ID: 998874335

View in Genome Browser
Species Human (GRCh38)
Location 5:146584090-146584112
Sequence TGGGGAATGAGCAGCAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 1, 2: 2, 3: 53, 4: 595}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998874330_998874335 -8 Left 998874330 5:146584075-146584097 CCCAGGTTGACTTTTTGGGGAAT 0: 1
1: 0
2: 1
3: 11
4: 165
Right 998874335 5:146584090-146584112 TGGGGAATGAGCAGCAGGGGCGG 0: 1
1: 1
2: 2
3: 53
4: 595
998874326_998874335 1 Left 998874326 5:146584066-146584088 CCAGGAAAACCCAGGTTGACTTT 0: 1
1: 0
2: 1
3: 18
4: 200
Right 998874335 5:146584090-146584112 TGGGGAATGAGCAGCAGGGGCGG 0: 1
1: 1
2: 2
3: 53
4: 595
998874331_998874335 -9 Left 998874331 5:146584076-146584098 CCAGGTTGACTTTTTGGGGAATG 0: 1
1: 0
2: 0
3: 14
4: 127
Right 998874335 5:146584090-146584112 TGGGGAATGAGCAGCAGGGGCGG 0: 1
1: 1
2: 2
3: 53
4: 595
998874325_998874335 2 Left 998874325 5:146584065-146584087 CCCAGGAAAACCCAGGTTGACTT 0: 1
1: 0
2: 1
3: 15
4: 156
Right 998874335 5:146584090-146584112 TGGGGAATGAGCAGCAGGGGCGG 0: 1
1: 1
2: 2
3: 53
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998874335 Original CRISPR TGGGGAATGAGCAGCAGGGG CGG Intronic
900143728 1:1149323-1149345 TGTGGCATGAGCAGCCGAGGGGG + Intergenic
900586882 1:3436950-3436972 TGGGGTCTGAGGAGCAGCGGAGG - Exonic
900949984 1:5853131-5853153 TGGGGAGTGGGATGCAGGGGAGG + Intergenic
901018689 1:6245358-6245380 TCGGGGAGGAGGAGCAGGGGTGG - Exonic
901037321 1:6344103-6344125 AGAGGAAAGAGCAGCAGGAGTGG + Intronic
901122633 1:6907805-6907827 TGGGGCAGGAGCAGAAGGGCTGG - Intronic
901251499 1:7783679-7783701 TGGGGAGCGAGAGGCAGGGGCGG - Intergenic
901324983 1:8360529-8360551 TGAGGCATGAGTTGCAGGGGTGG + Exonic
901727111 1:11250523-11250545 TGGGGAAGGAACAGCCAGGGAGG - Intronic
901817786 1:11804917-11804939 TGGGGAGTGAGGAACGGGGGCGG + Intronic
901925008 1:12560577-12560599 TGGTGAGTGAGGAGCAGGGGAGG - Intergenic
902472162 1:16656730-16656752 TGGAGGAGGAGCAGCAGGGAGGG - Intergenic
902486641 1:16750716-16750738 TGGAGGAGGAGCAGCAGGGAGGG + Intronic
902776714 1:18679488-18679510 AGGGGAAAGAGCAGCAGCTGGGG - Intronic
903085595 1:20854998-20855020 TGGGGAAAAGGCAGCAGTGGTGG - Exonic
903489169 1:23714862-23714884 TGGAGAATGAATTGCAGGGGTGG + Intergenic
903576560 1:24342969-24342991 TTGGGGATGAACAGCACGGGTGG - Exonic
903668187 1:25020810-25020832 TGTGCAATGGGCAGCAGGGGTGG - Intergenic
904009386 1:27381159-27381181 TGGGGGATGAGGAGCAGAAGAGG + Intronic
904434229 1:30483866-30483888 TGGGGACTGGGCAGTAGGAGAGG + Intergenic
905169342 1:36099939-36099961 TGGGGAATGAGGAGCTGTGGAGG + Intronic
906276529 1:44520633-44520655 TGGGGGAAGAGCAGTAGGGAAGG - Intronic
906282833 1:44565900-44565922 TGGGGAGTGAGAAGCAGCAGTGG - Intronic
906511743 1:46413967-46413989 TGGGTGATGGGCACCAGGGGAGG - Intergenic
907881679 1:58555234-58555256 TGGGGACTCAGCAGCAGATGGGG - Intergenic
907889326 1:58622586-58622608 TCGGGAACTTGCAGCAGGGGTGG - Intergenic
908366097 1:63425223-63425245 AGGGGAATGATCAGCAGAGAAGG + Intronic
908462274 1:64357162-64357184 TGGGGAAGCAGCAGCAGCGTGGG - Intergenic
908571984 1:65420292-65420314 TGGGGCGGGACCAGCAGGGGAGG + Intergenic
909939381 1:81592777-81592799 TGGGGAAGGAGGTGTAGGGGTGG + Intronic
910731827 1:90406141-90406163 TGGGGCATGAGCAGTAGTGAGGG - Intergenic
910827775 1:91428038-91428060 TGGGGAGTGAGGGGCGGGGGCGG - Intergenic
911025913 1:93435291-93435313 TGGGCACTGAGGAGCATGGGAGG - Intergenic
911088019 1:93995762-93995784 TGGGGAATAAGGAGCAGAGAAGG - Intronic
912492875 1:110071485-110071507 TGGAGGATGAGCAGAAGGGCTGG + Intronic
912618771 1:111134051-111134073 TGGGGCAGCAGGAGCAGGGGCGG + Intronic
913600998 1:120421053-120421075 TGGACAAGGAGCAGCAGGGAAGG + Intergenic
913688307 1:121254800-121254822 GGAGGAATGAGCAGAAGGAGTGG + Intronic
913939424 1:125087375-125087397 GGGGGAATAAGCCGCTGGGGCGG + Intergenic
914040163 1:144042443-144042465 GGAGGAATGAGCAGAAGGAGTGG + Intergenic
914086057 1:144455580-144455602 TGGACAAGGAGCAGCAGGGAAGG - Intronic
914149294 1:145025477-145025499 GGAGGAATGAGCAGAAGGAGTGG - Intronic
914247567 1:145897289-145897311 CCGGGCATGAGCAGAAGGGGCGG + Exonic
914362137 1:146944495-146944517 TGGACAAGGAGCAGCAGGGAAGG + Intronic
914489489 1:148142460-148142482 TGGACAAGGAGCAGCAGGGAAGG - Intronic
914589856 1:149097481-149097503 TGGACAAGGAGCAGCAGGGAAGG - Intronic
914753596 1:150551022-150551044 AGTGGGATGAGGAGCAGGGGTGG + Intronic
914783871 1:150810542-150810564 AGGGGACTGAGGAGCAAGGGTGG - Exonic
915012151 1:152697881-152697903 TGAGGGCTGAGCAGAAGGGGAGG + Intergenic
915361103 1:155286847-155286869 TTGGGATTGAGCAGTCGGGGAGG + Intronic
916328494 1:163590655-163590677 TGGTGACTGAGCAGCTGGGTGGG - Intergenic
916456278 1:164973961-164973983 GGGGAAATGAGCCGCAGGAGTGG - Intergenic
916505602 1:165425687-165425709 TGGGGATGGGGCAGCAGTGGGGG - Intronic
916517789 1:165536177-165536199 TGGGGAATGAGGAGGTGTGGAGG - Intergenic
916578997 1:166091070-166091092 TGAAGGATGAGCAGCAGAGGAGG + Intronic
917135081 1:171781721-171781743 TGGGGAAGGAACAGCAGGCGCGG + Exonic
917680667 1:177363457-177363479 TGGTGAATGAGCAGAAGAGAAGG + Intergenic
917724520 1:177816146-177816168 TGGGGATCGAGCACCAGGGCAGG - Intergenic
918107266 1:181425690-181425712 TGGGGTATGAGCGGCTGAGGTGG - Intronic
918447433 1:184629356-184629378 TGGGGATTGAGCAGGAGAGAAGG - Intergenic
920110876 1:203586263-203586285 TCTGGAATGTGCAGCAGGGAGGG - Intergenic
920438796 1:205965001-205965023 TGGAGAAGAAGCAGCAGGTGAGG + Intergenic
920475626 1:206273299-206273321 GGAGGAATGAGCAGAAGGAGTGG + Intronic
920800772 1:209185441-209185463 GGGAGAAAAAGCAGCAGGGGTGG + Intergenic
920811703 1:209291963-209291985 GGAGGAGTGAGCAGCAAGGGAGG + Intergenic
920917631 1:210270792-210270814 TGGGGAATAAACAGCAGGAGAGG + Intergenic
920983797 1:210864292-210864314 TGGGGAATGAGGAGCAGCTTAGG + Intronic
921776943 1:219112174-219112196 TGGGGAAGGAGCAGGTGGGCTGG - Intergenic
