ID: 998879633

View in Genome Browser
Species Human (GRCh38)
Location 5:146633015-146633037
Sequence CCCTTTCCACGCATGAGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998879633 Original CRISPR CCCTTTCCACGCATGAGTAT CGG (reversed) Intronic
909915740 1:81316795-81316817 TTCTTTCTAGGCATGAGTATAGG - Intronic
920455742 1:206099787-206099809 CCCTTTACAGGCGTGAGTAAGGG + Exonic
1068416836 10:56734152-56734174 CCCCTTTCACCCATGAGTAGAGG + Intergenic
1073148879 10:101298348-101298370 CCCTTTCCACGGATGTGCCTTGG + Intergenic
1077751185 11:4971787-4971809 CCCCTTCCACCAATGAGTAGAGG - Intronic
1080500943 11:32870457-32870479 CCCTTTTCAGGAATGAGTTTGGG - Intergenic
1086834826 11:91607777-91607799 CCCTTACCAAGCAGGAGTTTGGG - Intergenic
1089243368 11:117099785-117099807 CCCTATCCAACCATGAGTAATGG + Intergenic
1101262100 12:103043925-103043947 CCCTTTGCACACATCAGCATTGG + Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1107256381 13:38432532-38432554 CTCTTTCCACGCATAAGAAAAGG - Intergenic
1108404708 13:50088679-50088701 CCCTTTCCAGGAATCATTATTGG - Intronic
1112624632 13:101090035-101090057 CCCTTTCCAGTCATGAGTGTGGG + Intronic
1117465010 14:55984493-55984515 CCCTTTCCATGCATGGCTCTGGG - Intergenic
1119776300 14:77250952-77250974 CCCTTTCCAGGCATGCGCTTTGG + Intronic
1142860180 17:2756204-2756226 CCCTTTCCACGCAGGGGTTGGGG - Intergenic
1143975588 17:10827193-10827215 ACCTTTCCAGGCCTGAGAATAGG - Intronic
1154975548 18:21454016-21454038 CCCTTTCCAGGGATGAGTCTTGG + Intronic
1155249121 18:23938709-23938731 CCCTTTCCACCACTGAGCATTGG - Intronic
1163703475 19:18798848-18798870 CCCTTTCCGTGCAGCAGTATTGG - Intergenic
1164426538 19:28146761-28146783 CCATTCCCACTCATGGGTATGGG + Intergenic
927647690 2:24888360-24888382 CCCTTTCCACGTCTCATTATCGG + Intronic
938472621 2:131579451-131579473 CCCTTTCCACGTCTGAATTTTGG + Intergenic
942983823 2:182114897-182114919 CACTTTCCACACTTGAGAATAGG - Intronic
944762588 2:202832279-202832301 CCCTTTCCCCACTGGAGTATGGG - Intronic
946327364 2:218991745-218991767 CCATTTCCACACCTGTGTATGGG + Intronic
1171823961 20:29878088-29878110 CCCTTTCCAGGCAAGAGGAAAGG - Intergenic
1178485229 21:33015113-33015135 CCCTTTCCATGCATGCCTTTAGG - Intergenic
967541811 3:190677291-190677313 CCCTTTCCCCCCATTACTATTGG - Intergenic
981559773 4:146034262-146034284 CTCTATCCACCCATGAGCATGGG - Intergenic
998879633 5:146633015-146633037 CCCTTTCCACGCATGAGTATCGG - Intronic
1009524373 6:64725378-64725400 CCCTTCCCACCCATCAGAATAGG + Intronic
1034549100 7:151809061-151809083 CGCCTTGCACGGATGAGTATGGG + Intronic
1042558736 8:70056421-70056443 CTCTTTCCAGGCATGCTTATGGG + Intronic
1042749656 8:72144426-72144448 GACTTTCCGGGCATGAGTATAGG - Intergenic
1052118969 9:24685188-24685210 CACATTCCACGCATGTGTCTAGG + Intergenic
1054744894 9:68844336-68844358 CCCTTCCCAGGCATGATTAGAGG - Intronic
1188160670 X:26797793-26797815 CCCTTTTCTAGCATGACTATGGG - Intergenic
1192021894 X:67402803-67402825 CCTTTTGCAAGCATGAGTCTGGG + Intergenic
1194965797 X:100287411-100287433 TTCTTTCCATACATGAGTATGGG + Intergenic
1200372926 X:155746542-155746564 CCCTTTACACTCATGAATAGAGG - Intergenic