ID: 998877771

View in Genome Browser
Species Human (GRCh38)
Location 5:146618039-146618061
Sequence GTGTAGACATATTTGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998877771_998877785 24 Left 998877771 5:146618039-146618061 CCCATCCCCAAATATGTCTACAC 0: 1
1: 0
2: 2
3: 35
4: 243
Right 998877785 5:146618086-146618108 CGTTATGTTACATGACAAGGGGG 0: 1
1: 2
2: 15
3: 39
4: 235
998877771_998877783 22 Left 998877771 5:146618039-146618061 CCCATCCCCAAATATGTCTACAC 0: 1
1: 0
2: 2
3: 35
4: 243
Right 998877783 5:146618084-146618106 CACGTTATGTTACATGACAAGGG 0: 1
1: 0
2: 17
3: 105
4: 366
998877771_998877784 23 Left 998877771 5:146618039-146618061 CCCATCCCCAAATATGTCTACAC 0: 1
1: 0
2: 2
3: 35
4: 243
Right 998877784 5:146618085-146618107 ACGTTATGTTACATGACAAGGGG 0: 1
1: 2
2: 19
3: 90
4: 379
998877771_998877782 21 Left 998877771 5:146618039-146618061 CCCATCCCCAAATATGTCTACAC 0: 1
1: 0
2: 2
3: 35
4: 243
Right 998877782 5:146618083-146618105 CCACGTTATGTTACATGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998877771 Original CRISPR GTGTAGACATATTTGGGGAT GGG (reversed) Intronic
901991804 1:13121225-13121247 GTGTAGATATAGTTATGGATAGG - Intergenic
902753452 1:18533513-18533535 TTGTTGTCATATTTGGAGATGGG + Intergenic
906362929 1:45179733-45179755 GTGTGGACATATTTGGTGAGGGG - Intronic
907455215 1:54571347-54571369 GTGTAGGAAAATATGGGGATGGG + Intronic
907804666 1:57806289-57806311 ATGTGATCATATTTGGGGATAGG + Intronic
909307019 1:74094203-74094225 GTGTGGCTATATTTGGAGATGGG - Intronic
910901895 1:92130262-92130284 GTGTGGTCATATTTAGAGATGGG - Intronic
911372872 1:97015029-97015051 GTGTGGCCACATTTGGAGATGGG - Intergenic
912013538 1:105003417-105003439 TTCTAGACATCTTTGGAGATAGG + Intergenic
913293207 1:117294401-117294423 GTGTTAACATATTTGGGAAAAGG + Intergenic
914351183 1:146841896-146841918 TAGTTGACATTTTTGGGGATTGG + Intergenic
916262322 1:162854834-162854856 TTGGAGAGATATTTGGGCATGGG - Exonic
916876704 1:168977465-168977487 GTGTGGACATCTTTGGGAAGGGG - Intergenic
918994202 1:191735128-191735150 ATGTCCACAAATTTGGGGATAGG + Intergenic
919837658 1:201586791-201586813 GTGTGGTTATATTTGGAGATAGG - Intergenic
923729434 1:236536393-236536415 GTGTAGTCATCTCTGGGGAAGGG + Intronic
924169978 1:241328806-241328828 CTGTAGATTTATTTGGGGGTAGG - Intronic
924665470 1:246067242-246067264 ATGTAGACAAATTTGGAAATAGG - Intronic
1064604422 10:17023987-17024009 GAGTTGAGATATTTGGGGGTAGG - Intronic
1064647399 10:17473604-17473626 GTGAAGACATGTTTGGGAAATGG - Intergenic
1064874768 10:19980807-19980829 GTTTGGCTATATTTGGGGATGGG - Intronic
1065098845 10:22313085-22313107 GTTTAGAAATAATTAGGGATTGG + Intergenic
1070545533 10:77449481-77449503 GAGTAGACATCTTTGGAGAGAGG + Intronic
1072150394 10:92678394-92678416 GTGTAGACATAGTGGTGGAGAGG - Intergenic
1072297596 10:94026301-94026323 ATCTTGAGATATTTGGGGATAGG - Intronic
1073594880 10:104789749-104789771 GTGTAGCTGTATGTGGGGATGGG + Intronic
1074093420 10:110285338-110285360 GAGTAGACACATTTAAGGATGGG + Exonic