921917680 1:220630584-220630606 TGGGGAATGAAAATCAGGGTTGG - Intronic
923051584 1:230394400-230394422 TGGGGTGTGGGCAGCGGGGGAGG - Intronic
923446753 1:234078343-234078365 TGAGGAATGAGTAGGAGGTGAGG - Intronic
923510251 1:234645314-234645336 TGGGGAATTAGAAGTAGGAGAGG - Intergenic
923644551 1:235804452-235804474 TTGGGTATGACCAGCAGAGGCGG - Intronic
923779946 1:237013229-237013251 GGGGGAAGGAGCAGAAGGGCTGG - Intergenic
923898394 1:238298663-238298685 TGAGGAAGCAGCAGCAGGGTTGG + Intergenic
924350002 1:243105708-243105730 AGGGGAAAGAGCAGCAGGAGGGG + Intergenic
924497249 1:244602396-244602418 TTGAGAATCAGCGGCAGGGGTGG + Intronic
924854728 1:247864883-247864905 TGGCGGATGAGCTGCAGGAGAGG + Exonic
1062948047 10:1475458-1475480 TGGGGAGGGGACAGCAGGGGAGG + Intronic
1063046411 10:2397079-2397101 TGGGGAATGAGGCCCAGGGCAGG - Intergenic
1063235889 10:4115938-4115960 AAGGGAATAAGCAGCAGGGCAGG - Intergenic
1064314106 10:14238675-14238697 GGGGGAAGGAGCATAAGGGGAGG - Intronic
1065081791 10:22136465-22136487 TGGGGAATGAGCAGGAGCCAGGG - Intergenic
1065563873 10:26989781-26989803 TGTTGAATGAGCAGCAGATGAGG + Intergenic
1066355604 10:34680584-34680606 AGGGGAATGAGAAGCGGGAGGGG + Intronic
1066950742 10:42113182-42113204 CGGGGAATAAGCTGCAGCGGCGG + Intergenic
1067089691 10:43260290-43260312 AGAGGAAGGAGCAGCAGGTGTGG - Intronic
1068905465 10:62317141-62317163 TGGGGATCCAGCAGCAGGGAAGG + Intergenic
1069991494 10:72319427-72319449 TGGGGAGTGGGGGGCAGGGGAGG - Intergenic
1070609911 10:77926261-77926283 TAGAGAATGGGCAGCAGGTGAGG + Exonic
1070824850 10:79385140-79385162 TGGGGGATGAAAAGCAGGGCTGG + Exonic
1070933377 10:80276043-80276065 TGGGGAATGTGCACCAGAGCAGG + Intronic
1071514335 10:86287161-86287183 TGGGGAAGGAGCTGCAGGTGAGG + Intronic
1071785941 10:88899869-88899891 TGGGGAATGTGAAGCCGGGGAGG - Intronic
1072223794 10:93349394-93349416 TGGGGAAGGGGCAGCTGTGGGGG - Intronic
1072530456 10:96313843-96313865 TGGCGATGGAGCAGCAGGGTAGG + Intronic
1072625458 10:97108203-97108225 TCTGGAAGGTGCAGCAGGGGAGG + Intronic
1073428944 10:103473477-103473499 TGCGGAGTGAGCTGCAGGCGCGG - Exonic
1073592775 10:104772227-104772249 AGGGGATTGTGCAGCAGGGGTGG + Intronic
1074447250 10:113530615-113530637 GAGGGAAAGAGCAGTAGGGGAGG + Intergenic
1075600594 10:123765792-123765814 TGGAGGAGGAGCAGCAGGGTGGG - Intronic
1075919502 10:126198595-126198617 CTGGGTAGGAGCAGCAGGGGAGG - Intronic
1076372955 10:129966863-129966885 TGGGGCAGGAGCAGCAGCAGAGG + Intergenic
1076379576 10:130015799-130015821 TGGGGATTGGGGAGCAGGGGTGG + Intergenic
1076425006 10:130361484-130361506 AGGGGAAGGAGCAGGAGGGGAGG + Intergenic
1076666293 10:132094835-132094857 TGGGGAAGGACCATCAGGTGGGG + Intergenic
1076748180 10:132524934-132524956 TGGGGAACAAATAGCAGGGGTGG - Intergenic
1076802180 10:132835873-132835895 TGGGGAAGGGGGAGCAGGGGCGG - Intronic
1077376776 11:2208963-2208985 TGGCCAATGGGCAGCAGAGGGGG + Intergenic
1077445333 11:2588059-2588081 TGGGAGGGGAGCAGCAGGGGAGG + Intronic
1077463795 11:2723900-2723922 TGGGGGATGTGCCGCAGGGATGG + Intronic
1077483271 11:2826527-2826549 CGGGGAAGCAGCAGCAGGAGGGG - Intronic
1077702758 11:4456914-4456936 TGGGGAATGATAAACAGAGGAGG - Intergenic
1077896485 11:6457199-6457221 TGGGGAATGGGGAGCTGGTGTGG + Intronic
1078869174 11:15327978-15328000 TGGGGAATGAGCAGGAGTGGGGG + Intergenic
1079323573 11:19472697-19472719 TGGGGAAACAGCATCAAGGGAGG - Intronic
1079390931 11:20021692-20021714 TGGGGAGTGGGAAGCAGAGGTGG - Intronic
1080005122 11:27398529-27398551 TATGGACTGAGCAGCAGGGAGGG + Intronic
1080402301 11:31947437-31947459 TAGGGAAGGAGCATCAGGTGGGG - Intronic
1080906406 11:36550112-36550134 TGGGGACTGGGGAGCTGGGGAGG + Intronic
1081159473 11:39735136-39735158 TGGGGAATGGAGAGAAGGGGTGG - Intergenic
1081446957 11:43139966-43139988 TGGGGAATCATCAGCATGGGGGG - Intergenic
1082785877 11:57316300-57316322 TGGGGATGGTGCAGGAGGGGAGG - Intronic
1083733977 11:64669237-64669259 TGGAGATTGGGCTGCAGGGGTGG - Intronic
1083827317 11:65211041-65211063 TGGGAAAGGAGCAGGAGGGGAGG + Intronic
1084877249 11:72142366-72142388 TGGGGAATGGGCAGCAGTTAAGG + Intergenic
1084939012 11:72602407-72602429 TGGGCAAACAGCAGCAGGTGTGG - Intronic
1085026145 11:73237755-73237777 TGGGCACTGAGCAGCAAGGTGGG - Intergenic
1085339649 11:75722826-75722848 TGGGGAAGGAGCAGGAAGGACGG - Intronic
1085697611 11:78718493-78718515 TGGTGAATGTGCAGCAGGGCTGG + Intronic
1085732856 11:79013918-79013940 TGGGGAGTGAGCAGGGAGGGAGG - Intronic
1086445888 11:86869970-86869992 TGGCTAATAAGCAGCAGGGCTGG + Intronic
1087613518 11:100462081-100462103 GGGGGAATGAGCTGGAGGTGTGG - Intergenic
1088328869 11:108629345-108629367 TGGGCACTGAGGAGCATGGGAGG - Intergenic
1088395501 11:109363501-109363523 TGGAGAAAGAACAGTAGGGGAGG - Intergenic
1088741409 11:112770407-112770429 TGGGGAAGGAGCAGAAGGATAGG - Intergenic
1090168329 11:124576018-124576040 TGGGGAGTGGGAAGCAGAGGTGG - Intergenic
1090205965 11:124884572-124884594 TGGGGGAAGAGCAGCAGGCAGGG + Exonic
1090468779 11:126959716-126959738 TGTGAAATCAGGAGCAGGGGAGG - Intronic
1090659243 11:128870246-128870268 GGGGGAAAGAGCAACAGGCGGGG + Intergenic
1091549778 12:1529128-1529150 GGGGGAAGGGGCAGCAGGGAGGG - Intergenic
1091687551 12:2574509-2574531 TGGGAAGGGAGCTGCAGGGGAGG - Intronic
1093006613 12:14058297-14058319 TTGGGAATTAGCAGCAGAGCAGG + Intergenic
1093064759 12:14645573-14645595 AGAGGAATAAGCAGCAGGCGGGG + Intronic
1093720580 12:22437488-22437510 TAGGGAAGGACCAGCAGGTGGGG - Intergenic
1094765414 12:33588844-33588866 TGGACAATGAGCAGGAGTGGTGG + Intergenic
1095651864 12:44620675-44620697 TGGGGAGTGAGAAGAAGGGAGGG - Intronic
1096258526 12:50077079-50077101 TGGAGAATGGGCTGCACGGGAGG + Intronic
1096264210 12:50110787-50110809 TGAGGAAAGAACAGGAGGGGAGG + Exonic
1096493120 12:52023692-52023714 AGGAGGAGGAGCAGCAGGGGAGG - Intronic
1096650544 12:53060097-53060119 TGGGGAGTGGGCACCAGGGCTGG - Exonic
