ID: 998877862

View in Genome Browser
Species Human (GRCh38)
Location 5:146618666-146618688
Sequence TGCCCAGAAGCAGCCCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998877862_998877867 6 Left 998877862 5:146618666-146618688 CCAGAGCGGGCTGCTTCTGGGCA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 998877867 5:146618695-146618717 ATGAGAGGCTCACTGTCCAAGGG No data
998877862_998877868 12 Left 998877862 5:146618666-146618688 CCAGAGCGGGCTGCTTCTGGGCA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 998877868 5:146618701-146618723 GGCTCACTGTCCAAGGGAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 222
998877862_998877864 -9 Left 998877862 5:146618666-146618688 CCAGAGCGGGCTGCTTCTGGGCA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 998877864 5:146618680-146618702 TTCTGGGCAGAGGCCATGAGAGG 0: 1
1: 0
2: 4
3: 23
4: 410
998877862_998877866 5 Left 998877862 5:146618666-146618688 CCAGAGCGGGCTGCTTCTGGGCA 0: 1
1: 0
2: 1
3: 10
4: 171
Right 998877866 5:146618694-146618716 CATGAGAGGCTCACTGTCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998877862 Original CRISPR TGCCCAGAAGCAGCCCGCTC TGG (reversed) Intronic
900657045 1:3763539-3763561 CGCCCAGACGCTGCCTGCTCTGG + Intronic
902697949 1:18153108-18153130 TGCCCAGCAGCAGCCACCACAGG + Intronic
902894526 1:19469848-19469870 TGCCCACAAGCACCCAGGTCGGG + Intronic
903223383 1:21881209-21881231 TGCCCCGATGCAGCCCCCTGTGG - Intronic
903327455 1:22577559-22577581 TGAACAGAAGCAGCCTGTTCAGG - Intronic
903969508 1:27109663-27109685 CGCCCACAAGCACCCCGCCCAGG + Exonic
904774163 1:32896509-32896531 TGCCCATACACAGCCTGCTCAGG + Intronic
907546330 1:55263032-55263054 TGCTCAGAAGGAGCCAGCCCTGG + Intergenic
910760798 1:90729557-90729579 TGCCCAGGAGCTGCAGGCTCGGG + Intergenic
912116297 1:106412553-106412575 TGCCCAGCAGCTGCCCCGTCTGG + Intergenic
912354208 1:109041928-109041950 GGCCCCGAAGCGGCCGGCTCCGG + Exonic
917969065 1:180195702-180195724 TACCCAGCAGCAGCCCTCTGGGG - Intronic
920858597 1:209685937-209685959 TGCCCAGAACTGGCCCACTCTGG + Intergenic
922164384 1:223102906-223102928 AGCCCAGAAGAAGCCAGCTGGGG + Intergenic
1063298127 10:4826520-4826542 CGCCCACAAGCAGCCCGGCCCGG + Intronic
1064590908 10:16890110-16890132 TGCCCAATATCAGCCCACTCTGG + Intronic
1066390929 10:34976753-34976775 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1069674973 10:70240086-70240108 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1070111972 10:73495648-73495670 TGCCCAGCAGGGGCCCGCCCAGG + Intronic
1070580253 10:77713671-77713693 TGGGCAGAAGCAGCAAGCTCAGG - Intergenic
1070617678 10:77981577-77981599 TGAGCAGAAGCAGCCCCTTCCGG + Intronic
1070767010 10:79062551-79062573 TGACCAGAACCAGCCCTCTGGGG - Intergenic
1074112866 10:110434695-110434717 TGCCCACAAGCTGCCGGCTGTGG + Intergenic
1075036528 10:119073902-119073924 TGGCAAAAAGCAGCCTGCTCTGG - Exonic
