGG + Intronic
1166097415 19:40549458-40549480 GGGGCGGAGAAGGTGGGCATGGG + Intronic
1168076461 19:53982975-53982997 GGGGCGGGGAGGGTGGGCGTGGG - Exonic
927997229 2:27494867-27494889 GGACCGGCGGAGGTGGGTGTGGG - Exonic
932276987 2:70458914-70458936 GGGCCGGGGAGCCTGGGCTTTGG + Intronic
933747905 2:85584369-85584391 GGGCCGCCGAGCGAGGGCGGGGG - Intergenic
942450989 2:176107911-176107933 GGCCCGGCGAACGGGGGCCCGGG - Exonic
945051483 2:205828129-205828151 GGGCAGGAGATCGTGGGGGTGGG + Intergenic
1183351073 22:37335052-37335074 CTGCCGGAGAACTTGGGCGTGGG + Intergenic
1184789461 22:46690414-46690436 GCGCCGGGGAAGGTGGGCGCCGG - Intronic
950282446 3:11719600-11719622 GGGCCGGCGGACGGGAGCGCGGG + Intronic
954796097 3:53161917-53161939 GGGGCGGCGAGCGTGGGCCGGGG - Intronic
966860911 3:184230478-184230500 GGGCCGGGGAAGCTGGGCGCAGG - Exonic
969710277 4:8839305-8839327 GGGCCGGACAACGTGGGTGATGG - Intergenic
970456355 4:16227023-16227045 GGGCCGGCGCTCGTGGGGGTCGG - Intronic
986427924 5:7653259-7653281 GAGCCGGCCAGCCTGGGCGTGGG + Intronic
986713031 5:10501630-10501652 GGGCCGGCCATCGTGGGCAGGGG - Intergenic
998836069 5:146203847-146203869 GGGCCGGCGAACGTGGGCGTTGG + Intronic
1003062851 6:2876137-2876159 GGGCAGGGGACCGTGGGCGGCGG + Intergenic
1007891734 6:45300784-45300806 GGGCTGGGGAAAGTGGGGGTGGG + Intronic
1015691797 6:135932757-135932779 GAGCCAGAGAACGTGGGCTTTGG - Intronic
1022207607 7:28179783-28179805 GGGCCGGCGGCCGCGGGCGGGGG - Intronic
1022471191 7:30682663-30682685 GGGCTGGAGAGCGTGGGCCTGGG + Intronic
1024251313 7:47507822-47507844 GGGCTGGCAAACGTGGGGGAAGG - Intronic
1025022913 7:55494049-55494071 GGGCCGGAGAAGGTGGGAGCAGG + Intronic
1025988222 7:66474416-66474438 GGGCCGGCGCTCGTAGGGGTCGG + Intergenic
1029362092 7:100095347-100095369 GGGTGGGCAAACGTTGGCGTGGG - Intronic
1035662638 8:1359441-1359463 GAGCCCAGGAACGTGGGCGTGGG + Intergenic
1045547303 8:103140605-103140627 GGGCGGGCGAGCGGGGGCCTTGG + Intronic
1057192517 9:93095761-93095783 GGGCGGGCGACTGCGGGCGTGGG - Intergenic
1062523375 9:136968800-136968822 GGGCCAGAGGACGTGGGCGCAGG - Intergenic
1186859003 X:13653059-13653081 AGGCCGGCGCACGTGGTCCTGGG - Intergenic