1096847675 12:54417107-54417129 GGGGAGATGAGCAGAAGGGGAGG + Intronic
1097874755 12:64632646-64632668 TGTGGAATGGGGAGCACGGGAGG + Intronic
1098027892 12:66224447-66224469 TGGGGGATGAGCAGCAGAATAGG + Intronic
1098179817 12:67833857-67833879 AGGGGCATGTGCAGCAGAGGTGG + Intergenic
1098500609 12:71187583-71187605 TGGGGAAGGATCATCAGGTGGGG - Intronic
1099561006 12:84174045-84174067 TGGGCACTGAGGAGCATGGGAGG - Intergenic
1100339141 12:93661282-93661304 TAGGGAAAGAGCAGCATGGTGGG + Intergenic
1101170407 12:102086660-102086682 TGGAGAATGAGCAGTGGGTGAGG - Intronic
1101751080 12:107582825-107582847 GGGGCAATGAGCAGGAGTGGTGG - Intronic
1101843215 12:108342315-108342337 GGGGGAAAGAGAAGAAGGGGAGG + Intergenic
1102504499 12:113375029-113375051 TGGGGGATGAGCAGGTGGGTGGG + Intronic
1102933369 12:116878943-116878965 TGGGGCCTGCGCTGCAGGGGAGG - Intronic
1103919751 12:124393224-124393246 TGGGGAAGGAGGGGCAGGGCAGG - Intronic
1104948061 12:132425947-132425969 TGGCGGAGGAGCTGCAGGGGTGG - Intergenic
1105261494 13:18782957-18782979 TGGGGATTGGGAAGCATGGGTGG - Intergenic
1106220132 13:27739977-27739999 TGTGGGATGAGCAGCAGATGCGG - Intergenic
1106299926 13:28454087-28454109 TGGGGAAAGAGCAGTAAGAGGGG - Intronic
1106555473 13:30804720-30804742 AGTGGCATCAGCAGCAGGGGTGG + Intergenic
1108189638 13:47924368-47924390 TGGGGACTCAGCAGAATGGGTGG + Intergenic
1109016594 13:57022732-57022754 TGGGGAATCAGGAGAAAGGGTGG + Intergenic
1109510771 13:63369034-63369056 TGGGGAGTGGGTGGCAGGGGAGG + Intergenic
1109930795 13:69214774-69214796 CTGGTAATGAGGAGCAGGGGTGG + Intergenic
1111328485 13:86731412-86731434 TGGGGAAAGAGCACCAGGTGGGG + Intergenic
1112872792 13:103995384-103995406 TGGGGTAGGAGAAGCAGGGAGGG - Intergenic
1112936554 13:104806816-104806838 TGGGAAATGAGCAGAAGGGGAGG + Intergenic
1113070299 13:106413953-106413975 TGTGGGGTGAGCAGCAGCGGAGG - Intergenic
1113420992 13:110171308-110171330 TGGGGAGAGGGCAGGAGGGGGGG + Intronic
1113518901 13:110924323-110924345 TGTGGGATGGGCAGCAGGTGTGG - Intergenic
1113909877 13:113836722-113836744 AGGGGAATGAGGAGGAGGAGGGG + Intronic
1113956649 13:114102976-114102998 GGGTGAGCGAGCAGCAGGGGTGG - Intronic
1115724496 14:36198476-36198498 AGGGGAATGGGGAGGAGGGGAGG + Intergenic
1115987583 14:39118015-39118037 TGGGGAATAACCTTCAGGGGCGG - Exonic
1116023727 14:39491391-39491413 GGATGAATGAGAAGCAGGGGAGG - Intergenic
1116639720 14:47445736-47445758 TGAGGGATAAGCAGAAGGGGAGG + Intronic
1117611333 14:57486044-57486066 AGGGGAAGGAGAAGAAGGGGAGG + Intronic
1117930841 14:60838957-60838979 TGGGGAATGAGGAGCATGAGAGG + Intronic
1118229942 14:63938485-63938507 TGGAGAAGGAGCAGAAAGGGTGG + Intronic
1118507235 14:66426752-66426774 TGAGGAATGTGAGGCAGGGGAGG + Intergenic
1118572515 14:67207713-67207735 TGGGAAATTAGGAGGAGGGGGGG + Intronic
1118782051 14:69014972-69014994 TGGGCAATGAGCAGAAAAGGGGG + Intergenic
1119116534 14:72027062-72027084 TGGGGAAGGAGTAGAAGAGGAGG + Intronic
1119177355 14:72578918-72578940 TGGGGAATAAGCAAGTGGGGTGG + Intergenic
1119395016 14:74319877-74319899 TGGAGAAGGAGCAGCCAGGGAGG + Intronic
1119424985 14:74529167-74529189 AGGGGAATGCGCAGCTGGGAGGG + Intronic
1119740667 14:77012006-77012028 AGGAGAATGAGTAGCAGGAGGGG - Intergenic
1119771122 14:77221149-77221171 TGGGGCATGAGTGGGAGGGGAGG - Intronic
1120334057 14:83131024-83131046 AGGGGAAAGAGCAGAAGGAGAGG + Intergenic
1122074721 14:99228749-99228771 AGGGGAAGGAGGAGCAGGGAGGG - Intronic
1122397046 14:101441263-101441285 TGGGGGAGGAGCAGCCGGGAGGG - Intergenic
1122411630 14:101528767-101528789 TGGGGAAGGAGGAAGAGGGGTGG + Intergenic
1122760430 14:104020894-104020916 TGGGGCATGAGGAGCAGGCATGG - Intronic
1122779962 14:104139380-104139402 TGTGGAAACAGCAGCAGGGAAGG - Intronic
1122794077 14:104197024-104197046 TGGGGACTGAGAGGCAGGGCTGG + Intergenic
1122977945 14:105178653-105178675 TGGGGGATGAGCAGCTGGCCTGG - Intronic
1123106610 14:105844772-105844794 TGAGGAATGAGCAGGTGGGTGGG + Intergenic
1123800633 15:23816215-23816237 TGGGTAATGAGGAGCATGAGGGG + Intergenic
1124127086 15:26945821-26945843 GAAGGAATGTGCAGCAGGGGTGG - Intronic
1124256467 15:28146711-28146733 TGGGGAGTGAGCGGCATTGGAGG + Intronic
1124338817 15:28876719-28876741 TGGAGGAGGAGCAGGAGGGGTGG + Intergenic
1124567763 15:30832382-30832404 TGGGGAGTGAGCGGCATTGGAGG - Intergenic
1124883242 15:33661103-33661125 TGGGTCACGAGCAGCAGGGCAGG + Intronic
1125316883 15:38441403-38441425 TGGAGACAGAGCAGCTGGGGAGG + Intergenic
1125330389 15:38576051-38576073 AGGCTAATGAGCAGCAGGGATGG + Intergenic
1125381642 15:39092605-39092627 TGGGCACTGAGGAGCATGGGAGG - Intergenic
1125528691 15:40396451-40396473 CAGGGACTGAGCAGGAGGGGAGG + Intergenic
1125709843 15:41775548-41775570 AGGAAAAAGAGCAGCAGGGGTGG + Intronic
1127981404 15:64037880-64037902 AGGTGAGTAAGCAGCAGGGGAGG - Intronic
1128062284 15:64742673-64742695 TGGGGGATGAGCATCCAGGGAGG + Intronic
1128320522 15:66690582-66690604 TTGGGAAGGAGAATCAGGGGAGG - Intergenic
1128451339 15:67807466-67807488 AGGGCAGTGAGGAGCAGGGGTGG - Intergenic
1129057992 15:72835739-72835761 AGGGGGAAGAGGAGCAGGGGAGG + Intergenic
1129252658 15:74317493-74317515 TGGGCACCCAGCAGCAGGGGTGG + Intronic
1129319989 15:74769226-74769248 TGGGGAATGAGAGGAAGTGGGGG - Intergenic
1129679980 15:77653271-77653293 TGGGGAAAGAACAGCAGGCAAGG - Intronic
1129997117 15:80016515-80016537 TGTGGAAGGAGAGGCAGGGGGGG + Intergenic
1130096899 15:80862694-80862716 AGGTGGATGAGGAGCAGGGGTGG + Intronic
1131026762 15:89149500-89149522 AGGTGAATGAGCAGCAGGAGGGG + Intronic
1131261669 15:90890988-90891010 TCCGGAATGAGCTGCAGCGGTGG - Exonic
1132502219 16:289609-289631 TGGGGAAAGAGATGCAGCGGTGG + Intronic
1132535200 16:475604-475626 TGGGAAGTGAGCAGGTGGGGTGG + Intronic
1132606814 16:797094-797116 TGTGGAATGGGCAGCTGTGGGGG + Intronic
1133412030 16:5577015-5577037 TGGGGAGAGAGGAGCAGAGGAGG - Intergenic
1133520143 16:6549159-6549181 GGGGGAAGGAGGAGGAGGGGAGG + Intronic