1075108532 10:119559640-119559662 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1076349937 10:129808761-129808783 TGGCCAGAAAGAGCCCACTCCGG + Intergenic
1077154892 11:1086892-1086914 TGACCATAAGCAGCCCGACCAGG - Intergenic
1077196310 11:1282253-1282275 TGGCCAGAGGGAGCCCCCTCAGG - Intronic
1077208771 11:1358376-1358398 TGACCAGAAGCAGGCCGTGCTGG - Intergenic
1077391141 11:2301146-2301168 GGCCCAGCTGCCGCCCGCTCAGG - Intronic
1078094112 11:8285989-8286011 CACCCAGAAGCAGCACCCTCAGG + Intergenic
1079018350 11:16888192-16888214 TGCCCAGCAGCCGCCCCATCTGG + Intronic
1096951626 12:55479275-55479297 TGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1097089589 12:56494605-56494627 TGCCCAGCCGCCGCCCCCTCTGG - Intergenic
1098001752 12:65951394-65951416 TGTTCAGAAGAAGCCTGCTCAGG + Exonic
1098622579 12:72621332-72621354 TACCCAGCAGCAGTCCTCTCGGG - Intronic
1102677534 12:114668771-114668793 TGCGCAGAAGGAGCGCGCCCTGG + Intergenic
1102874186 12:116436953-116436975 TGCCCAGCACCAGCCCACGCAGG - Intergenic
1104507379 12:129345092-129345114 TGCCCAGAACCTGCTTGCTCTGG + Intronic
1104836980 12:131797889-131797911 TTCCCAGATGCTGCCCTCTCTGG - Intronic
1104873942 12:132019940-132019962 TGCCCATAGGAAGCCAGCTCAGG - Intronic
1106558402 13:30829223-30829245 TGCCAGGAAGCAGCCAGCTCTGG - Intergenic
1106589860 13:31089880-31089902 TGGGCAGAAGCAGCCCACCCGGG - Intergenic
1112146946 13:96710414-96710436 GGCCCTGAAGCAGTCAGCTCTGG - Intronic
1116431293 14:44848134-44848156 TGCCCAGAAGAAGCTGACTCTGG - Intergenic
1120394832 14:83955827-83955849 TGCCCAGAACCTGCTTGCTCTGG + Intergenic
1128577933 15:68789095-68789117 TTCCCAGAAGCTGGCTGCTCTGG - Intronic
1131054808 15:89368904-89368926 TGGGCAGGAGCAGCCCGGTCGGG - Intergenic
1131368304 15:91858166-91858188 AACCCAGAAGCAGACAGCTCAGG + Intronic
1132575395 16:661544-661566 TGCACAGATGCAGCCCCCCCCGG - Intronic
1132585686 16:705066-705088 GGTCCAGAAGCCGCCCGCCCGGG + Intronic
1136116772 16:28099490-28099512 TCCCCAGAAGCAGATTGCTCAGG - Intronic
1136750233 16:32628901-32628923 TTCCCAGAAGAAGCCAGCCCGGG - Intergenic
1137558461 16:49488314-49488336 TGCCCAGAAGCAGGCAGGTAAGG - Exonic
1141083759 16:81076975-81076997 TCCCCAGACCCCGCCCGCTCTGG + Intronic
1141188410 16:81805679-81805701 GGTCCAGAAGCAGCCAGCTTTGG - Intronic
1142399958 16:89853435-89853457 TGGCCAGGAGCGGCCTGCTCAGG + Intronic
1203052364 16_KI270728v1_random:888106-888128 TTCCCAGAAGAAGCCAGCCCGGG - Intergenic
1143544708 17:7589233-7589255 TGGCCAGCGGCGGCCCGCTCTGG - Exonic
1143621503 17:8083392-8083414 TGGTCAGAAGCAGCCCACTACGG - Intronic
1144497421 17:15757318-15757340 TCCCCTGCAGCAGCTCGCTCAGG - Intergenic
1144652213 17:17014311-17014333 TCCCCTGCAGCAGCTCGCTCAGG + Intergenic
1145160782 17:20572368-20572390 TCCCCTGCAGCAGCTCGCTCAGG - Intergenic
