ID: 998879621

View in Genome Browser
Species Human (GRCh38)
Location 5:146632968-146632990
Sequence GTGTAATGGACACCAACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998879621_998879634 24 Left 998879621 5:146632968-146632990 CCCCAGGTTGGTGTCCATTACAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 998879634 5:146633015-146633037 CCGATACTCATGCGTGGAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 18
998879621_998879635 25 Left 998879621 5:146632968-146632990 CCCCAGGTTGGTGTCCATTACAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 998879635 5:146633016-146633038 CGATACTCATGCGTGGAAAGGGG 0: 1
1: 0
2: 0
3: 2
4: 25
998879621_998879632 23 Left 998879621 5:146632968-146632990 CCCCAGGTTGGTGTCCATTACAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 998879632 5:146633014-146633036 ACCGATACTCATGCGTGGAAAGG 0: 1
1: 0
2: 0
3: 0
4: 22
998879621_998879630 18 Left 998879621 5:146632968-146632990 CCCCAGGTTGGTGTCCATTACAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 998879630 5:146633009-146633031 CAGCCACCGATACTCATGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998879621 Original CRISPR GTGTAATGGACACCAACCTG GGG (reversed) Intronic