1133640202 16:7709469-7709491 ATGTGAATGAGCAGCAAGGGAGG - Intronic
1134242450 16:12515981-12516003 AGGGGAAGGGGAAGCAGGGGAGG + Intronic
1135382219 16:22004693-22004715 TGGGGAAAGGGAAGCAGGGGTGG - Intergenic
1137379666 16:47985765-47985787 TGAGGAAAGAGCAGGAGGTGAGG + Intergenic
1137456797 16:48623725-48623747 TGTGGAGAGAGCAGCTGGGGAGG + Intergenic
1139517663 16:67461301-67461323 TGGGGAAAGAGAAACAGGGCTGG + Intronic
1139561252 16:67743805-67743827 TGGTGAATGAGCAGCAGCCGGGG - Intronic
1139659710 16:68412190-68412212 TGAGGAATGAGCAGTTGGTGGGG + Intronic
1140491304 16:75338222-75338244 TGGGGAATGTGAAGCATGGGGGG + Intronic
1140549995 16:75855421-75855443 GGGGAAATGAGCAGCACGGATGG + Intergenic
1140772047 16:78214073-78214095 CAGGGCATGGGCAGCAGGGGAGG - Intronic
1141516710 16:84549623-84549645 TGGGGCTAGAGCAGCGGGGGTGG + Intronic
1141903457 16:87007511-87007533 CGAGGAAGGAGCAGCAGTGGGGG - Intergenic
1141942529 16:87287013-87287035 TGGGGAAAGAGCAGGAGGGAAGG + Intronic
1142112563 16:88340116-88340138 TGGGGTAGGAGGAGAAGGGGTGG - Intergenic
1142485859 17:247331-247353 TGGGCAAGGAGCAGGAGGGGAGG - Intronic
1142614163 17:1125312-1125334 AGGGGAATGAGGAGCAGAAGGGG - Exonic
1142641440 17:1288266-1288288 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641552 17:1288520-1288542 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641581 17:1288592-1288614 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641604 17:1288646-1288668 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641672 17:1288791-1288813 TGGGGGATGAGAAGCTGGAGGGG - Intronic
1142641851 17:1289176-1289198 TGGGGGATGAGGAGCCGGAGGGG - Intronic
1142641874 17:1289230-1289252 TGGGGGATGAGGAGCCGGAGGGG - Intronic
1142641951 17:1289413-1289435 TGGGGGATGAGGAGCCGGAGGGG - Intronic
1142681617 17:1552978-1553000 TGCGGCATGAGCAGCGGGGCCGG - Intronic
1142759396 17:2034473-2034495 GGGGGAGGGAGGAGCAGGGGAGG - Intronic
1142759485 17:2034664-2034686 AGGGGGATGGGGAGCAGGGGAGG - Intronic
1142759532 17:2034761-2034783 AGGGGAGGGGGCAGCAGGGGAGG - Intronic
1143164165 17:4889681-4889703 AGGAGAAGGAGCAGCAGCGGCGG + Exonic
1143593641 17:7901065-7901087 TGGGTATTGAGCCACAGGGGTGG + Intronic
1144022212 17:11247443-11247465 TGGGGAGAGGGCAGCAGGGAAGG - Intronic
1144169933 17:12649787-12649809 TGGGGTATGTGCAGAAGGAGAGG + Intergenic
1144659385 17:17058403-17058425 TGGGGAATGGGGACCTGGGGAGG + Intronic
1144715614 17:17433566-17433588 TGGGGGAGGGGCAGCAGGTGGGG - Intergenic
1145193846 17:20869547-20869569 AGGGTAGTGAGCAGCAGGAGTGG + Intronic
1145207216 17:20990946-20990968 TGGAGAAAGAGCAGGTGGGGAGG + Intergenic
1145298185 17:21611620-21611642 AGGGTAGTGAGCAGCAGGAGTGG - Intergenic
1145352069 17:22091773-22091795 AGGGTAGTGAGCAGCAGGAGTGG + Intergenic
1146270682 17:31483421-31483443 AGGGGAATGAGCCCCAGAGGTGG - Intronic
1146453703 17:32993810-32993832 AGGGGAAGGAGGAGCAGGAGGGG + Intronic
1146790777 17:35749325-35749347 TGGGGAATGAGAAGCAAGGAGGG + Intronic
1146898560 17:36564744-36564766 TGGGGATGTAGCAGCAGGAGGGG - Intronic
1147517916 17:41139826-41139848 TGAGGAGTGAGCTGAAGGGGAGG + Exonic
1147552469 17:41453861-41453883 AGGAGAATGAGAAGCAGGGGTGG - Intergenic
1147583582 17:41639792-41639814 AGGGGAAAGAGGACCAGGGGAGG + Intergenic
1147668509 17:42163642-42163664 GGGGGAATGAGAAGCTGAGGGGG + Exonic
1147975731 17:44247235-44247257 TGGAGCTTGGGCAGCAGGGGAGG - Intergenic
1148027797 17:44600400-44600422 TGGGGCATCAGCAGCAAGGAGGG - Intergenic
1148677590 17:49454110-49454132 TGGGGACAGAGGATCAGGGGAGG + Intronic
1148698684 17:49575830-49575852 TGGGGAATTAGCACCAAGGACGG + Intergenic
1149169941 17:53797127-53797149 TTAGGAAGGAGCACCAGGGGGGG + Intergenic
1149799964 17:59558050-59558072 TGAGGAAAGACCAGCAGCGGTGG - Intergenic
1149970298 17:61211191-61211213 TGGGGAAAGGGAAGCAGAGGTGG - Intronic
1150893667 17:69184235-69184257 TGGAGAAAGACCAGCAGGTGAGG - Intronic
1151983647 17:77528647-77528669 TGGGGAAGGAGGAGCAGCGCCGG - Intergenic
1152095883 17:78271423-78271445 TGGAGGATGAGCAGGAGGTGGGG + Intergenic
1152278658 17:79372532-79372554 TGGAGAAAGACCCGCAGGGGTGG - Intronic
1152281696 17:79388747-79388769 CGGGGCATGTGCAGGAGGGGTGG - Intronic
1152452261 17:80389149-80389171 TGGGAAATGAAAAGCAGGAGAGG - Intronic
1152552393 17:81036093-81036115 TGGGGAGGGGGCGGCAGGGGAGG - Intronic
1152687303 17:81700911-81700933 AGGGGGAGGAGCAGAAGGGGTGG - Intronic
1152872712 17:82766432-82766454 AGGGGAAGGTGCAGCAGGGTGGG - Intronic
1153087341 18:1303248-1303270 TGGGGGATTAAAAGCAGGGGTGG - Intergenic
1153965923 18:10182045-10182067 TAGGGAAGGACCAGCAGGTGGGG + Intergenic
1154031229 18:10756004-10756026 TGGAGAATGAGGAGGAGGGATGG + Intronic
1154031351 18:10756623-10756645 TGGAGGATGAGGAGGAGGGGTGG + Intronic
1154153837 18:11928450-11928472 TGGTGAGTGAGGAGCAGGAGAGG - Intergenic
1155964091 18:32019591-32019613 TTGGGAAAGGGTAGCAGGGGTGG - Intronic
1156743833 18:40365587-40365609 TGGGGAATGAGGAGCAGATGGGG - Intergenic
1157182838 18:45512583-45512605 TTGGTAATGAGCAGCAGTGCAGG - Intronic
1157531317 18:48423244-48423266 AGGGGAATGAGCAGAGGGCGAGG - Intergenic
1157851512 18:51057002-51057024 TGGGGGATGAGTAGGAAGGGAGG + Intronic
1158516918 18:58138384-58138406 TGAGGAAAGAGGAGGAGGGGAGG - Intronic
1158951510 18:62499564-62499586 GGGGGAAGGAGGAGGAGGGGTGG - Intergenic
1159925817 18:74268341-74268363 TGGGGAAGGTGTTGCAGGGGCGG + Intronic
1160345206 18:78127041-78127063 TGGGAAAGGAGCAGGAGGGCTGG + Intergenic
1160602612 18:80025462-80025484 CGGGGAATCAGCAGCAGCTGGGG - Intronic
1160809782 19:1008364-1008386 TGGGGAATGAGCACTGGGGTTGG - Intronic
1160901854 19:1432763-1432785 TGGGGAGCGTCCAGCAGGGGAGG - Intronic
1160923009 19:1529382-1529404 TGAGGTGGGAGCAGCAGGGGTGG - Intronic
1160927663 19:1554628-1554650 TGGGGGATGGGCACCAGGAGGGG - Intergenic
1161140704 19:2646059-2646081 TGGGTAATGGGGAGCAGGTGTGG - Intronic
1161608735 19:5229403-5229425 TGGAGAAAGAGAAGCAGAGGTGG + Intronic
