ID: 998849391

View in Genome Browser
Species Human (GRCh38)
Location 5:146339069-146339091
Sequence GCAGCGGGTGACATGGAATC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998849391_998849399 5 Left 998849391 5:146339069-146339091 CCTGATTCCATGTCACCCGCTGC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 998849399 5:146339097-146339119 TGCCAGGAGCGCGAAGATGATGG 0: 1
1: 0
2: 0
3: 7
4: 103
998849391_998849402 30 Left 998849391 5:146339069-146339091 CCTGATTCCATGTCACCCGCTGC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 998849402 5:146339122-146339144 ATGAACTCCAAGCAGCCTTTCGG 0: 1
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998849391 Original CRISPR GCAGCGGGTGACATGGAATC AGG (reversed) Exonic
900623404 1:3597426-3597448 GCAGCGGGAGACAGGGCGTCAGG - Intronic
906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG + Exonic
908503229 1:64766106-64766128 TCAGCAGGTGACACTGAATCTGG + Intronic
910027786 1:82679068-82679090 GAAGCGGGGGAGATGGAACCAGG + Intergenic
910357704 1:86378614-86378636 GCAGAAGGTGACAGGGAAGCAGG + Intronic
911430011 1:97773690-97773712 GAAGCGGATTACATGGAATTTGG + Intronic
919987332 1:202685027-202685049 GCAGAGGAGGACATGGAAGCCGG + Intronic
920713429 1:208317067-208317089 GCAGCGAGGGACATCTAATCAGG + Intergenic
1069238892 10:66113515-66113537 GCAGCGTTTGACCTTGAATCTGG - Intronic
1069927404 10:71860387-71860409 CCAGCGGGTGACAGGGCCTCAGG - Intergenic
1074876878 10:117620620-117620642 ACAGCAGGTCACATGGATTCAGG - Intergenic
1078448488 11:11422798-11422820 GCAGCTGGTGGCAAGCAATCTGG + Intronic
1078861215 11:15249037-15249059 GCTGTGAGTGACATGGAGTCTGG + Intergenic
1083737054 11:64687420-64687442 GCAGCTGGTGCCTTGGCATCCGG - Intronic
1089629214 11:119773573-119773595 GCAGCAGGAGAAATGGAAGCTGG - Intergenic
1089632324 11:119791581-119791603 GAAGTGGCTGACATGGAAGCTGG + Intergenic
1091594694 12:1869368-1869390 GCAGCGGGTGGCTTTGAATCTGG - Intronic
1095175602 12:39088748-39088770 GCAGAAGGTGACGTGGAAGCAGG + Intergenic
1095239413 12:39839150-39839172 TCAGCAGGTGACTTGGAATCTGG + Intronic
1095743804 12:45635213-45635235 GCAGCGTGTGAAATGAATTCTGG - Intergenic
1095965575 12:47864878-47864900 GCAGCTGGTGACAGGGCAGCTGG - Intronic
1106803145 13:33277527-33277549 GCCGTGGGTGACATGGGATATGG - Intronic
1108790388 13:53962916-53962938 GCAGAAGGTGACAAGGAAGCAGG + Intergenic
1111998082 13:95184440-95184462 GCAGAGGGGAAAATGGAATCTGG + Intronic
1112972212 13:105274066-105274088 ACAGAGAGTGACATGGAGTCTGG - Intergenic
1114129322 14:19771681-19771703 ACAGTGGGTGTCATGGGATCTGG + Intronic
1116364219 14:44039892-44039914 GCAGAAGGTGCCATGGAAGCAGG - Intergenic
1116694249 14:48151288-48151310 GCAGCAGGTGAAATGGAAGCAGG - Intergenic
1118257299 14:64216177-64216199 GTCACGGGTGACATGGCATCAGG - Intronic
1118766731 14:68915126-68915148 GCAGAGGGTGATATGGGGTCTGG - Intronic
1121528653 14:94637682-94637704 GCAGTGGGTGTCCTGGAATTAGG - Intergenic
1121528681 14:94637782-94637804 GCAGTGGGTGTCCTGGAATTAGG - Intergenic
1121558832 14:94859264-94859286 GCAGGGGGTGAAGTGGAGTCGGG + Intergenic
1122074264 14:99225788-99225810 TCAGAGAGTGAAATGGAATCTGG + Intronic
1123015172 14:105370071-105370093 CCAGCGGGTGACCTGGAGCCCGG - Intronic
1131133422 15:89914250-89914272 GCAGGTGGTGACATGAAGTCAGG - Intergenic
1134126292 16:11618505-11618527 GCAGCTGGTGTCAGAGAATCTGG + Intronic
1137633988 16:49969685-49969707 GTAGCGGGAGGCATGGACTCAGG - Intergenic
1139084090 16:63562798-63562820 GCAGAAGGTGAAGTGGAATCAGG - Intergenic
1140519120 16:75566672-75566694 GCGGAGGGTGACATGGGGTCAGG - Intronic
1141193442 16:81841796-81841818 GCAGCGTCTGACATGGCAGCTGG - Intronic
1146085747 17:29827402-29827424 GCAGAGGGTGAAATGGTAACAGG + Intronic
1150511424 17:65756602-65756624 GTAGTGGGAGACATGAAATCTGG + Intronic
1151821548 17:76499710-76499732 CCAGCAGGTCACATGGTATCAGG + Intronic
1152649156 17:81483964-81483986 GCAGCGGCTGGCCTGGAATTCGG - Intergenic
1153823630 18:8854779-8854801 GCAGAGGGAGAAATGAAATCTGG - Intergenic
1159422187 18:68235398-68235420 GCAGAGGGAGACATGAAATTTGG + Intergenic
1161452570 19:4354636-4354658 GCAGCGGGTCACCTGAACTCAGG + Intronic
1162306774 19:9879508-9879530 GCAGGGGGTGAAAGGGAAGCAGG - Intronic
1163716820 19:18877847-18877869 GCAGAGGGTCACATGGGTTCTGG - Intronic
1164388271 19:27794881-27794903 GCAGGGGGTGACATGGGCTATGG + Intergenic
1165185999 19:34021885-34021907 GCAGTGGGTGAAATGGTCTCTGG + Intergenic
1166068079 19:40371791-40371813 GTAGCGGGTGTCATAGAACCGGG - Exonic
1166110732 19:40621556-40621578 GAAGCGGGTGATATGGAGGCTGG + Intronic
1167971750 19:53192281-53192303 GCAGGGGGAGACCTGGGATCTGG - Intronic
925104341 2:1277739-1277761 GCAGCTGGTGACATGCAAGCTGG + Intronic
926218039 2:10917295-10917317 GCTGCAGGGGACCTGGAATCGGG - Intergenic
929055158 2:37870213-37870235 GTAGAGGGTGACATGGTAACAGG + Intergenic
929558255 2:42938778-42938800 GCTGGGGATGACATGGAATCTGG - Intergenic
933716661 2:85366463-85366485 GCAGCGGGTGAGATGGGTCCAGG - Intronic
938536989 2:132255775-132255797 ACCACGGGTGACAGGGAATCAGG - Intronic
940449122 2:153816321-153816343 GCAGAAGGTGACATGGCTTCAGG + Intergenic
943019096 2:182551435-182551457 GCAGTGGGTGTCGTGGAATTTGG + Intergenic
943126772 2:183803950-183803972 GCATGGGATGACCTGGAATCAGG + Intergenic
945274454 2:207974264-207974286 GCAGCTGGAGAAATGAAATCAGG - Intronic
946927074 2:224636689-224636711 GGAGAGGGTGAGATGGATTCGGG - Intergenic
947120863 2:226813339-226813361 GCAGTGGGAGCCATTGAATCAGG + Intergenic
1169600323 20:7252236-7252258 GCAGCGTGTAACATGGGATTTGG + Intergenic
1170703546 20:18725690-18725712 GCAGAGGGTGACTTGGGATTAGG - Intronic
1171411629 20:24951870-24951892 GCAGAGGATGACATGGCACCTGG - Intronic
1171767775 20:29299737-29299759 ACCACGGGTGACAAGGAATCAGG - Intergenic
1171865898 20:30487554-30487576 ACCACGGGTGACAGGGAATCAGG - Intergenic
1173643519 20:44619502-44619524 GCAGCAGGTGGCATGTAATTTGG - Exonic
1175584314 20:60125957-60125979 GCAGCGGGAGCCATGGGATGGGG + Intergenic
1175689382 20:61054609-61054631 GCAGAGTGTGACATGAAATGAGG + Intergenic
1176217298 20:63954260-63954282 GCTGCGGTTGAGATGGAGTCTGG - Intronic
1177129060 21:17234373-17234395 GCAGAGGCTGACATGGAAAATGG + Intergenic
1184011291 22:41750584-41750606 GTAGAGGGGAACATGGAATCAGG + Intronic
950437767 3:12991076-12991098 GCAGGGGGTGAGAGGGAGTCTGG + Intronic
954843058 3:53530215-53530237 GCGGTGGGTGACAGGGAATTGGG + Intronic
960383786 3:116995180-116995202 ACAGTGGGTGACATGGGTTCTGG - Intronic
976000616 4:80370102-80370124 GCAGAGGGTGAAAGGGAAGCTGG + Intronic
980658556 4:135824884-135824906 GAAGCAAGTGACATGGCATCAGG + Intergenic
982926723 4:161347034-161347056 GCAGTGGGTCACAAGGAATCTGG - Intergenic
984317654 4:178147995-178148017 GCAGAGGGTAAGATGCAATCTGG - Intergenic
985930575 5:3054292-3054314 GAAAAGGGTGACATGGAAGCTGG + Intergenic
989106450 5:37867535-37867557 GCAGCGTGTGACTTGGCATGGGG + Intergenic
992565280 5:77990173-77990195 GCAGAGGGTGGGATGGCATCTGG - Intergenic
993246371 5:85458527-85458549 GCAGAGGGTGTCAGGCAATCTGG + Intergenic
998301713 5:141028207-141028229 ACAGTGAGTGACATGGGATCAGG - Intergenic
998849391 5:146339069-146339091 GCAGCGGGTGACATGGAATCAGG - Exonic
1000662065 5:163949470-163949492 TCAGCAGGTGCCATGGGATCAGG + Intergenic
1001684681 5:173584601-173584623 GCAGGGAGTGACAAGGAATTTGG - Intergenic
1007417772 6:41702145-41702167 GCTGAGGGTGACATGGGATGAGG - Intronic
1009611470 6:65946986-65947008 GCATTGGGTGACTTGGATTCAGG + Intergenic
1018252092 6:161881491-161881513 GCAGTGGGATTCATGGAATCTGG - Intronic
1018533420 6:164793229-164793251 AGAGAGGGTGATATGGAATCAGG + Intergenic
1018544313 6:164918880-164918902 GCAAGGGCTGGCATGGAATCTGG + Intergenic
1019288729 7:236716-236738 GAGGCGGGTGCCCTGGAATCTGG + Intronic
1019288747 7:236773-236795 GAGGCGGGTGCCCTGGAATCTGG + Intronic
1019288769 7:236842-236864 GAGGCGGGTGCCCTGGAATCTGG + Intronic
1021490419 7:21214306-21214328 GCAGCTGGTGGCATGGAAAAAGG + Intergenic
1025143497 7:56484516-56484538 GCAGGGGGTGACATGGCCTGTGG + Intergenic
1025609719 7:63067808-63067830 GCAGGGGGTAACATGGACTGTGG - Intergenic
1031448361 7:121882716-121882738 GCCGAGGGAGACAGGGAATCAGG + Intronic
1035437230 7:158868107-158868129 GAAGAGTGTGACATAGAATCTGG + Intronic
1035985540 8:4427356-4427378 GCAGAGGGTGATCTGGAACCAGG + Intronic
1043387666 8:79764529-79764551 GCAGCTGGTCAGATGGATTCAGG + Exonic
1044290386 8:90462114-90462136 GCAGAGAGTGACATGGGACCTGG - Intergenic
1047032409 8:120896660-120896682 GCAGAGGGTGCAATGGATTCTGG - Intergenic
1048042078 8:130740426-130740448 GTGGCAGCTGACATGGAATCTGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049180430 8:141219398-141219420 GCAGAGGGTGACATGCATGCTGG - Intronic
1056204579 9:84307707-84307729 GCAGAGGGTGACATTTAATAGGG + Intronic
1056280922 9:85040688-85040710 GCAGAGGATGAAAAGGAATCTGG + Intergenic
1186825879 X:13339827-13339849 GCAGGGTGTGACCTGGAATTTGG - Intergenic
1197874624 X:131090035-131090057 GAAGGGGGTGACAAGGAATGAGG + Intergenic