ID: 998845446

View in Genome Browser
Species Human (GRCh38)
Location 5:146304573-146304595
Sequence ACTCAGAGCGGACCCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998845446_998845448 -6 Left 998845446 5:146304573-146304595 CCTGCTGGGGGTCCGCTCTGAGT 0: 1
1: 1
2: 1
3: 19
4: 133
Right 998845448 5:146304590-146304612 CTGAGTTGATATACATACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 113
998845446_998845449 8 Left 998845446 5:146304573-146304595 CCTGCTGGGGGTCCGCTCTGAGT 0: 1
1: 1
2: 1
3: 19
4: 133
Right 998845449 5:146304604-146304626 ATACAGTGGAACCTTTGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998845446 Original CRISPR ACTCAGAGCGGACCCCCAGC AGG (reversed) Intronic
900504049 1:3020426-3020448 ACACAGAGGGGGCCACCAGCAGG + Intergenic
901049524 1:6419451-6419473 CGTCGGAGCGGACCCCCAGCAGG - Intronic
903213074 1:21829392-21829414 ACTCATAGCGGAACTCCAGGTGG + Exonic
904999981 1:34660458-34660480 ACTGAGAGGGGAAACCCAGCAGG - Intergenic
905925777 1:41748688-41748710 GCTCAGAGAGGTCACCCAGCTGG + Intronic
911912400 1:103652920-103652942 ACTCAGAGCCGTCACTCAGCTGG + Intergenic
911916054 1:103699028-103699050 ACTCAGAGCCGTCACTCAGCTGG - Intronic
911919814 1:103747058-103747080 ACTCAGAGCCGTCACTCAGCTGG + Intronic
915105822 1:153534649-153534671 ACTCAGAGAGGACCCCCAGAGGG + Exonic
919749135 1:201025697-201025719 AGTCAGAGGGGACCTCCTGCAGG - Intergenic
919777504 1:201203791-201203813 ACTCATAGCGCTTCCCCAGCCGG - Exonic
921340376 1:214128539-214128561 ATTCAGAGTGGGCCCACAGCAGG - Intergenic
921763516 1:218943617-218943639 ACTCAGAACGTAACCACAGCAGG - Intergenic
922831764 1:228557811-228557833 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922832244 1:228609793-228609815 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922832804 1:228612034-228612056 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922833365 1:228614275-228614297 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922833925 1:228616516-228616538 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922834482 1:228618757-228618779 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922835036 1:228620972-228620994 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922835593 1:228623192-228623214 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922836151 1:228625434-228625456 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922836709 1:228627673-228627695 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922837268 1:228629915-228629937 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922837829 1:228632156-228632178 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922838387 1:228634396-228634418 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922838945 1:228636621-228636643 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922839505 1:228638862-228638884 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922840066 1:228641093-228641115 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922840626 1:228643334-228643356 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922841189 1:228645565-228645587 AGTAGGGGCGGACCCCCAGCAGG + Intergenic