1074269679 10:111941663-111941685 GGGTAAACACATTTGGGGACTGG - Intergenic
1075199074 10:120387214-120387236 TTGTAGACATCTATGGGGAGAGG + Intergenic
1075482278 10:122792137-122792159 GTGTAGACACAGTTGTGGTTTGG - Intergenic
1075916429 10:126171645-126171667 GTGAAGTCATGTTTTGGGATGGG - Intronic
1081401523 11:42648647-42648669 GTGTAGACATAGTTTCAGATGGG - Intergenic
1089575826 11:119442285-119442307 GTATAGCTATATTTGGAGATGGG - Intergenic
1090158589 11:124467532-124467554 GTGTGGTGAGATTTGGGGATGGG + Intergenic
1092013880 12:5140236-5140258 GTGTAAACACTTTTGGGGGTGGG + Intergenic
1092255573 12:6925252-6925274 ATTTAGGCATATGTGGGGATAGG - Intronic
1095505551 12:42893953-42893975 GTGTAGACAGACTTGGGTCTGGG + Intergenic
1095525943 12:43125695-43125717 GAGTACACATATTTGGAGTTAGG - Intergenic
1099902888 12:88734556-88734578 GTGTAGAGATAAATGGGGGTGGG - Intergenic
1101299123 12:103459629-103459651 GTGAAGAAATATTTGAGGCTGGG - Intronic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1103525793 12:121567316-121567338 ATGTAGCCATATTTGGAGATAGG + Intronic
1105606069 13:21927452-21927474 GTGTGGCCTTATTTGGAGATAGG + Intergenic
1106873195 13:34043909-34043931 ATATAGACATCTTGGGGGATGGG - Intergenic
1107018739 13:35730557-35730579 GTGTGGATATATTTGGAGATTGG + Intergenic
1108204629 13:48075173-48075195 ATTTAGACATCTTTGGGGAAAGG - Intronic
1109248535 13:59988254-59988276 TGGCAGAAATATTTGGGGATGGG - Intronic
1110044049 13:70806708-70806730 GTGTAGTTATATTTGGAGATGGG + Intergenic
1113647469 13:112009113-112009135 GTGTGGACTTGTTTGGAGATAGG + Intergenic
1114548757 14:23521576-23521598 GTGTATGCATTTATGGGGATGGG + Exonic
1115156860 14:30350747-30350769 GTGGACACAAATATGGGGATGGG + Intergenic
1115565689 14:34623315-34623337 GTGTAGACGTACTTGGGCAATGG + Intronic
1115892408 14:38046115-38046137 GTGTACACTAATGTGGGGATCGG + Intergenic
1116849949 14:49898680-49898702 ATGTACACATATTAGGGAATAGG + Intergenic
1116990229 14:51268253-51268275 GCTTAGACAAATTTGTGGATAGG + Intergenic
1117799376 14:59427578-59427600 GTCTATAATTATTTGGGGATGGG + Intergenic
1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119877409 14:78072688-78072710 GTGTAGCTGTATTTGGAGATGGG - Intergenic
1120613976 14:86678627-86678649 ATGTATACATATATGTGGATAGG - Intergenic
1121852370 14:97233367-97233389 GTCTAGAAATATTTTGGGAGCGG + Intergenic
1124598988 15:31115883-31115905 GTGTAGGCAGATTTGGGGCCTGG + Intronic
1125334980 15:38618154-38618176 GTGTAGACAGATGTTGGGACGGG - Intergenic
1126174098 15:45719550-45719572 TTGTGGACATATTTTTGGATTGG - Intergenic
1126633540 15:50760645-50760667 GTGTATTGATATTTGGAGATGGG - Intronic
1126865808 15:52935482-52935504 ATATAGTCATATTTGGGGTTAGG + Intergenic
1128458723 15:67849927-67849949 GTGTGACCATATTTGGAGATTGG + Intergenic
1129947382 15:79550991-79551013 GTGTAACTGTATTTGGGGATAGG - Intergenic
1130117503 15:81018070-81018092 GTGTTCAAATATCTGGGGATAGG - Intronic
1131044535 15:89302994-89303016 GTGTTTACTTATTTGGGGAGAGG - Intronic
