ID: 998840776

View in Genome Browser
Species Human (GRCh38)
Location 5:146251264-146251286
Sequence GTGCAAACCTGAAATTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998840776 Original CRISPR GTGCAAACCTGAAATTATGT GGG Intronic
901299802 1:8191432-8191454 GTGCTAACCTGACATAATGGTGG + Intergenic
905470435 1:38187828-38187850 GTGCAAGCCTGAAACAATATTGG + Intergenic
909082355 1:71128091-71128113 GTGAAAACCTGGGATCATGTGGG + Intergenic
909311244 1:74152615-74152637 GTGTTAACATGAAATTATGATGG + Intronic
910267677 1:85356657-85356679 GTTCAAAACTGAGATGATGTTGG - Intronic
910611708 1:89151162-89151184 GTACAAACTTGAAGTTATATAGG - Intronic
910742234 1:90532381-90532403 AGGCAAACCAGAAATTATTTGGG + Intergenic
911902915 1:103527643-103527665 GTGAGAAACTGAAATTATATTGG + Intronic
913105338 1:115609174-115609196 GTGTAAACCTGGAAGTATGAGGG - Intergenic
916957770 1:169857462-169857484 GTGCAAACCTGCAAATATGGGGG + Intronic
917318452 1:173753943-173753965 GTTCAAATCTGAAATCATCTGGG + Intronic
919176461 1:194025599-194025621 CTGCAAATCAGAAATTCTGTTGG - Intergenic
920579138 1:207088594-207088616 ATTAAAACCTGAAATTTTGTAGG + Intronic
921487809 1:215735121-215735143 GAGGAAACATGAAATTAAGTTGG - Intronic
922626868 1:227056198-227056220 GTGCAAATCTGTAATTATTTAGG - Intronic
924867068 1:247994639-247994661 CTACAAACTTGAAGTTATGTAGG + Intronic
1063174237 10:3537248-3537270 GTGTAAATTTGAAATTATCTTGG - Intergenic
1064157577 10:12916467-12916489 GTGCCAACCTGATAGTATGGTGG + Intronic
1064954567 10:20893488-20893510 GTGCAAAGCAGAAACTAGGTGGG + Intronic
1067525829 10:47038051-47038073 GTGCAAACCAGTAATTTTCTGGG - Intergenic
1070491828 10:76983840-76983862 GTGCAAACATTAGCTTATGTGGG - Intronic
1072813544 10:98482609-98482631 GTGCCAACCTGAAAATAGCTCGG - Intronic
1074655031 10:115575854-115575876 GTACAAACTTGAAGTTAGGTAGG - Intronic
1074675635 10:115847247-115847269 GTACAAACTTGCACTTATGTAGG + Intronic
1075283226 10:121159374-121159396 GTTCAAAGCTAAAATTATTTTGG + Intergenic
1078588571 11:12617512-12617534 TTCCCAACCTGAAATTATTTTGG + Intergenic
1083131397 11:60626454-60626476 GTGCAAACTTGCAGTGATGTAGG + Intergenic
1083805887 11:65073685-65073707 GTGCAAACAGGAAACAATGTTGG + Intronic
1084841517 11:71854971-71854993 ATGCAAACCTAAAATTATTAAGG + Intergenic
1087505168 11:99011789-99011811 GTACAAACTTGCAGTTATGTAGG + Intergenic
1088067769 11:105741892-105741914 GTACAAACTTGCAGTTATGTAGG + Intronic
1090490135 11:127153355-127153377 CAGCATAGCTGAAATTATGTTGG - Intergenic
1091181672 11:133610193-133610215 TAGCAGTCCTGAAATTATGTTGG + Intergenic
1091944949 12:4531324-4531346 GGGCAAAGTTGAAATTTTGTAGG + Intronic
1095032267 12:37304966-37304988 GTGGAAATCTGAAACTCTGTAGG + Intergenic
1097647883 12:62259152-62259174 GGGCAAACGAGAAATGATGTGGG + Intronic
1100607613 12:96164789-96164811 AAGCAAACCTGAGATTCTGTGGG + Intergenic
1100873631 12:98939670-98939692 GTGCAAAGCTTAAATTATTGGGG - Intronic
1102271608 12:111541290-111541312 ATCCAAAACTGAATTTATGTGGG - Intronic
1106675670 13:31955593-31955615 GTGCAAATCTGAATTTCTGGAGG + Intergenic
1106857012 13:33864556-33864578 GTGGAAACTTGTGATTATGTTGG + Intronic