1161973247 19:7595716-7595738 TGTGCACGGAGCAGCAGGGGCGG - Intergenic
1162391024 19:10390301-10390323 TGGGGAATGAGGAGGAGGCTGGG + Intergenic
1162944190 19:14032259-14032281 AGGGAAATGAGCAGCAGGAAGGG - Intronic
1162971685 19:14184377-14184399 TGGGGACAGAGCAGGTGGGGAGG - Intronic
1163003761 19:14384590-14384612 TGGGATATGAGCGGCAGGTGGGG - Intronic
1163076152 19:14893551-14893573 CGGGGAATGAGCAAGAGGCGAGG + Intergenic
1163078156 19:14915012-14915034 AGGGGAATGAGCAAAAGGAGAGG - Intergenic
1163121839 19:15223069-15223091 GGTGGAATGAGCAACTGGGGAGG - Intergenic
1164249713 19:23466210-23466232 TGGGGAAGGAGGAGGAGAGGAGG - Intergenic
1164574854 19:29399926-29399948 AGGGGAAAGAGCAGCAGGAGGGG + Intergenic
1165812001 19:38617480-38617502 TGGGGAGAGAGCTACAGGGGAGG + Intronic
1165943666 19:39428564-39428586 CCGGGAATGTGCAGCTGGGGCGG - Intergenic
1165999816 19:39871248-39871270 TGGGGAAGGAGCATCAGGCTGGG + Intronic
1166382368 19:42361793-42361815 TGGGCAAGGGGCTGCAGGGGTGG + Intronic
1166889093 19:45979402-45979424 TGGGGAAAATGCAGCAGGGGAGG + Intergenic
1167147882 19:47693936-47693958 TGGGGAATGAGAGGCGAGGGAGG + Intronic
1168026055 19:53644399-53644421 TGGGGAATGCTTTGCAGGGGAGG - Intergenic
1168187318 19:54708548-54708570 CTGGGAATGAGGAGCGGGGGAGG + Intergenic
1168682885 19:58328786-58328808 AGGGGAAGGAGGAGCAAGGGTGG - Intronic
1168719484 19:58547056-58547078 TGGGGAAGGGTCAGCGGGGGTGG + Intronic
1202704558 1_KI270713v1_random:13524-13546 TGGAGGAGGAGCAGCAGGGAGGG - Intergenic
924977901 2:194901-194923 TGGGGAAGGACCAGCATGGGTGG - Intergenic
925235043 2:2270750-2270772 TGGGGCAGGAGCACCAGGGCAGG - Intronic
925709192 2:6721441-6721463 AGGGGAATGAGCAGTGGAGGAGG + Intergenic
925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG + Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928846305 2:35677102-35677124 TGGGGAAGGAGCAACACTGGAGG + Intergenic
929242958 2:39671249-39671271 TGGGAAATAAGCAACAGGAGAGG - Intronic
929576523 2:43055976-43055998 TGGGGAATGGGCATCTGGGAGGG + Intergenic
929997630 2:46838760-46838782 CAGGGGATGAGCAGAAGGGGAGG + Intronic
931153145 2:59597457-59597479 AGGGGAAAGAGCAACAGTGGTGG + Intergenic
931766235 2:65459060-65459082 TGGGAAATGAGGAGGAGGGGAGG - Intergenic
932485265 2:72080823-72080845 TGGGCACTGAGGAGCATGGGAGG + Intergenic
932486062 2:72085102-72085124 TGTAGAATGAGAAGCAGGGTGGG + Intergenic
932771784 2:74504496-74504518 TGGGGAATAAGTAGCTGAGGAGG - Intergenic
933220309 2:79680020-79680042 AGGGGGATGAGCAGCAAGAGAGG + Intronic
935172672 2:100622684-100622706 TGGAGCATGAGCAAGAGGGGTGG - Intergenic
935357906 2:102221610-102221632 GTGGGAATGGGCAGGAGGGGAGG - Intronic
935456231 2:103270413-103270435 TGGGGATGGAGCAGGAGGGAAGG - Intergenic
936519196 2:113201228-113201250 TGTGGGAGGAGCAGCTGGGGAGG + Exonic
937066743 2:119023433-119023455 GGGGGCATGAGGAGCAGGAGTGG + Intergenic
937198288 2:120179882-120179904 TGGAGGATGGGCAGCAGTGGAGG + Intergenic
937312213 2:120909331-120909353 TGAGGGAAGGGCAGCAGGGGAGG - Intronic
937521800 2:122721033-122721055 TGGGGAAGGACCATCAGGCGGGG - Intergenic
937989584 2:127654773-127654795 TGGGAAGTGGGCAGCAGTGGCGG - Intronic
938218847 2:129548377-129548399 TAGGAAATGAACAGCAGGGTGGG - Intergenic
940987384 2:160062670-160062692 TGGGGAAGGAGGAGGAGGAGGGG + Intergenic
941627446 2:167845132-167845154 TAGGGAAGGAGCATCAGGTGGGG - Intergenic
941771276 2:169348781-169348803 TTGGGAATCACCAGCAGGGCGGG + Intronic
942657169 2:178226064-178226086 TGGGCCATAAGCAGCAAGGGAGG + Intronic
942675290 2:178420643-178420665 TGGGGAAGAGGAAGCAGGGGTGG + Intergenic
943046422 2:182866747-182866769 TTGGGAAAGAGCAGCCTGGGCGG - Exonic
943129888 2:183841721-183841743 TGGGGAAGCAGAAGCAGGGTGGG + Intergenic
944287790 2:197971519-197971541 TGGCTAAGGAGCGGCAGGGGAGG + Intronic
944950588 2:204744498-204744520 TGTGGAATGAGAAACTGGGGAGG + Intronic
946446609 2:219745565-219745587 TGGGGCTTGAGCAGCAGGAAGGG + Intergenic
947192550 2:227522727-227522749 TGGGGAATAAGAAGGAGGGTAGG + Intronic
947593631 2:231398061-231398083 TGGGGAAGTAGCGGCAGTGGCGG - Exonic
947667836 2:231918440-231918462 TGGGGAAGAAGCATCAGTGGGGG - Intergenic
947934405 2:233991121-233991143 GGAGGAATCAGCAGCCGGGGAGG + Intronic
947976799 2:234373627-234373649 TGGGGAAGGAACAGAATGGGAGG + Intergenic
948028829 2:234800087-234800109 TGGGGAATCAGCAGCCAGGTGGG + Intergenic
948029032 2:234801294-234801316 TGGGGAACCAGCAGCCGGGTGGG + Intergenic
948251929 2:236536243-236536265 TGGGCACTGAGGAGCTGGGGGGG + Intergenic
948575450 2:238946882-238946904 TGGGCACTGAGGAGCATGGGAGG - Intergenic
948805244 2:240451114-240451136 TGGGGAAGGAACAGAAGGGGAGG - Intronic
949047256 2:241877732-241877754 TGGGGAGTGAGGAGCATGGGGGG - Intergenic
1168749355 20:271164-271186 TGGGAAGAGAGCAGGAGGGGAGG + Exonic
1168803798 20:661526-661548 GGGGGAATGAGACGAAGGGGAGG - Intronic
1169072046 20:2738690-2738712 TGGGGCCTGAGGAGAAGGGGAGG - Intronic
1169198089 20:3693974-3693996 AGGAGAAAGTGCAGCAGGGGAGG - Intronic
1170070094 20:12357492-12357514 CTGGAATTGAGCAGCAGGGGTGG + Intergenic
1170191723 20:13651401-13651423 TGGTGAGTGAGTAGCAGAGGCGG + Intergenic
1172427416 20:34864399-34864421 TGGGGAAAGAGTAGTAAGGGTGG + Intronic
1172548275 20:35778974-35778996 TGGGGAAGGAGCAAGAGGAGGGG + Intronic
1172787022 20:37475173-37475195 TGGGGGAAGAGAAGCAGAGGAGG - Intergenic
1172913033 20:38424268-38424290 TGGGTAATGAACAGGTGGGGTGG + Intergenic
1173802411 20:45902606-45902628 TGGGGGATGAGCAGCAGGGGCGG + Intronic
1173859597 20:46274217-46274239 TGGGGATTGGGCAGCATGGAGGG + Intronic
1174104587 20:48153259-48153281 AGGGGAATGTACAGCAGGGAAGG - Intergenic
1174140020 20:48406143-48406165 TGGGGAAGGAGCAGCCTCGGCGG - Intergenic
1175258181 20:57659311-57659333 TGGGGAATGAAGAGCTGGGCTGG - Intronic
1175789171 20:61730987-61731009 AGGGGAAGGAGCAGCTGAGGGGG + Intronic
1176648933 21:9528607-9528629 AGGGTAGTGAGCAGCAGGAGTGG - Intergenic