1134749577 16:16615260-16615282 ATGTGGACATATTTGGGGAGGGG + Intergenic
1134995893 16:18738364-18738386 ATGTGGACATATTTGGGGAGGGG - Intergenic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1135246125 16:20858573-20858595 ATATATACATATTTGGGGGTAGG + Exonic
1135501102 16:22996540-22996562 GTGTAAACTTATTTGGAAATAGG - Intergenic
1136740145 16:32512608-32512630 GTGAAGAGATATTTGGGGGAGGG - Intergenic
1139092836 16:63669516-63669538 GTGTGGACATCTTTGGAGAAAGG + Intergenic
1139405256 16:66712803-66712825 GGGTATACTTATTTGGAGATGGG - Intergenic
1139429293 16:66902548-66902570 GTGTACACATGTATGGGGATGGG + Intergenic
1139665621 16:68453484-68453506 GTGTAGACAACTGTGGGGAATGG + Intergenic
1139982853 16:70873650-70873672 TAGTTGACATTTTTGGGGATTGG - Intronic
1140093344 16:71854808-71854830 GTGTATACCAATTTGGGAATAGG + Exonic
1203012763 16_KI270728v1_random:314729-314751 GTGAAGAGATATTTGGGGGAGGG + Intergenic
1203031098 16_KI270728v1_random:587888-587910 GTGAAGAGATATTTGGGGGAGGG + Intergenic
1203040623 16_KI270728v1_random:746543-746565 GTGAAGAGATATTTGGGGGAGGG - Intergenic
1143074008 17:4324191-4324213 GTGTAAACATTTTGGGGGAGGGG - Intronic
1144044001 17:11438661-11438683 GTGTAACTATATTTGGAGATAGG - Intronic
1144769946 17:17753996-17754018 GGGGAGACCTATTTGGGGAAAGG + Intronic
1145121461 17:20264038-20264060 GTCTAGACATATTTTGTGAAGGG - Intronic
1146051267 17:29555470-29555492 GTGTGTACATATATGGGGGTGGG + Intergenic
1146918852 17:36696351-36696373 CTGTATAAATATGTGGGGATTGG - Intergenic
1147700727 17:42392721-42392743 GTGTAGACATGTTTGGAGGAAGG - Intergenic
1147837646 17:43346307-43346329 ATATATACATATTTGGGGGTAGG - Intergenic
1148466184 17:47866565-47866587 ATGTAGAAATGTTTGGGGATTGG + Intergenic
1148506777 17:48133574-48133596 GTGTGGACACATTTAGAGATGGG + Exonic
1149949616 17:60971831-60971853 TTCTAGACCTACTTGGGGATGGG - Intronic
1150032575 17:61754912-61754934 GTGTGGTTATATTTGGAGATGGG - Intronic
1150676186 17:67246750-67246772 GTGTAGACACATTAAGGGATTGG + Intergenic
1151130155 17:71888736-71888758 GTGTGGCGATATTTGGAGATAGG - Intergenic
1151549775 17:74815471-74815493 GTGCAGAGAAATTTGGGGATGGG + Intronic
1151883373 17:76908617-76908639 GTGTACATATTTATGGGGATGGG + Intronic
1156657633 18:39307885-39307907 TTGTAGACATAATGGGGGACAGG + Intergenic
1156834013 18:41530703-41530725 TTGTAACCATATTTGGAGATAGG + Intergenic
1157156431 18:45271255-45271277 GTGTAGACATCTTAGTGGCTGGG + Intronic
1157291579 18:46413329-46413351 ATGCAGATAGATTTGGGGATGGG - Intronic
1158850757 18:61493903-61493925 GTGTAGACAAAGTTGGTGAGTGG - Intronic
1159184936 18:64957555-64957577 GTTTAGACTTCTTTGGGGGTAGG - Intergenic
1159491960 18:69148179-69148201 ATGTAGACATCTTTGGGAGTGGG + Intergenic
1162540550 19:11293415-11293437 GTGTACATATTTATGGGGATGGG - Intergenic
1163599399 19:18239616-18239638 GTGAAGACAAATGTGGAGATGGG + Intronic
1163766747 19:19167569-19167591 GTGTAGACATGTTGGGTGTTTGG - Intronic