1148997614 17:51724943-51724965 TGCCTACAAGGAGCCAGCTCTGG + Intronic
1150894560 17:69196082-69196104 TGCCCAGCCGCCACCCGCTCTGG - Intronic
1151187061 17:72372195-72372217 ACCCCAGAGGCAGGCCGCTCGGG + Intergenic
1152140787 17:78535182-78535204 TGCCCAAGAGCAGCCTGCTTTGG + Intronic
1153836730 18:8970433-8970455 AGGCCAGAAGCAGCCCTCTAGGG - Intergenic
1154089623 18:11344794-11344816 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1156250126 18:35344450-35344472 AGACCGGAAGCAGCCCGCGCCGG - Exonic
1157857723 18:51117280-51117302 TGCCCAGCAGCTGCCCTGTCCGG - Intergenic
1159614897 18:70569704-70569726 TGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1160990201 19:1857306-1857328 TGGCTAGGAGCAGCGCGCTCTGG - Intronic
1163117686 19:15198104-15198126 TCTCCAGAAGCAGCCAGCGCTGG + Intronic
1163531786 19:17854217-17854239 AGCCCAGGACCAGCCTGCTCAGG + Intergenic
1164016727 19:21260788-21260810 TGCCCAGCAGCTGCCCTGTCTGG - Intronic
1164274149 19:23702121-23702143 TGCCCAGAACCTGCTTGCTCTGG + Intergenic
1164298186 19:23934909-23934931 TGCCCCTAAGCAGCTGGCTCTGG - Intronic
1164745654 19:30610809-30610831 TGGCTAGAAGCAGCTCTCTCTGG - Intronic
1167913178 19:52720582-52720604 TGCCCAGCAGCTGCCCCGTCTGG - Intronic
928379896 2:30808853-30808875 TGCCAAGAAACAAGCCGCTCTGG + Intronic
929592770 2:43157861-43157883 TGTCCAGAAGCAGCCCCCTCAGG - Intergenic
931239676 2:60441030-60441052 TCCCCAGGAGCAGCCCCCTGAGG - Intergenic
932274641 2:70442881-70442903 TGCCCAGAAGCTGACCCCTCTGG - Intergenic
932493843 2:72137070-72137092 GGCCCAGAAACAGCCAGCCCAGG + Intronic
934519831 2:95013189-95013211 ATCCCAGAAGCAGCCCTCTGTGG + Intergenic
935575024 2:104700522-104700544 TGCTCAGAAGCAGCCCCCAAAGG - Intergenic
937310412 2:120899189-120899211 GGCCCAGCTGCAGCCTGCTCTGG - Intronic
937842283 2:126535804-126535826 TACTCAGAAGCAGCCCCCTGTGG + Intergenic
938500922 2:131831066-131831088 GGCCCAGAAGCTGCCCACTGGGG + Intergenic
942290994 2:174470604-174470626 TCCCCAGTAGCAGGCTGCTCTGG + Intronic
942552167 2:177130876-177130898 TCCCCAGCAGCAGCCCTCTATGG + Intergenic
942979115 2:182057467-182057489 TGCACAGAAGCAGCAAGCTGGGG + Intronic
943863214 2:192894257-192894279 CGCCCAGCAGCCGCCCGGTCCGG + Intergenic
946192310 2:218013996-218014018 TTCCCAGAGGCAGCCAGCACAGG + Intergenic
946424600 2:219586746-219586768 TGCCCAGAACCTGCTTGCTCTGG - Intergenic
947102793 2:226639246-226639268 TTCCCAGAAGCAGCCCTCTGCGG - Intergenic
947390373 2:229633687-229633709 TGTCCAGCAGCAGCCCGTTCAGG + Intronic
948147597 2:235719733-235719755 TGCCCTGCAGCAGCCCTCCCTGG + Intronic
948301050 2:236907665-236907687 TGCCACGAAGCAGCTCCCTCTGG - Intergenic
1169234821 20:3922539-3922561 GGCCCAGAAGCAGGCGGCACAGG - Intronic
1170573502 20:17646140-17646162 TGCCCAGGACCACCCAGCTCAGG - Intronic
1173907803 20:46641560-46641582 TGACCAGAAGCACCCAGCTGTGG + Intronic