1178744771 21:35238250-35238272 AAGGGCATGAACAGCAGGGGTGG + Intronic
1178756718 21:35357067-35357089 TGTGGAATGAGTGGCAGGGAGGG + Intronic
1179602595 21:42490117-42490139 TGGGGGATGAGATGGAGGGGAGG - Intronic
1179800433 21:43809244-43809266 TGGGGACTGAGCAGCAGCTCTGG + Intergenic
1180018127 21:45100869-45100891 TGGGGTATGGGCCGCAGGCGTGG + Intronic
1180239425 21:46490375-46490397 TGGTGAATGAGAGGCAGGGCTGG + Intronic
1180626062 22:17194316-17194338 TGGGAAATGAGCAGAGGAGGTGG - Intronic
1180875761 22:19174601-19174623 CCGGGAATGTGCAGCTGGGGAGG - Intergenic
1180961624 22:19764922-19764944 TGGGGAATCAGCTCCAGCGGTGG - Intronic
1181051781 22:20241365-20241387 TGGGCGGTGAGAAGCAGGGGTGG - Intergenic
1181068245 22:20316611-20316633 TGGGAAAGGAGCAGGAGGAGCGG + Intronic
1182482310 22:30617099-30617121 TGGGGAATGAGGGACAGGGGAGG + Intronic
1182482326 22:30617142-30617164 TGGGGAATGAGGGACAGGGGAGG + Intronic
1182779975 22:32859728-32859750 TGGGGAAGAAGCAAGAGGGGTGG - Exonic
1183186400 22:36293899-36293921 TGGGGCAGGAGCAGTGGGGGTGG - Intronic
1183589663 22:38772666-38772688 TGGGGAAGCAGCCGCAGAGGGGG - Intronic
1183596815 22:38817894-38817916 TGGGGCAGGTGCTGCAGGGGTGG + Intergenic
1183631574 22:39036202-39036224 AGGGGCATGAGCAGAAGGGAGGG - Intergenic
1183636109 22:39063800-39063822 AGGGGCATGAGCAGGAGGGAGGG - Intronic
1183758108 22:39789821-39789843 TGGGGAATGAGCAGGCTGGTGGG + Intronic
1184535232 22:45082210-45082232 CGGGGAACCAGCAGCAGGGACGG + Intergenic
1184551023 22:45204172-45204194 CAGGGGCTGAGCAGCAGGGGAGG + Intronic
1184723237 22:46328246-46328268 AGGGCACTGGGCAGCAGGGGAGG + Intronic
1184740497 22:46426129-46426151 TGGGGAGGGCGCAGCCGGGGAGG + Intronic
1184927199 22:47651258-47651280 TGGGGAAGGAGGAGAAGGTGGGG + Intergenic
1184965961 22:47972547-47972569 GGGGGAATGAGAGGAAGGGGTGG + Intergenic
1185044701 22:48523141-48523163 TGTGGCACGAGCGGCAGGGGAGG - Intronic
1185199384 22:49492220-49492242 TGGAGGAAGAGCAGCTGGGGAGG - Intronic
950643740 3:14364909-14364931 GAGGGAATGAGCACCAGTGGGGG - Intergenic
950778684 3:15372798-15372820 TGGGGCGAGGGCAGCAGGGGTGG - Intergenic
951954559 3:28240599-28240621 GGCGGAAGCAGCAGCAGGGGAGG + Intergenic
952810183 3:37395483-37395505 TGGGAAAGCAGCAGCAGGGTTGG + Intronic
953416764 3:42725618-42725640 TGGGAAATGGGGAGGAGGGGAGG + Intronic
953620463 3:44528408-44528430 TGGTGGGTGAGCAGCAGGGATGG - Intergenic
954067495 3:48118464-48118486 GGGGGGCAGAGCAGCAGGGGAGG + Intergenic
954390263 3:50264900-50264922 GGAGGAATGTGCAGGAGGGGAGG + Intergenic
955701080 3:61682810-61682832 TGAGGAATAAACAGCAGTGGCGG + Intronic
955881944 3:63556145-63556167 GGAGGACAGAGCAGCAGGGGAGG + Intronic
956681376 3:71784985-71785007 CGGGGCGTGAGCAGCAGCGGCGG + Exonic
957062733 3:75495320-75495342 TGGAGGATGAACTGCAGGGGAGG + Intergenic
958665373 3:97129728-97129750 TAGGCAAGGAGCAGCAGGGTTGG + Intronic
958816644 3:98923919-98923941 TGGGGCATGAGGAGAAGGGGAGG - Intergenic
959930139 3:111971641-111971663 TTGTGTATGAGAAGCAGGGGTGG - Intronic
960988841 3:123297436-123297458 TGGGGGCTGAGCAGGAGTGGAGG - Intronic
961290665 3:125844097-125844119 TGGAGGATGAACTGCAGGGGAGG - Intergenic
961429732 3:126872809-126872831 CAGGGAAGGAGCAGCAGGGCAGG - Intronic
961812782 3:129531372-129531394 TTGGGCCTCAGCAGCAGGGGAGG + Intronic
962344901 3:134611644-134611666 TGGGGACTGAGCAGCTTGTGTGG - Intronic
962404573 3:135089839-135089861 TAGAGAAGGAGCAGCAGGTGAGG - Intronic
963838414 3:150080132-150080154 TGGGGGATGAGCAGCCGGAAGGG - Intergenic
964851881 3:161104655-161104677 TGGGGAATGTGGAGAACGGGCGG - Intronic
965126857 3:164641681-164641703 TGGGCAATGAGTGGAAGGGGAGG - Intergenic
966876740 3:184326581-184326603 TGGGGCAAGGGCAGCAGCGGAGG + Exonic
966912218 3:184566011-184566033 TCGGGATTGGGCAGCTGGGGGGG + Intronic
966932989 3:184687661-184687683 TGGGGAATGGGGAGGAGGGGAGG + Intergenic
967171402 3:186825797-186825819 AGGGTAAAGAGCAGCAGGGCTGG + Intergenic
967387366 3:188924827-188924849 TGGGGAGTGGGCAGCAGTGGGGG + Intergenic
967788938 3:193526782-193526804 TGGGGAGAGAGCAGCAGAGATGG + Intronic
968494291 4:906914-906936 TGGGAGGTGAGCAGAAGGGGCGG - Intronic
968660868 4:1798222-1798244 TGGGGGCTGAGAAGCTGGGGTGG - Intronic
968775311 4:2536605-2536627 GGGGGAAGGAGCAGCGGGGAGGG - Intronic
969347117 4:6576447-6576469 TGGGGGGTGAGCAGCAGGGAAGG + Intronic
969430851 4:7153483-7153505 TGGGGAAGGAGGAGCAAGGGAGG - Intergenic
969505573 4:7585176-7585198 TGGGGAATGGGCAGGATGGTCGG + Intronic
969680028 4:8637746-8637768 TGGGGTATGAGCAGAAGTGATGG - Intergenic
969696873 4:8740002-8740024 TGGGGCATGGGCAACACGGGTGG + Intergenic
970350515 4:15197268-15197290 TGGGAGATGGGCAGCTGGGGAGG + Intergenic
971362471 4:25950715-25950737 TGGGAAATCAGCAGCAGGGATGG - Intergenic
974229265 4:59088920-59088942 AGGGGAAGGAGGAGGAGGGGAGG - Intergenic
977795459 4:101159370-101159392 TAGGGAATGAGGGGCTGGGGAGG - Intronic
978900379 4:113942240-113942262 TGGGAAATGAGAAGTAGGAGTGG - Intronic
979209044 4:118077755-118077777 TTGGCGATGAGCAGCAGGAGTGG + Intronic
979251940 4:118574839-118574861 AGGGGAAAGAGCAGCAGGAGGGG - Intergenic
980114101 4:128662868-128662890 TTGAGAAGGAGCAGCAGGAGGGG - Intergenic
983389970 4:167117642-167117664 TGGGGGCAGAGCAGCAGGGTGGG + Intronic
984968532 4:185164973-185164995 TGGGGAAAGGCCAGCAGGGAGGG + Intronic
985988695 5:3538137-3538159 TGGGGCATGGGCTGCAGGGGAGG - Intergenic
986170494 5:5310718-5310740 TAAGGTATGAGCAGCAGAGGTGG - Intronic
986536519 5:8793729-8793751 TGGAGGATGAGCTGGAGGGGTGG - Intergenic
988529309 5:32013785-32013807 TGGGGGTGGAGCAGAAGGGGAGG - Intronic
990272752 5:54162165-54162187 TGGCGAATAGGCAGCAGAGGAGG - Intronic
990314495 5:54571255-54571277 GGGGAAAGGAGCAGCAGGCGAGG + Intergenic
990322915 5:54647561-54647583 TGGGGCATGAGAGGAAGGGGAGG + Intergenic
990563224 5:57004264-57004286 TAGGGAATGTGAAGCAAGGGAGG + Intergenic
991062323 5:62390576-62390598 TGGGGAAGGAGCAGGAAGGGAGG + Intronic