1108811573 13:54231110-54231132 CTACAAAGCTAAAATTATGTAGG + Intergenic
1109186061 13:59269900-59269922 GTACAACACTGAAATTATGCTGG - Intergenic
1109425381 13:62160238-62160260 GTACAAACTTGCAGTTATGTAGG + Intergenic
1109429886 13:62218099-62218121 GTGCAAAATTGAAGATATGTTGG - Intergenic
1110496434 13:76173758-76173780 GTGCAAGTCTGAAATAATATAGG + Intergenic
1110592827 13:77284695-77284717 GTGCAAACAAGAAAATGTGTAGG - Intronic
1111476252 13:88752175-88752197 GTGTAGACCATAAATTATGTTGG - Intergenic
1111826982 13:93280269-93280291 TTGCAAAGCTGAATTTATTTGGG - Intronic
1111926260 13:94466266-94466288 GTGCAAAGTTGCAGTTATGTAGG + Intronic
1111985684 13:95064648-95064670 GTGCAAACCTGGACATTTGTAGG + Intronic
1113022859 13:105908090-105908112 TTGCAAAAGTGAAATTATTTTGG + Intergenic
1114419650 14:22570654-22570676 TTACAAACATGAAATTATGTTGG - Intronic
1115078596 14:29422090-29422112 ATGCACAGCTGAAATTATGAGGG - Intergenic
1116633341 14:47360964-47360986 GTGCAAAGTTGTAGTTATGTGGG + Intronic
1116763797 14:49046628-49046650 GTGCAAAACTGAAATTTTAATGG + Intergenic
1116775222 14:49171830-49171852 GTACAAAGTTGCAATTATGTAGG + Intergenic
1117079089 14:52133008-52133030 GTGCAAAGATGAATGTATGTTGG + Intergenic
1121060846 14:90908310-90908332 GTACAAATCTGAAAGCATGTCGG + Intronic
1127620614 15:60730237-60730259 GTGCACACCTGAAACCGTGTGGG - Intronic
1131844686 15:96476650-96476672 GTGCAAAGTTGCAGTTATGTAGG - Intergenic
1131857081 15:96609011-96609033 GTTCAAACTTGAAATAATCTAGG + Intergenic
1132506279 16:310872-310894 GTGCAATCCTGAAATGTTTTTGG - Intronic
1135100971 16:19605230-19605252 TTTCAAACCTGAACTTCTGTGGG - Intronic
1138499642 16:57431969-57431991 GTGAGAACAAGAAATTATGTGGG + Intronic
1140109243 16:71988849-71988871 GTGAAGAAGTGAAATTATGTGGG + Intronic
1141360690 16:83392785-83392807 GTGCCATCTTTAAATTATGTAGG + Intronic
1142947457 17:3443984-3444006 GTACAAACTTGCAATTATGTAGG - Intronic
1143157726 17:4849087-4849109 GTGTAGACCTGGAATTCTGTGGG + Intronic
1145995296 17:29101631-29101653 GTGCAAGCCTGAAATCCTGCTGG + Intronic
1146113494 17:30113102-30113124 TTGAAAAACTCAAATTATGTAGG + Intergenic
1148256358 17:46136060-46136082 GTGCATATCAGAATTTATGTGGG - Intronic
1151987323 17:77552324-77552346 GTGCAAACCTGATTTTCTCTGGG + Intergenic
1153361319 18:4200284-4200306 GTGAATAACTGAAATTATGAGGG - Intronic
1155060728 18:22226092-22226114 GTACAAAGTTGCAATTATGTAGG - Intergenic
1155381976 18:25232845-25232867 GGGGAAACCTGAAATTTTGTTGG - Intronic
1155520690 18:26665573-26665595 CTGGATACTTGAAATTATGTAGG + Intergenic
1156738314 18:40291604-40291626 GTGTAAACTTGCAGTTATGTAGG + Intergenic
1157985011 18:52427473-52427495 GTGCAAACCTGACATCTTGTTGG - Intronic
1164463250 19:28466004-28466026 GTGCAAACTTGCAGTTATGTAGG + Intergenic
925624856 2:5832422-5832444 GGCCACACCTGAAATGATGTTGG + Intergenic
927723848 2:25405687-25405709 GGCCAAACCAGATATTATGTAGG - Intronic
928744158 2:34391571-34391593 GTGCAAACTATAAATTATCTTGG + Intergenic
929106832 2:38373859-38373881 GTACCAACCTGAAAATATGATGG - Intronic
932206293 2:69886152-69886174 GTACAAACTTGCAGTTATGTAGG - Intergenic
