ID: 998852430

View in Genome Browser
Species Human (GRCh38)
Location 5:146364002-146364024
Sequence CAGAAGAAGGAGATGAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998852426_998852430 11 Left 998852426 5:146363968-146363990 CCAAATAATCTAGAGAGTTATAG No data
Right 998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG No data
998852425_998852430 12 Left 998852425 5:146363967-146363989 CCCAAATAATCTAGAGAGTTATA No data
Right 998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998852430 Original CRISPR CAGAAGAAGGAGATGAAGGG TGG Intergenic
No off target data available for this crispr