922857848 1:228790380-228790402 ACTTTGTGTGGACCCCCAGCTGG - Intergenic
1065814221 10:29470063-29470085 CCTCAGAGCGGCCCCCAAGTCGG + Intronic
1065887708 10:30093479-30093501 ACTCACAGCTGGCCCCCTGCAGG + Intronic
1069818646 10:71214131-71214153 ACTCAGAGAGGACTCCGTGCAGG - Intronic
1070723629 10:78773421-78773443 ACCCAGAGAGGAGCCCCAGTTGG - Intergenic
1071060845 10:81570041-81570063 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1071504990 10:86226813-86226835 GCTCAGGGAGGACCGCCAGCTGG - Intronic
1076462569 10:130656638-130656660 AGGCAGAGTGGACCCCGAGCGGG + Intergenic
1076775847 10:132697651-132697673 ACCCAGAACAGACCCCCAGCGGG - Intronic
1081748136 11:45487473-45487495 ACCCAGGGGGGACCCACAGCTGG + Intergenic
1082763261 11:57146519-57146541 ATTCAGAGATGACTCCCAGCAGG - Intergenic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1084601397 11:70147844-70147866 ACCCAGAGATGACCCACAGCAGG - Intronic
1085294662 11:75424323-75424345 CCTCAGAGCAGACCCCCGACGGG + Intronic
1086162485 11:83737997-83738019 ATTCAGAGAGGAACCCCAGAGGG + Intronic
1088250721 11:107858846-107858868 GGCCAGAGCGGAGCCCCAGCCGG - Exonic
1089698917 11:120232445-120232467 ACACAGAGCTGGGCCCCAGCGGG - Intergenic
1091624196 12:2110109-2110131 ACTCACAGGGGACACCCAGGAGG + Intronic
1091948550 12:4571472-4571494 ACTCACAGCACACCCCCAGTAGG - Intronic
1092169098 12:6362259-6362281 AGTCAGAGGGGACACGCAGCCGG + Intronic
1095954993 12:47800768-47800790 ACTGTGAGCAGACCCCCAGCAGG + Intronic
1110621265 13:77598600-77598622 ACTCAGTGGAGACCCTCAGCTGG - Intronic
1113330195 13:109319330-109319352 ACTCGGAGCGGCCTGCCAGCGGG - Intergenic
1114269578 14:21092558-21092580 ACCCAGATCAGTCCCCCAGCCGG - Exonic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115274326 14:31590461-31590483 AATCAGAGCGGCCCAGCAGCTGG - Intronic
1119195809 14:72715898-72715920 ACTCAGAGTTGACCCCAAGAAGG + Intronic
1119439458 14:74618499-74618521 ACTCAGAGCGGACCCCTAGCTGG - Intergenic
1123191473 14:106576222-106576244 ACTCAGAGCGGAAACCCACCTGG - Intergenic
1124211789 15:27770289-27770311 ACACTGCGCGGACCCCAAGCCGG + Intronic
1127772824 15:62244495-62244517 ACTCAGTGCGGACACCCCGTCGG + Intergenic
1130485032 15:84394151-84394173 ACTTAGTGCGGACACCCAGTTGG - Intergenic
1132573204 16:652987-653009 ACTCAGAGCAGGCACCCAGCAGG - Intronic
1132885502 16:2180421-2180443 ACTGTGCCCGGACCCCCAGCAGG + Exonic
1132909856 16:2303885-2303907 ACTCAGAGGGGTCCCTGAGCAGG + Intronic
1134679584 16:16114874-16114896 TCTTTGAGCGGACCCCCAGTGGG + Exonic
1135052004 16:19200981-19201003 AGTCGGAGCTGCCCCCCAGCTGG - Intronic
1138492084 16:57382713-57382735 CCTCAGAAGGGACCCCCAGCAGG + Exonic
1138806476 16:60095595-60095617 ATGCAGAGCCGACCCACAGCTGG - Intergenic