991977610 5:72198547-72198569 AGGGGTATGAGCAGAAGAGGTGG - Exonic
992378633 5:76215632-76215654 AGAGGACAGAGCAGCAGGGGCGG - Intronic
997008706 5:129850760-129850782 TGGGGACAGAGTAGCAGGAGAGG - Intergenic
997213835 5:132094542-132094564 TGGGGAATGCTCAGAAGGGGAGG - Intergenic
997379058 5:133422182-133422204 TGGGGACAGAGCAGCAGGGCTGG + Intronic
997854841 5:137364044-137364066 GGGGAAATGAGCAGCAGGGCTGG - Intronic
998148571 5:139744468-139744490 GGGGGAATGAGGGGCATGGGGGG - Intergenic
998520117 5:142792725-142792747 TGTGGAATGAGCAGCGTTGGAGG + Intronic
998874335 5:146584090-146584112 TGGGGAATGAGCAGCAGGGGCGG + Intronic
999798671 5:155012003-155012025 GGGGGAATGGGGGGCAGGGGAGG - Intergenic
999931543 5:156438385-156438407 TGGGCAATTTGCAGCAAGGGAGG + Intronic
1002305844 5:178282367-178282389 TGGGAAGGGAGCAGCAGGGCTGG + Intronic
1002866714 6:1128187-1128209 TGGGGTAGGAGGAGCAGGGAGGG + Intergenic
1003063157 6:2877768-2877790 TAGGGAAGGACCAGCAGGTGGGG - Intergenic
1004064255 6:12227488-12227510 TGGGGGATGAGGGGCAGGGAAGG + Intergenic
1004070919 6:12296708-12296730 GGAGGAAGGGGCAGCAGGGGTGG - Exonic
1004370942 6:15051559-15051581 TGGTGCATCAGCAGGAGGGGAGG - Intergenic
1004722249 6:18277629-18277651 AAGGGAAGGAGCAGAAGGGGAGG - Intergenic
1005711415 6:28506437-28506459 TGGACAATGAATAGCAGGGGTGG + Intronic
1005840830 6:29743749-29743771 TGAGGAGTGGGCAGCAGGGAGGG - Intergenic
1005850173 6:29814968-29814990 TGAGGAGTGGGCAGCAGGGAGGG - Intergenic
1005856398 6:29866397-29866419 TGCGGGAGGAGGAGCAGGGGTGG - Intergenic
1005862232 6:29910727-29910749 TGAGGGAGGAGGAGCAGGGGTGG - Intergenic
1006060041 6:31412685-31412707 TGAGGAGTGGGCAGCAGGGAGGG + Intronic
1006072535 6:31507769-31507791 TGAGGAGTGGGCAGCAGGGAGGG + Intronic
1006437798 6:34035267-34035289 TGGGGTAAGGGCAGCAGGGATGG + Intronic
1006840589 6:37025863-37025885 TGAGGAATGCGTAGCAGTGGAGG - Exonic
1007066607 6:38997084-38997106 TGGGGAAAGGGGATCAGGGGTGG - Intronic
1007405678 6:41634834-41634856 TGCGGAATGAACTGCAAGGGAGG + Intergenic
1007730075 6:43940265-43940287 TGGGGAAGGGGAAGCTGGGGTGG + Intergenic
1010414891 6:75601865-75601887 TGGGGGAGGAGCGGCAGCGGCGG + Intronic
1013179938 6:107709031-107709053 TGGGGCTGGGGCAGCAGGGGTGG - Intronic
1013913751 6:115310126-115310148 TAGGGAATGACCATCAGGTGGGG + Intergenic
1016386648 6:143536697-143536719 TGGGGGAGGAGCAGCCGGGCAGG + Intergenic
1017215408 6:151901045-151901067 TAGGGAATGACCATCAGGTGGGG + Intronic
1017352845 6:153463400-153463422 TGGGGGAAGAGGGGCAGGGGAGG + Intergenic
1017488829 6:154926384-154926406 TGGGGAAGAAGCATCAGTGGTGG + Intronic
1017502464 6:155038297-155038319 GGGGGAAGGAGCAGGAGGGCAGG - Intronic
1018031690 6:159846281-159846303 TCGGGACTGAGCTGCAGGGTGGG - Intergenic
1018899471 6:168043963-168043985 TGGGCCGTGAGCAGCAGGTGTGG + Intronic
1019049930 6:169175037-169175059 GGCGGAAGGAGCAGCAGGGCAGG - Intergenic
1019129624 6:169864308-169864330 GGGGGAAGGAGCACCAGGGAGGG - Intergenic
1019474730 7:1238642-1238664 GGGGGAAGGAAGAGCAGGGGAGG + Intergenic
1019521310 7:1461682-1461704 TGGAGGATGAGGAGGAGGGGCGG - Intergenic
1019819795 7:3234086-3234108 GGGGGAGGGAGCGGCAGGGGTGG + Intergenic
1021194770 7:17663030-17663052 TTGGGACTGAGCAGCCGGGTGGG - Intergenic
1022104189 7:27186469-27186491 TGTGGAATGAGCAGTAGGAAAGG - Intergenic
1022794696 7:33722679-33722701 TGGGGATTGAGCTGCAGGCGAGG - Intergenic
1023295544 7:38711591-38711613 GGGGCAATGAGCAGGAAGGGAGG - Intergenic
1024523801 7:50330870-50330892 TGCAGGGTGAGCAGCAGGGGCGG + Intronic
1024966324 7:55025220-55025242 TGGGGAATGGACTGCAGGAGTGG + Intronic
1026569364 7:71515867-71515889 AGGGGAAAGAGCGGCAGGGTGGG + Intronic
1026944189 7:74305866-74305888 TGGTGAACTGGCAGCAGGGGCGG - Intronic
1032532970 7:132637168-132637190 TGGGGGATGAGGAATAGGGGAGG - Intronic
1032655966 7:133929833-133929855 TGAGGAATGAGCAGGGGAGGGGG - Intronic
1032797319 7:135288383-135288405 TGGGGAATGGGCAGCCTGGAGGG + Intergenic
1032846409 7:135755375-135755397 TGGGGACTGAGCCAGAGGGGAGG - Intergenic
1033015659 7:137668731-137668753 TGGTGAAGGAGCAAGAGGGGAGG + Intronic
1033138483 7:138804161-138804183 TGGGGAGTGATGAGCCGGGGAGG - Exonic
1033589550 7:142797805-142797827 TGGGGAATGGGTAGGAGTGGGGG + Intergenic
1034115171 7:148577810-148577832 TGGGGGGTGAGGAGCATGGGAGG + Intergenic
1034263589 7:149771665-149771687 CAGGGAAGGGGCAGCAGGGGCGG - Intronic
1034423504 7:151001289-151001311 TGGAGAATGAGCAGAAGGCCAGG + Exonic
1034468346 7:151242845-151242867 TGGAGAAGGAGGAGCAGGGCAGG + Intronic
1034670397 7:152853324-152853346 GGGGGATTTGGCAGCAGGGGCGG + Intronic
1034716640 7:153249259-153249281 TGGAGAAAGAGCAGCAGTTGAGG + Intergenic
1034900685 7:154906310-154906332 GGAGGAAGGAGCAGCTGGGGCGG + Intergenic
1035746718 8:1966341-1966363 TGGGGGAGGGGCAGCCGGGGAGG + Intergenic
1037046330 8:14309039-14309061 TGGGGAATTAAGAGTAGGGGAGG - Intronic
1037259315 8:16989528-16989550 TGGGGGATGGGGGGCAGGGGAGG + Intergenic
1039438469 8:37578172-37578194 TGGGGAATGAGCAGAAAATGTGG - Intergenic
1039888243 8:41667677-41667699 TGGGAAATCAGGAGCAGGAGAGG + Intronic
1039917761 8:41872389-41872411 TGAGGAAAGAGCAGCACTGGGGG - Intronic
1041292267 8:56319241-56319263 TGGGGATTGAGGAGCAGAGGGGG - Intronic
1041961444 8:63621681-63621703 TGGGTATTGAGCAGCAGGGAAGG + Intergenic
1042150754 8:65781125-65781147 TGGCGAGAGAGGAGCAGGGGAGG + Intronic
1042374600 8:68035554-68035576 TGGGAAATCAGCAGCATGGTGGG + Intronic
1044780021 8:95734459-95734481 TGGTGGATGAGGAGCAGGGATGG + Intergenic
1045074203 8:98544533-98544555 TGTGAAATGAGAAGCAGGGATGG + Intronic
1046395604 8:113634125-113634147 TGTGGCAGGAGCAGCAGTGGCGG - Intergenic
1047035803 8:120937429-120937451 TGGGGATTGGGGGGCAGGGGTGG + Intergenic
1047816828 8:128473808-128473830 TGGGGAACGGGCAGCAATGGTGG - Intergenic
1047880369 8:129186255-129186277 GGGGTGATGAGCAGCAAGGGTGG - Intergenic
1048589275 8:135806072-135806094 TTGGGAAACAACAGCAGGGGAGG + Intergenic
