ID: 998872046

View in Genome Browser
Species Human (GRCh38)
Location 5:146562046-146562068
Sequence GATGGGGTCACGAGTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998872041_998872046 13 Left 998872041 5:146562010-146562032 CCAGTGTAGTTATCAGTGGCATG No data
Right 998872046 5:146562046-146562068 GATGGGGTCACGAGTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998872046 Original CRISPR GATGGGGTCACGAGTTTTTC TGG Intergenic
No off target data available for this crispr