925829849 2:7883279-7883301 GTGTGACCATATTTGGAGATAGG + Intergenic
928366062 2:30704178-30704200 GTGTAAAAATAATTGGGGAGAGG - Intergenic
928366995 2:30710459-30710481 CTGTAGACATATTTTTGGACAGG - Intergenic
928923290 2:36548962-36548984 CTGTAGAGATATTTGGGGTGGGG + Exonic
929602261 2:43211744-43211766 GTGTATAAATATTTGTAGATAGG + Intergenic
931138670 2:59433137-59433159 GTGTAATTATATTTGGAGATGGG - Intergenic
932398798 2:71465913-71465935 GTGTAGAGATTGTTGGGGATGGG + Intronic
932636305 2:73391230-73391252 CTGTAGATAAATTTGGAGATGGG - Intronic
932718556 2:74121344-74121366 GTGAAGACATATGTAGCGATTGG + Intergenic
933807931 2:86013493-86013515 GTGTGGATGTATTTGGAGATGGG + Intergenic
937648741 2:124296766-124296788 GTGTATACATTTATGGGGAGAGG - Intronic
939072577 2:137560827-137560849 GAGTACACATGTTTGGGGCTGGG - Intronic
939733722 2:145817498-145817520 GTGTAGTTTTATTTGGGGATGGG + Intergenic
940057605 2:149529303-149529325 GTGTAGGGATATGTGGGGAAAGG - Intergenic
941250179 2:163151714-163151736 GTCTAGACATATTTAGGTTTAGG - Intergenic
942974680 2:182001228-182001250 GTGTAGACATGCTTTGAGATAGG + Intronic
943657723 2:190527360-190527382 GTGAAGACAGACTTGGGGAAAGG + Intronic
944335468 2:198528574-198528596 GTCTAGAAATAGATGGGGATGGG - Intronic
945226623 2:207537350-207537372 GTCTTTACATATTTGGGGATGGG + Intronic
946545468 2:220737292-220737314 GTGGAGAAATATTTGGGGGCAGG - Intergenic
947338620 2:229113620-229113642 GTGTATACATATTTACAGATGGG + Intronic
948305318 2:236942522-236942544 TTGTAGAACTATTTGGGTATTGG + Intergenic
948396129 2:237646578-237646600 GTGTAGCTGTATTTGGAGATGGG + Intronic
1169576361 20:6966338-6966360 GTGTAAACTTATTTGGAAATAGG + Intergenic
1170143056 20:13144161-13144183 GTGGACACAAGTTTGGGGATGGG - Intronic
1170713503 20:18812695-18812717 GTGTAGCCAGATTTGAGGAGAGG - Intronic
1172946520 20:38693545-38693567 TTGGGGACATATTTTGGGATGGG + Intergenic
1173038187 20:39433139-39433161 GTGTAACTATATTTGGAGATAGG + Intergenic
1173534100 20:43795607-43795629 TTGATGACAGATTTGGGGATGGG + Intergenic
1175384104 20:58583240-58583262 GTGTAGAAATGTTTGGGAAGGGG + Intergenic
1177162974 21:17568789-17568811 TAGTAGACATTTTTGGGGGTGGG - Exonic
1179562151 21:42222398-42222420 CTGTTGGCTTATTTGGGGATGGG + Intronic
1181532528 22:23525035-23525057 GCGTGGACATATTGGGGGAGGGG - Intergenic
1182684065 22:32107205-32107227 GTGGAGACATTTTTGGAGGTAGG - Intronic
1183550888 22:38484135-38484157 GCTTAGACAAATTTGGGGTTGGG + Exonic
1184312580 22:43657295-43657317 GTATAGTCATTTTGGGGGATGGG - Intronic
950472212 3:13193334-13193356 CTGAATACATATTTGGGGGTGGG + Intergenic
951006551 3:17622364-17622386 ATGCAGACATTTTTGAGGATTGG - Intronic
951126594 3:18991961-18991983 GTGTGTACATATCTGGGGATTGG - Intergenic
952104807 3:30056659-30056681 TTGTGGTTATATTTGGGGATAGG - Intergenic
952135588 3:30415651-30415673 ATATAGTCATATTTGGGGTTGGG - Intergenic
952983800 3:38759647-38759669 ATGTAGACATTTTTTGGAATAGG + Intronic
953371489 3:42392282-42392304 GGGTAGACAGATGTGGGGATGGG + Intergenic
955521944 3:59783723-59783745 GTGTGGAGATGTTTGTGGATGGG - Intronic
955639668 3:61068644-61068666 GTGTAGATATCTTTGGGGGGAGG + Intronic
957940436 3:86996485-86996507 ATGTGGACATCTTTGGGGAGGGG - Intergenic
957995898 3:87689806-87689828 GGGTAGACAGAATTGGGGGTTGG - Intergenic
957997388 3:87707738-87707760 ATGTAACCATATTTGGAGATGGG - Intergenic
958576338 3:95953439-95953461 GGGGAGATAAATTTGGGGATAGG + Intergenic
959219603 3:103499954-103499976 GTTTAGTCATATTTGGGGTTTGG + Intergenic
959406441 3:105966923-105966945 ATGTAACCATATTTGGGAATAGG - Intergenic
959904323 3:111693834-111693856 GTGTAGACCTAGCTGGGGAGTGG - Intronic
960373962 3:116875727-116875749 GTGTGGTTATATTTGGAGATAGG - Intronic
962975410 3:140441879-140441901 GTGCAGACATATGTGAGGCTCGG - Intronic
962976602 3:140451410-140451432 GTGTGGACTTATTTGGAGTTGGG + Intronic
964272157 3:154968235-154968257 ATGTGAACATATTTGGAGATAGG - Intergenic
964547561 3:157850959-157850981 GTATAGATTTATTTGGGGAAGGG - Intergenic
967205348 3:187114530-187114552 GAGTAGACATTTTTGGGGTGTGG + Intergenic
967715200 3:192754405-192754427 ATGTAGTCAGACTTGGGGATTGG - Intronic
969955249 4:10883020-10883042 GTGTGGAGATATTTGGAGATGGG + Intergenic
970066411 4:12099358-12099380 GTGAAGATCTGTTTGGGGATGGG - Intergenic
971478943 4:27097463-27097485 ATGTAGCCTTATTTGGTGATAGG + Intergenic
972164107 4:36261169-36261191 GAGTAGACATATTTGGCCATAGG - Intergenic
972226158 4:37015192-37015214 GTGTTGACAAATTTGGTGACTGG - Intergenic
972581451 4:40398993-40399015 GTGTAACCATTCTTGGGGATTGG - Intergenic
974221453 4:58977979-58978001 ATGTAATCATATTTGGAGATCGG + Intergenic
977456083 4:97261301-97261323 GTGTGGCTATATTTGGAGATGGG + Intronic
977675974 4:99747430-99747452 GAGTAGTCATTTTTGGGGAATGG + Intergenic
978100881 4:104840199-104840221 GTGAAGACATGTTAGGAGATAGG + Intergenic
978225458 4:106328966-106328988 TTTTAGACATATCTGGGGAAAGG - Intronic
979683421 4:123485533-123485555 GAGAAGACATAATTTGGGATAGG - Intergenic
981407587 4:144389018-144389040 GAATAGACATAATTGGGGAAGGG + Intergenic
983576223 4:169264391-169264413 ATGTGGCCATATTTGGGGATAGG - Intronic
983588982 4:169386636-169386658 GTGTAGCTGTATTTGGAGATGGG + Intergenic
983897330 4:173095629-173095651 GTGTGAACACATTTGGAGATTGG - Intergenic
985847274 5:2359764-2359786 GTGTAGTCATATTGGGGAATTGG + Intergenic
987087604 5:14484803-14484825 GAGTAGTCAAATGTGGGGATAGG - Intronic
988970287 5:36460038-36460060 GTGTAGAGATATTTGCTGATTGG + Intergenic
990533784 5:56700019-56700041 GTGAGGACATATCAGGGGATGGG + Intergenic
990558238 5:56957667-56957689 GTGTGGCTATATTTGGAGATGGG + Intronic
992164727 5:74038364-74038386 GTGTAGTGGTATTTGTGGATGGG + Intergenic
994078542 5:95680593-95680615 GTGTAGTAATATTAGGGCATAGG - Intronic
995240110 5:109875992-109876014 GTAGATAGATATTTGGGGATGGG + Intergenic
996368944 5:122732971-122732993 GTGAAAACATATTTGGGGAAAGG - Intergenic
997518961 5:134509935-134509957 GCGCAGACATCTTTAGGGATGGG + Intergenic