1175442706 20:59002520-59002542 TGCCCATTGGCAGCCCCCTCTGG + Intronic
1175872406 20:62214683-62214705 TGCACAGGAGGGGCCCGCTCTGG - Intergenic
1178668062 21:34566198-34566220 TGCCCAGAAGCAATCCACTCTGG - Intronic
1181475190 22:23163794-23163816 TGTCCAGAAGGAGCTCACTCTGG - Exonic
1182798148 22:33006446-33006468 TGCCATGAAGCAGGCCCCTCAGG - Exonic
1183703012 22:39460353-39460375 TGCCCCCAAGCAGCCAGCACAGG - Intronic
1184490441 22:44805193-44805215 GGCCCAGCAGCAGCCTCCTCGGG - Intronic
1184841456 22:47054733-47054755 TGCCCAGGAACAGCCCTCACTGG - Intronic
952764583 3:36943954-36943976 TGCCCAGAAACACCCCGATCTGG + Intronic
954746809 3:52792064-52792086 TCCCCAAAATCAGCCAGCTCAGG - Intronic
956710475 3:72034824-72034846 TCCCCAGAAGCTGCCATCTCTGG - Intergenic
956931620 3:74050037-74050059 TGCCCAGAGGTAGCCCCCACAGG + Intergenic
957646750 3:82939905-82939927 AGCCCAGGAGCCGCCCGCCCAGG + Intergenic
962787932 3:138785071-138785093 TGCCCAGCAGCCGCCCTGTCCGG + Intronic
964529648 3:157653564-157653586 TGCCCAGAGCCAGCCCTTTCTGG + Intronic
968156536 3:196385683-196385705 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
969429688 4:7146874-7146896 TGCCCAGAACCGGCGCGCACAGG - Intergenic
972399965 4:38691820-38691842 TGCCCAGTAGCAGCCCACGTAGG + Intronic
973263369 4:48186612-48186634 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
973274395 4:48292560-48292582 TGCCCAGCAGCTGCCCCGTCTGG + Intergenic
973581649 4:52349857-52349879 TGGCCAGAAGCTGCTTGCTCTGG - Intergenic
975858061 4:78646011-78646033 TGCCCAGAAACAGCAGCCTCAGG - Intergenic
976976220 4:91168467-91168489 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
979343458 4:119556493-119556515 AGCCCAGAGGTAGCCAGCTCAGG - Intronic
986013400 5:3737412-3737434 TGCTCTGAAGCAGCCAGCCCAGG + Intergenic
988532881 5:32041038-32041060 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
989314866 5:40066739-40066761 TGCCTAGAAGCTGGCCGCGCTGG - Intergenic
989663462 5:43824564-43824586 TGCCCAGCAGCTGCCCCATCTGG - Intergenic
989663471 5:43824604-43824626 TGCCCAGCAGCCGCCCCATCTGG - Intergenic
991120524 5:63008317-63008339 TGAGCAGAGGCAGCCGGCTCCGG - Intergenic
993905610 5:93620669-93620691 TGCCCTGAAGGAGACCGCGCGGG - Exonic
995177672 5:109197618-109197640 GGCCCAGAAGCACACAGCTCTGG - Intergenic
997433529 5:133857962-133857984 TGCCCAGCAGCTGCCCTGTCTGG - Intergenic
997823760 5:137088455-137088477 TGCCTGGAAGCAGGCCGATCAGG - Intronic
998877862 5:146618666-146618688 TGCCCAGAAGCAGCCCGCTCTGG - Intronic
1001930557 5:175669985-175670007 AACCCAGGAGCAGCCCCCTCGGG + Intronic
1001994544 5:176145451-176145473 TTCCCAGAAGGAGCCAGCCCAGG + Intergenic
1002400918 5:178991244-178991266 GGCTCAGAAGCAGCCTGGTCTGG - Intronic
1002447289 5:179297406-179297428 TGCCGAGAAGCAGCAATCTCAGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1004999348 6:21225078-21225100 TGCTCAGAAGGAGCACGCTTAGG + Intronic