933542629 2:83666886-83666908 GTCCAAAACTGAAATTACATTGG - Intergenic
939111705 2:138016348-138016370 GTGTAAACCTTAACTTATTTAGG + Exonic
939235812 2:139490724-139490746 GGGCAAGCCTAAATTTATGTGGG + Intergenic
940564087 2:155338438-155338460 GTGCAAAACTGAATATATCTGGG + Intergenic
942372401 2:175299384-175299406 GAGTAGACCTGAAATTATGGAGG + Intergenic
943529483 2:189061554-189061576 GTGCATACCTGAAAACCTGTGGG + Exonic
944085938 2:195848192-195848214 GTGCAAACCTCAAGGAATGTTGG - Intronic
944491291 2:200260321-200260343 GTACAAATTTGCAATTATGTAGG + Intergenic
944962823 2:204895108-204895130 GTGCAAATGTGCATTTATGTTGG + Intronic
946497461 2:220209218-220209240 TTGCAAACCTGAAACCATTTTGG + Intergenic
1169575315 20:6953428-6953450 GCACAAACCTGAAAATATGAAGG + Intergenic
1169626823 20:7580442-7580464 GTTCAATCCTGAACTTCTGTGGG + Intergenic
1173776307 20:45709898-45709920 CAGCAAACCTAAAATTATGTTGG - Intergenic
1175661190 20:60813904-60813926 GTGAAACTCTGAAATTATGATGG + Intergenic
1178800499 21:35790448-35790470 GTGCAGACCTGAAATGATGTAGG - Intronic
1179822677 21:43945844-43945866 GTGCAAGCATGAGATGATGTAGG - Intronic
949707645 3:6837389-6837411 CTGCAAACCCAAAAATATGTTGG - Intronic
950154715 3:10712878-10712900 GTGCAAACCTGAGCTTGTGTGGG - Intergenic
951536919 3:23748709-23748731 CTGTAAACCTTAACTTATGTGGG - Intergenic
952903009 3:38121934-38121956 GGGCAACCCTGAGATCATGTGGG - Intronic
955893185 3:63671895-63671917 CTGCAAACTGGAAATTATGCAGG - Intronic
958448508 3:94244281-94244303 CCGCAAAACTGACATTATGTTGG - Intergenic
959397198 3:105855293-105855315 GTACAAATTTGAAGTTATGTAGG + Intronic
960417324 3:117400324-117400346 GTGTAAAACTGAAATGAAGTTGG + Intergenic
962238648 3:133731300-133731322 GTACAATCCTTAAATAATGTTGG + Intergenic
965314395 3:167173457-167173479 GTGTAAACCTTAAAGTATTTTGG - Intergenic
969782613 4:9421010-9421032 ATGCAAACCTAAAATTATTAAGG + Intergenic
970808170 4:20060328-20060350 TTGCAAAACTGAAATAATATGGG + Intergenic
970911513 4:21281871-21281893 CTGCAAACCTGCAATTTTCTTGG + Intronic
974149460 4:57987926-57987948 GTGGAAACCTGAAAGTATGAAGG - Intergenic
976895333 4:90103130-90103152 GTGGATTCCTGAAACTATGTGGG + Intergenic
977049555 4:92111696-92111718 GAGCAAACCTGGAATCATGGAGG - Intergenic
978996004 4:115154019-115154041 GTGCATACTTGAAAATGTGTGGG + Intergenic
980666283 4:135940609-135940631 GTGTAAACATGAATATATGTAGG - Intergenic
983666211 4:170187720-170187742 GTGCCAAACTGAAATTTTGCAGG - Intergenic
984255302 4:177383057-177383079 ATGCATCCCTGAAATTATGTTGG - Intergenic
984458467 4:180001449-180001471 GTCCAAATCTGAAGTTATTTAGG + Intergenic
985272711 4:188209321-188209343 GTGCAATCCTGGAATATTGTGGG + Intergenic
987420450 5:17714374-17714396 GTACAAACTTGTAGTTATGTAGG - Intergenic
990342564 5:54838062-54838084 GTGCAAAGCTGAAATTGAGATGG + Intergenic
992851253 5:80811551-80811573 ATCCAAATCTGAAATTATTTGGG + Intronic
994310514 5:98264158-98264180 GCGCCAACCAGAAATGATGTAGG + Intergenic
995239799 5:109872977-109872999 AGCCAAACCTGAAATTTTGTTGG + Intergenic
995691266 5:114828927-114828949 GTGCAAAGTTGCAATTATGTAGG + Intergenic
997109707 5:131061384-131061406 GTGCAAAATTGCAATTATGTAGG + Intergenic
998840776 5:146251264-146251286 GTGCAAACCTGAAATTATGTGGG + Intronic
1001048441 5:168394309-168394331 TAGCAAACCTCAAACTATGTTGG + Intronic
1001501320 5:172237708-172237730 GTGAAAACATGAAAATATTTAGG + Intronic
1004989269 6:21118455-21118477 GTGCAACCCTGAATCTGTGTTGG - Intronic
1005167813 6:22945529-22945551 GAGAAAATCTGAAATTATATAGG + Intergenic
1008148228 6:47918161-47918183 GTGCAGACATGAAATTTTTTAGG - Intronic
1010693811 6:78944454-78944476 GTCCAAGCAAGAAATTATGTAGG + Intronic
1013669948 6:112390043-112390065 GTGCAAACTAGAAATGATGATGG - Intergenic
1015142467 6:129950482-129950504 GTGCAAGCTTGAAATTCAGTGGG + Intergenic
1016975058 6:149799485-149799507 TTGCAAACCTAAAACTATCTTGG - Intronic
1017340157 6:153311765-153311787 GTATAAAACTGAAATTATGGAGG - Intergenic
1017587210 6:155940009-155940031 GTGCCTACATGAAATTATTTGGG - Intergenic
1017996631 6:159537330-159537352 GTACAAAGCTGCAGTTATGTGGG + Intergenic
1019864372 7:3692171-3692193 ATGGAAACTTGAAATTATGTTGG - Intronic
1021314578 7:19131401-19131423 GTGAAAAGCAGAAATAATGTAGG - Intergenic
1023238942 7:38121646-38121668 GGGCAAAACTGAATTTCTGTAGG + Intergenic
1031287211 7:119885545-119885567 GTGCAAATCTGAAATCCAGTAGG + Intergenic
1031599543 7:123689600-123689622 GTGTAAAGCTGAATTTTTGTAGG - Intronic
1040710307 8:50180305-50180327 GTACAAACTTGAAGTTATATAGG + Intronic
1040871085 8:52100739-52100761 TTTCAAGCCTGAACTTATGTTGG + Intergenic
1041798345 8:61771014-61771036 ATGCAAACCTGTAAATATGGTGG - Intergenic
1044741378 8:95330446-95330468 GTGCAAAGTTGCAGTTATGTAGG - Intergenic
1044797089 8:95913078-95913100 GTACAAACATGTAGTTATGTAGG + Intergenic
1046164384 8:110411303-110411325 GAACAAACCTGTAATTACGTAGG + Intergenic
1046236970 8:111436864-111436886 GTGGAAATCTGAAAGAATGTTGG + Intergenic
1046620546 8:116525109-116525131 GTGAAACCTTGAAATTGTGTTGG - Intergenic
1050709882 9:8449525-8449547 CTGCAAACCGGAAATTGGGTAGG - Intronic
1051359778 9:16271753-16271775 GGGCAAAGGTGAAATCATGTTGG - Intronic
1054885605 9:70194861-70194883 GTAGAAACCAGAAATTCTGTCGG + Intronic
1055099561 9:72449219-72449241 GTGCCAGCCTGAAAATGTGTGGG - Intergenic
1058920977 9:109614634-109614656 GTACAAACTTGCAGTTATGTAGG + Intergenic
1059572817 9:115458795-115458817 TTGCAAACATGAAATTATAAAGG + Intergenic
1060425454 9:123501058-123501080 TTGTAAAACTGAAATTCTGTAGG + Intronic
1188706011 X:33331355-33331377 ATGCTAACCTGAAATTGTATGGG - Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190515518 X:51220154-51220176 ATACAAACCTTAAATTATGTAGG - Intergenic
1194989007 X:100524872-100524894 GTACAAACTTGAAGTTATGTAGG - Intergenic
1196223330 X:113137427-113137449 GTAAAAACCTAAAATTATCTGGG + Intergenic
1196890257 X:120284438-120284460 GTGCAGACCTGAAAGTAGTTGGG - Intronic
1197027003 X:121764155-121764177 GTACAAATTTGATATTATGTAGG + Intergenic
1198099017 X:133407692-133407714 GTACAAACTAGAAATTAAGTGGG - Intronic
1199279505 X:145983647-145983669 GTGCAAACTTGCACATATGTAGG + Intergenic
1199802213 X:151262787-151262809 ATGCAAACCTTATCTTATGTTGG + Intergenic
1201471242 Y:14337161-14337183 GTGAAAATCTGAAATTATGGAGG + Intergenic