1142414086 16:89931984-89932006 TCTCATCGGGGACCCCCAGCTGG - Intronic
1143583859 17:7841857-7841879 AGTCACAGCGGAGCCTCAGCCGG + Intronic
1144245799 17:13362963-13362985 ATACAGACCAGACCCCCAGCAGG + Intergenic
1151710111 17:75799612-75799634 GCACAGAGCTGACCCACAGCAGG - Intronic
1152789674 17:82272638-82272660 GTTCAGAGAGAACCCCCAGCGGG + Intronic
1152798963 17:82322307-82322329 CCTCAGAGCGGGAGCCCAGCAGG - Exonic
1155027860 18:21958501-21958523 ACTCACAGCAGACCCGCAGTGGG + Intergenic
1156298732 18:35817437-35817459 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1156462535 18:37329367-37329389 TCTCAGAGCCTACCCTCAGCTGG - Intronic
1157126486 18:44961016-44961038 AATCAGAGCGGAAACCCAGCTGG + Intronic
1157392868 18:47317497-47317519 ACTCTTGGTGGACCCCCAGCAGG + Intergenic
1162830891 19:13283537-13283559 ACCCAGAGAGGGCCCCCACCTGG - Intronic
1162919110 19:13889905-13889927 ACCCCCAGCAGACCCCCAGCAGG - Exonic
1163761291 19:19138050-19138072 CCCCAGAGTGGACCCCCAACAGG + Intronic
1165718822 19:38064236-38064258 ACTCAGAGGGGCGCCCCACCCGG + Intronic
1168129900 19:54311547-54311569 ACTCACAGCTGACCCCCAGTGGG - Exonic
927863883 2:26576675-26576697 ACTCAGAGCATGCCCCCAGGGGG - Intronic
927864013 2:26577331-26577353 ACTCAGTGAGGACACCCAGCTGG + Intronic
928429799 2:31207903-31207925 ACTCAGAGCAGAACCACAGTGGG - Intronic
932300565 2:70664018-70664040 ACTCTGAGCTGGACCCCAGCCGG - Intronic
932825309 2:74933634-74933656 CCACAGAGCAGACCCTCAGCTGG - Intergenic
938560737 2:132470071-132470093 ACTCAGCACTGACCCCCAACTGG + Intronic
946324599 2:218978646-218978668 AATCACAGAGGACCCCCACCAGG + Intergenic
948449132 2:238058131-238058153 ACTCGGAGCGGCCTGCCAGCCGG - Intronic
1170817144 20:19723081-19723103 ATTTAGAGGGGACCCACAGCTGG - Intergenic
1172764549 20:37344626-37344648 GCTCAGGGCGGGCCCCCAGCTGG - Intergenic
1176135241 20:63519667-63519689 GCTCAGTGAGGACCCACAGCTGG - Intergenic
1176271899 20:64239691-64239713 GCCCAGAGAGGACCCCCAGGAGG + Intronic
1180187084 21:46145359-46145381 ACCAACAGCGAACCCCCAGCTGG - Intronic
1180951770 22:19723681-19723703 ACTTAGAGGGGACTTCCAGCCGG + Intronic
1182586310 22:31346057-31346079 ACGCAGCGCGCGCCCCCAGCGGG - Exonic
1183329169 22:37210256-37210278 CCTCAGAGCTTACCCCCAGCGGG - Intronic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG + Intergenic
953755965 3:45646170-45646192 TCTCAGAGCGGTTGCCCAGCTGG + Intronic
953931849 3:47009510-47009532 CCTCAGGGCGGCCCCTCAGCCGG - Exonic
958448968 3:94249689-94249711 ACACAGAGCAGACCACCAGGGGG + Intergenic
959239273 3:103767797-103767819 ACACAGAGCCCACCCGCAGCAGG + Intergenic
959844728 3:111019441-111019463 ACTCAGAGGCACCCCCCAGCAGG + Intergenic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
960987137 3:123288063-123288085 ACTTAAAGCAGACTCCCAGCTGG + Intronic
971792371 4:31185243-31185265 ACTCAGAGTGGCCAGCCAGCTGG - Intergenic
977033958 4:91925239-91925261 GCTCAGAGCGGACCCACAGTGGG - Intergenic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