1006578799 6:35064726-35064748 TGCCCAGTGGCAGCTCGCTTAGG - Intronic
1007111643 6:39316309-39316331 TGCACAGATGCTGCCAGCTCTGG - Intronic
1007415143 6:41687244-41687266 TGCCCTGAAGCACCCCTCCCTGG - Intronic
1008673551 6:53796045-53796067 TGCCCAGATGCCGGCCGCCCGGG + Intronic
1008909911 6:56721119-56721141 TGCCCAGCAGCTGCCCTGTCTGG - Intronic
1009042050 6:58190830-58190852 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1009432594 6:63582869-63582891 TACCTAGAAGCAGCCAGCCCAGG + Exonic
1010300611 6:74255124-74255146 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1017254885 6:152322778-152322800 TGCCTAGCTCCAGCCCGCTCAGG + Intronic
1019651544 7:2161862-2161884 TGCCCAGCAGCCGCCCTGTCCGG + Intronic
1022102528 7:27177020-27177042 TGCCCTGCAGCAGACAGCTCAGG + Intronic
1022488185 7:30796305-30796327 TCCCCAGAAGCAGCAGGCTTAGG + Intronic
1027336620 7:77157701-77157723 TGCAGAGAAGCAGCCCCCACTGG - Intronic
1028650942 7:93150239-93150261 TGCCCAGAACCTGCTTGCTCTGG + Intergenic
1029125040 7:98289673-98289695 GGCCCAGAAGGAGCCCGTTGGGG + Intronic
1029155077 7:98511435-98511457 AGCCCAGGAGAAGCCAGCTCAGG + Intergenic
1029779171 7:102713408-102713430 TGCAGAGAAGCAGCCCCCACTGG + Intergenic
1031467226 7:122127433-122127455 TGCCCAAAAGCAGCCCTGTTAGG + Intronic
1032252602 7:130271033-130271055 TACCCACAAGCAGCTCCCTCAGG + Intronic
1037755725 8:21709025-21709047 TGCCCACCTGCAGCCCACTCCGG - Intronic
1039201101 8:35094662-35094684 TGCCCAGCCGCCGCCCGGTCTGG - Intergenic
1042946763 8:74163016-74163038 TGAACAAAAGCAGCCAGCTCCGG + Intergenic
1043654132 8:82640521-82640543 TGTCCAGAAGCAGCATGCTGTGG + Intergenic
1044969445 8:97605153-97605175 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1049271346 8:141697900-141697922 AGCCCAGACGCTGGCCGCTCAGG + Intergenic
1049278670 8:141732889-141732911 TGCCCAGAAGCAGCATCCTCCGG - Intergenic
1050947975 9:11550041-11550063 TGGATAGGAGCAGCCCGCTCTGG + Intergenic
1053312854 9:37030255-37030277 TTCCCAGAGGCCGCCCGCTCGGG - Intronic
1056576082 9:87857178-87857200 TGCCCAGCAGCAGCCACGTCTGG - Intergenic
1056703511 9:88931920-88931942 TGCCCAGAAGCAGGTGGCTGAGG + Intergenic
1059608990 9:115871110-115871132 TGCCCACAAGCAGCACGCTAAGG + Intergenic
1185654974 X:1677342-1677364 TGCCCAGGAGAATCCAGCTCAGG + Intergenic
1190906837 X:54736633-54736655 TGCCCAGCAGCCGCCCTATCCGG + Intergenic
1192337453 X:70234240-70234262 TGCCCTGAAGCAGCCTGCTTTGG - Intergenic
1195979046 X:110558737-110558759 TGCCCAGCTGCAGCCCCGTCTGG - Intergenic
1200002733 X:153070567-153070589 TGCCCAGAAGCAGGTCGCATTGG - Intergenic
1200004990 X:153079442-153079464 TGCCCAGAAGCAGGTCGCATTGG + Intergenic
1200162754 X:154017849-154017871 TCCCCAGCAGCACCCGGCTCAGG - Intronic
1201948264 Y:19535722-19535744 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic