ID: 998877862

View in Genome Browser
Species Human (GRCh38)
Location 5:146618666-146618688
Sequence TGCCCAGAAGCAGCCCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998877862_998877864 -9 Left 998877862 5:146618666-146618688 CCAGAGCGGGCTGCTTCTGGGCA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 998877864 5:146618680-146618702 TTCTGGGCAGAGGCCATGAGAGG 0: 1
1: 0
2: 4
3: 23
4: 410
998877862_998877867 6 Left 998877862 5:146618666-146618688 CCAGAGCGGGCTGCTTCTGGGCA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 998877867 5:146618695-146618717 ATGAGAGGCTCACTGTCCAAGGG No data
998877862_998877868 12 Left 998877862 5:146618666-146618688 CCAGAGCGGGCTGCTTCTGGGCA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 998877868 5:146618701-146618723 GGCTCACTGTCCAAGGGAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 222
998877862_998877866 5 Left 998877862 5:146618666-146618688 CCAGAGCGGGCTGCTTCTGGGCA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 998877866 5:146618694-146618716 CATGAGAGGCTCACTGTCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998877862 Original CRISPR TGCCCAGAAGCAGCCCGCTC TGG (reversed) Intronic