979550603 4:121986902-121986924 ACTCACAAAGTACCCCCAGCAGG - Intergenic
983373631 4:166896923-166896945 AATCAGAGGGGCCCCCCAGTTGG - Intronic
996064148 5:119063577-119063599 ACTCAGGGATGAACCCCAGCTGG - Intronic
998393058 5:141800160-141800182 TCCCAGAGAGGACGCCCAGCTGG - Intergenic
998845446 5:146304573-146304595 ACTCAGAGCGGACCCCCAGCAGG - Intronic
999648656 5:153744086-153744108 ACTCAGAGCAGGCCCAGAGCCGG + Intronic
1001896675 5:175388576-175388598 ACTCAGACATGACCCCCACCCGG + Intergenic
1002647766 5:180669594-180669616 ACGCAGAGCGGACTCTCAGATGG + Intergenic
1006936690 6:37723584-37723606 AATCAGAGCGGGGCCCCTGCCGG - Intergenic
1011604641 6:89091044-89091066 ACTTAGTGTGGACCCCCAACTGG - Intergenic
1016868401 6:148792328-148792350 ATTCAGAGCTGACCCCGGGCTGG + Intronic
1019802983 7:3102178-3102200 ACACAGAGGGGACCCACAGAAGG + Intergenic
1020650876 7:10874625-10874647 ACTTAGAGAGGATCCGCAGCTGG - Intergenic
1023793023 7:43768888-43768910 ACTGAGAGCTGACCCGCAGGTGG - Intronic
1026952616 7:74357538-74357560 ACTCAGAGCGGAGACCCTGGAGG + Intronic
1027202282 7:76071788-76071810 CCTCACAGTGGACCCCCACCAGG - Intergenic
1027336561 7:77157068-77157090 ACTCAGAGCTGACCCCTTGGAGG - Intronic
1029779231 7:102714041-102714063 ACTCAGAGCTGACCCCTTGGAGG + Intergenic
1030555479 7:111019397-111019419 AATCAGAGCAGCCCCGCAGCAGG + Intronic
1032066062 7:128772153-128772175 TCTCAGAATGGATCCCCAGCAGG + Intergenic
1032130810 7:129225581-129225603 TCTCAGAGATGCCCCCCAGCCGG + Intronic
1033585799 7:142773490-142773512 ACTCAGAGTGTTGCCCCAGCCGG - Intergenic
1034684570 7:152958917-152958939 GCACAGAGTGGACCCCCATCTGG + Intergenic
1035842342 8:2826356-2826378 ACTCAGAGCGGATGCACACCTGG - Intergenic
1038214076 8:25545697-25545719 ACTCAATGGGGACCCCCTGCAGG + Intergenic
1038254658 8:25940404-25940426 ACTCAGGGCAGACCCCATGCAGG + Intronic
1040090725 8:43396337-43396359 ACTGAGAGCCACCCCCCAGCAGG - Intergenic
1040706721 8:50137313-50137335 ACTCAGAGCGTCCCATCAGCAGG - Intronic
1045743353 8:105387563-105387585 ACTCAGAGCGGCCAGCCAGCCGG - Intronic
1046140465 8:110083780-110083802 ACTCAGAGGAGACCCCCAGTGGG - Intergenic
1048050169 8:130808969-130808991 ACTCAGGCCGGACCTCCAGCTGG + Intronic
1048486609 8:134853823-134853845 ACTTAGAGGGAACCCCAAGCTGG - Intergenic
1058733130 9:107869222-107869244 AGTCAGAGAGGCACCCCAGCAGG + Intergenic
1061565113 9:131433506-131433528 ACTCAGAGAGGACTTGCAGCAGG - Intronic
1186071013 X:5820721-5820743 ACTGAGAGCACACCCCCAGCAGG - Intergenic
1186147116 X:6635894-6635916 ACACAGTGAGGGCCCCCAGCCGG - Intergenic
1187267345 X:17747282-17747304 ACTCAGAGCTGCCCCCCATCGGG + Intronic
1187317104 X:18206579-18206601 ACTCAGAGCTGCCCCCAATCGGG - Intronic
1187401020 X:18960240-18960262 ACACAGAGCAGAACCACAGCCGG - Intronic
1192265286 X:69533488-69533510 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1197795937 X:130299064-130299086 ACTCAGAGGAGACCCGCAGTGGG + Intergenic