1048971157 8:139645616-139645638 TGGGGCATGGGCAGGAGGGAGGG - Intronic
1049165528 8:141123355-141123377 TGGTGAGTGAGGAGCAGGTGAGG - Intronic
1049532119 8:143159997-143160019 ACAGGAATGAGCGGCAGGGGCGG + Intronic
1049794139 8:144488852-144488874 TGGGGACAGAGCCCCAGGGGAGG + Intronic
1051078820 9:13272801-13272823 TGGGGAGTGAGAAGCCGAGGAGG + Intronic
1051183756 9:14438107-14438129 GGGGGACTGAGAAGCAGGGAGGG + Intergenic
1051883785 9:21868749-21868771 TTGGGAGAGAGCAGCAGAGGGGG - Intronic
1052599407 9:30605284-30605306 TGGAGACTGAGAAGCAGGGAGGG - Intergenic
1053004727 9:34596909-34596931 TGTGGAAAGAGAAGCAGGTGGGG + Intergenic
1053914069 9:42931910-42931932 TGGGGATTGGGGAGCATGGGTGG + Intergenic
1054455903 9:65430296-65430318 TGGGGAATGGTCTGCAGGGCAGG - Intergenic
1054777586 9:69136876-69136898 TTGGGAAAGAGCAGGAGGAGAGG + Intronic
1055132265 9:72789445-72789467 TGGAAAATGAGCAACAGGGTTGG - Intronic
1055731131 9:79280179-79280201 GGGGGCTTGAGCAGCAGTGGTGG + Intergenic
1057266350 9:93620346-93620368 TGGGGCAGGGGCAGCAGGTGAGG + Intronic
1057339815 9:94190061-94190083 TGGAAAATGAGAAGCAGGAGGGG - Intergenic
1057666408 9:97048866-97048888 TGGGGTAGGAGCAGCAGAAGAGG - Intergenic
1057842845 9:98500369-98500391 TGGGTAATGATGGGCAGGGGAGG + Intronic
1059061584 9:111038851-111038873 TGGGGTAAGCGCAGGAGGGGCGG - Intergenic
1059959322 9:119549952-119549974 TGAGGAGGGAGAAGCAGGGGAGG + Intergenic
1060421517 9:123472759-123472781 TGGGGAATGAGGAGCCGCGGTGG - Intronic
1060480707 9:124015448-124015470 TGGGCACTGTGCAGAAGGGGCGG + Exonic
1060618782 9:125044173-125044195 TGGGTAATGACGAGCATGGGAGG + Intronic
1060723108 9:125991068-125991090 GGGGGAGGGAGCTGCAGGGGTGG - Intergenic
1060825952 9:126688313-126688335 TGGGGAAGGGGCAGCAGGGCGGG - Intronic
1061251440 9:129428713-129428735 TGGGGAAGGTGCAGCAGCTGAGG + Intergenic
1061895351 9:133644114-133644136 TGGGGCCTGAGCCTCAGGGGTGG - Intronic
1062033592 9:134372895-134372917 TGGTGAAGGGGCAGCAGGAGAGG + Intronic
1062368064 9:136221361-136221383 TGCAGAATGAGAAGTAGGGGTGG - Intronic
1203780848 EBV:100090-100112 TGGTAAATGTGCAGAAGGGGAGG + Intergenic
1203626669 Un_KI270750v1:32156-32178 AGGGTAGTGAGCAGCAGGAGTGG - Intergenic
1186670938 X:11766670-11766692 TAGGAAGTCAGCAGCAGGGGAGG + Intronic
1186890661 X:13956223-13956245 TGGTTACTGAGCAGCTGGGGCGG + Intergenic
1187748396 X:22433732-22433754 TAGGGAAGGAGCATCAGGTGGGG - Intergenic
1188466575 X:30488364-30488386 TGGGAAATGAGCAGTAGCAGTGG - Intergenic
1189218178 X:39345093-39345115 TAGGGAAGGAGCATCAGGTGGGG - Intergenic
1189350199 X:40270180-40270202 TGGGACAGGAGAAGCAGGGGTGG + Intergenic
1189401078 X:40669344-40669366 TGGGGAAGTAGCAGCTAGGGAGG - Intronic
1189704246 X:43743884-43743906 TGGAGAACGAGCAGCTAGGGAGG + Exonic
1190463367 X:50701095-50701117 TGGTGATTAAGCAGCTGGGGAGG - Intronic
1190936485 X:55002899-55002921 TGGGGAAGGGACAGAAGGGGAGG + Intronic
1192192475 X:68999887-68999909 TGGGGAAGAATCAGCAGGAGGGG - Intergenic
1192432460 X:71121704-71121726 TGGGGGCTGAGGAGCAGGGGTGG - Exonic
1192906169 X:75553500-75553522 TGGGGGGTGGGCAGCAGGCGTGG - Intergenic
1193099839 X:77597049-77597071 TGGGGCAGCAGCAGCAGGGAAGG + Intronic
1193823507 X:86195048-86195070 TGGGGAAGGAGCAGGAGGACTGG - Intronic
1193970046 X:88039616-88039638 TGGGGCAGCAGCAGCAGTGGTGG - Intergenic
1194018090 X:88651538-88651560 TGGGGAACCAGAAGCAGGGTAGG + Intergenic
1194114036 X:89873722-89873744 TGGCGTAGGGGCAGCAGGGGTGG + Intergenic
1194423766 X:93710632-93710654 TGGGGAAAGAGCATGTGGGGTGG + Exonic
1195938137 X:110144706-110144728 TGGGTCCTGAACAGCAGGGGAGG + Intronic
1196950912 X:120875153-120875175 TGGGACAGCAGCAGCAGGGGAGG + Exonic
1197160157 X:123313877-123313899 TGGAGAAGGGGCAGCAGGGTGGG + Intronic
1199666206 X:150098384-150098406 AGGGGAAAGGACAGCAGGGGTGG + Intergenic
1199851777 X:151729044-151729066 TGGGGACAGAGGAGCTGGGGCGG + Intergenic
1200034772 X:153320149-153320171 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200034775 X:153320167-153320189 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200034778 X:153320185-153320207 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045363 X:153398030-153398052 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045370 X:153398066-153398088 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045373 X:153398084-153398106 TGAGGGAAGAGCAGCAGGTGAGG - Intergenic
1200045380 X:153398120-153398142 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045387 X:153398156-153398178 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045398 X:153398210-153398232 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045409 X:153398264-153398286 TGAGGGAGGAGCAGCAGGTGAGG - Intergenic
1200045413 X:153398282-153398304 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045420 X:153398318-153398340 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045431 X:153398372-153398394 TGAGGCAGGAGCAGCAGGTGAGG - Intergenic
1200045441 X:153398426-153398448 TGAGGTAGGAGCAGCAGGTGAGG - Intergenic
1200097790 X:153672294-153672316 TAGGGAATGGGGAGCAGAGGTGG - Intronic
1200228501 X:154432422-154432444 AGGCGAATGAGCAGCAGAGCAGG - Exonic
1200232547 X:154451246-154451268 TGGGGAATCAGCTGCTGAGGTGG - Intergenic
1200242909 X:154507112-154507134 TGGGGCGTGAGCAGCTGGGGAGG + Intronic
1200424985 Y:3010083-3010105 TGGGGACGCTGCAGCAGGGGAGG - Intergenic
1200456082 Y:3395153-3395175 TGGGGACTGAGCGGAAAGGGTGG - Intergenic
1200951621 Y:8903802-8903824 TGGGGAAAGGGCAGCGGCGGTGG - Intergenic
1201266839 Y:12215079-12215101 TGGGGAAAGAGCAGGAAGTGTGG - Intergenic
1202162295 Y:21948042-21948064 TGGCCAAAGAGAAGCAGGGGTGG + Intergenic
1202229061 Y:22638331-22638353 TGGCCAAAGAGAAGCAGGGGTGG - Intergenic
1202314093 Y:23557834-23557856 TGGCCAAAGAGAAGCAGGGGTGG + Intergenic
1202556709 Y:26112761-26112783 TGGCCAAAGAGAAGCAGGGGTGG - Intergenic