998070829 5:139196864-139196886 GTATAGCCAGATTTGGGGATTGG - Intronic
998877771 5:146618039-146618061 GTGTAGACATATTTGGGGATGGG - Intronic
1000197420 5:158973015-158973037 GTGAAGAAATATTTGGGGAGGGG - Intronic
1000541573 5:162547736-162547758 ATGTAGACCTATTTTGGGTTAGG - Intergenic
1000734722 5:164884909-164884931 GTGCAGAGACATTTGGGGATTGG - Intergenic
1001065736 5:168533803-168533825 GTGTTACTATATTTGGGGATAGG - Intergenic
1002390424 5:178907370-178907392 ATATATACATATTTGGGGGTAGG + Intronic
1003356067 6:5371633-5371655 CTCTTGTCATATTTGGGGATAGG + Intronic
1004792067 6:19037513-19037535 GTGTGGATGTATTTGGAGATGGG - Intergenic
1008337748 6:50326665-50326687 GTGTAGGCATATTGGTGCATAGG - Intergenic
1008827921 6:55720762-55720784 CCAAAGACATATTTGGGGATGGG + Intergenic
1009405927 6:63312789-63312811 GTGCAGACATACTTGGGAAGTGG + Intronic
1009845930 6:69134440-69134462 GTGAAAACATATTTGGGATTGGG + Intronic
1010259105 6:73794865-73794887 GTTTATACACATTTGTGGATTGG + Intronic
1011079138 6:83470547-83470569 ATGTAACCATATTTGGGGATAGG + Intergenic
1012027638 6:94017819-94017841 CTGGAGACATATGTAGGGATAGG - Intergenic
1012704993 6:102513346-102513368 ATAGAGAAATATTTGGGGATGGG - Intergenic
1013541968 6:111119673-111119695 GTGTGGCAATATTTGGAGATGGG + Intronic
1013730378 6:113157567-113157589 TTATAAACTTATTTGGGGATAGG - Intergenic
1014148904 6:118030601-118030623 GTGTAAAGATCTTTGGGGGTGGG + Intronic
1015336998 6:132050650-132050672 GTGTAGCCTTATTTGGAGATAGG + Intergenic
1015577455 6:134688211-134688233 GTGTACACATGTTTAGGGATGGG - Intergenic
1019947171 7:4339016-4339038 GTAAAGACATATCTGGGGCTGGG + Intergenic
1020863105 7:13519895-13519917 GTGTAAGCATATTTGTGGTTGGG - Intergenic
1022790680 7:33686046-33686068 GAGAAGACATATTTGTGAATGGG + Intergenic
1024291869 7:47810882-47810904 GTGTGGATATATGTGGGGATGGG + Intronic
1025792916 7:64708578-64708600 GTGTAGTAAGATTTGAGGATAGG - Exonic
1026694627 7:72580040-72580062 GTGTGGCTATATTTGGAGATGGG - Intronic
1027456403 7:78397233-78397255 ATGAAGATAAATTTGGGGATAGG + Intronic
1027643603 7:80768594-80768616 GTGAAAAAACATTTGGGGATGGG + Intronic
1027882609 7:83860478-83860500 GTGTACACTTCTTGGGGGATGGG + Intergenic
1028738451 7:94245289-94245311 ATCCACACATATTTGGGGATGGG - Intergenic
1028747337 7:94342617-94342639 TAGTAGACATCTTTGAGGATAGG - Intergenic
1029986532 7:104928050-104928072 ATGTAACCATATTTGGGGATGGG + Intergenic
1031161661 7:118176146-118176168 ATGTGGACATCTTTGGGGGTTGG + Intergenic
1031867623 7:127055646-127055668 ATATATAAATATTTGGGGATGGG - Intronic
1032510752 7:132470508-132470530 ATGTGGACATCTTTGGGGAGGGG - Intronic
1032682282 7:134197248-134197270 GTATATACATATTTGAGGTTGGG + Intronic
1033126947 7:138714797-138714819 ATGTAGACATCTTTGGGGATGGG - Intronic
1033272893 7:139948419-139948441 GTGTAGCTGTATTTGGAGATAGG - Intronic
1033342976 7:140506350-140506372 ATGTAACCATATTTGGAGATAGG - Intergenic
1033420181 7:141198669-141198691 GTGGAGACAGATCTGGAGATGGG - Intronic
1033493875 7:141873997-141874019 ATGTAGAACTATTTGGGGATGGG - Intergenic
