ID: 998856890

View in Genome Browser
Species Human (GRCh38)
Location 5:146402310-146402332
Sequence CCAAATGGCAGTTGCTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998856887_998856890 -1 Left 998856887 5:146402288-146402310 CCATAGCACAGAGTAAGCACTGC No data
Right 998856890 5:146402310-146402332 CCAAATGGCAGTTGCTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998856890 Original CRISPR CCAAATGGCAGTTGCTCTTA TGG Intergenic
No off target data available for this crispr