ID: 998870649

View in Genome Browser
Species Human (GRCh38)
Location 5:146548367-146548389
Sequence GATTCTACTGCACCACGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998870649_998870653 -5 Left 998870649 5:146548367-146548389 CCTGCTCGTGGTGCAGTAGAATC No data
Right 998870653 5:146548385-146548407 GAATCTGGAAAATGAGAGGGAGG No data
998870649_998870654 1 Left 998870649 5:146548367-146548389 CCTGCTCGTGGTGCAGTAGAATC No data
Right 998870654 5:146548391-146548413 GGAAAATGAGAGGGAGGAGCTGG No data
998870649_998870651 -9 Left 998870649 5:146548367-146548389 CCTGCTCGTGGTGCAGTAGAATC No data
Right 998870651 5:146548381-146548403 AGTAGAATCTGGAAAATGAGAGG No data
998870649_998870652 -8 Left 998870649 5:146548367-146548389 CCTGCTCGTGGTGCAGTAGAATC No data
Right 998870652 5:146548382-146548404 GTAGAATCTGGAAAATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998870649 Original CRISPR GATTCTACTGCACCACGAGC AGG (reversed) Intergenic
No off target data available for this crispr