1035863731 8:3058990-3059012 ATGTTGACATGTTTGGGGAAAGG + Intronic
1038265434 8:26036063-26036085 TTGCACACATATTTGGGGTTAGG - Intronic
1038452052 8:27646133-27646155 GAGAAGACCTCTTTGGGGATTGG + Intronic
1039763387 8:40601963-40601985 GTGTACACTTATTGGGTGATGGG - Intronic
1040387276 8:46922044-46922066 GTGCAGAGACCTTTGGGGATGGG + Intergenic
1042022803 8:64387843-64387865 CTGTGGGCATATTTTGGGATAGG - Intergenic
1043869175 8:85411956-85411978 GTGCATACATATATGGGGAGGGG + Intronic
1044745449 8:95366439-95366461 GTGTGATCATATTTGGAGATAGG - Intergenic
1044810354 8:96054728-96054750 GTGAAGACATGTTTGCTGATAGG - Intergenic
1045563896 8:103294262-103294284 CTGTACACATACTGGGGGATAGG - Intergenic
1045985432 8:108244924-108244946 GTATAGACATATTTAGGGGTAGG - Intronic
1046139674 8:110074305-110074327 TTTTAGACATTTTTGAGGATAGG - Intergenic
1046627935 8:116595079-116595101 GTGTAGCTCTATTTGGAGATAGG + Intergenic
1048422722 8:134293338-134293360 TTGTGGCCATATTTGGAGATGGG + Intergenic
1051507012 9:17838526-17838548 TGGTAGACATATTTGAGCATTGG - Intergenic
1051600038 9:18863396-18863418 GTGAAGAGACATTTGGGGAATGG + Intronic
1055273594 9:74589326-74589348 GTGTAGTCATATTTCGGGAATGG - Intronic
1055330795 9:75181430-75181452 GTGTGGACATATTTTGGTAGTGG - Intergenic
1057027563 9:91746543-91746565 GTGTAGACACACTTGGCGAGCGG + Intronic
1058986013 9:110208670-110208692 CTGTAGACATATTGGGTAATTGG - Intergenic
1059057446 9:110999154-110999176 GTGTGGACATATTGGGGAGTTGG - Intronic
1061159751 9:128886625-128886647 GTGTAGACATCTTTGGGGACTGG + Intronic
1061979085 9:134089694-134089716 GTGTCTGCATTTTTGGGGATGGG + Intergenic
1062161455 9:135082620-135082642 GTGTGTGCATATTTGGGGCTGGG - Intronic
1062388095 9:136322765-136322787 GTGGGGACTTATTTGGGGAAAGG + Intergenic
1185450148 X:277267-277289 GTGGGGACAGATGTGGGGATAGG + Intronic
1186966762 X:14795737-14795759 GTGTAGACATCTTTGTGTTTGGG - Intergenic
1189343343 X:40221302-40221324 GTGTGGTTATATTTGGAGATAGG - Intergenic
1190104584 X:47550300-47550322 GTGTGGCTATATTTGGAGATAGG - Intergenic
1190851461 X:54247608-54247630 GTGTCTACAGGTTTGGGGATGGG + Intronic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1193333528 X:80261773-80261795 GTGGGGAGATATTTGGGGACAGG + Intergenic
1193977504 X:88140627-88140649 GTGTGGTGATATTTGGAGATGGG + Intergenic
1194036647 X:88883148-88883170 GTGTTGAAATATTTAGTGATTGG - Intergenic
1194148686 X:90296545-90296567 GTTTACAAATATTTGGAGATTGG - Intergenic
1194937905 X:99973127-99973149 ATGTGAACATATTTGGAGATTGG - Intergenic
1194967835 X:100309430-100309452 GTGTACACATCTTGGGTGATGGG + Intronic
1196671398 X:118371790-118371812 ATGTAGACATATTTGAGTATTGG - Intronic
1197405734 X:126046802-126046824 GTGTAGGCAGAGGTGGGGATTGG + Intergenic
1198478163 X:137015950-137015972 GTTCAGACACATTTGAGGATTGG - Intergenic
1199118476 X:144021313-144021335 ATGTAAACATATTTGGAAATAGG - Intergenic
1200495059 Y:3873277-3873299 GTTTACAAATATTTGGAGATTGG - Intergenic