ID: 998880299

View in Genome Browser
Species Human (GRCh38)
Location 5:146638437-146638459
Sequence AGGAACCAGGAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1167
Summary {0: 1, 1: 0, 2: 13, 3: 101, 4: 1052}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998880291_998880299 28 Left 998880291 5:146638386-146638408 CCATGTTGGCTGGCTTAATGTCC 0: 1
1: 0
2: 3
3: 7
4: 110
Right 998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG 0: 1
1: 0
2: 13
3: 101
4: 1052
998880293_998880299 7 Left 998880293 5:146638407-146638429 CCACAATATCTGGCACAGACGAG 0: 1
1: 0
2: 1
3: 12
4: 124
Right 998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG 0: 1
1: 0
2: 13
3: 101
4: 1052

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998880299 Original CRISPR AGGAACCAGGAGAAGGAGGC AGG Intronic
900172302 1:1274913-1274935 AGGAGGCAGAGGAAGGAGGCTGG - Intergenic
900319129 1:2073908-2073930 AGGAGGCAGGAGAAGAAAGCCGG + Intronic
900554817 1:3275118-3275140 AGGCACTGGGAGCAGGAGGCGGG + Intronic
900894459 1:5473606-5473628 AGGAACCAGGACAAGGCAGCAGG + Intergenic
900929236 1:5725957-5725979 AGGAACCAGGGAAGGGAGGGAGG - Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901036280 1:6338196-6338218 AGGAAGCAGGAGAGCGCGGCAGG + Intronic
901221436 1:7586088-7586110 AGGAGCCTGGAGGAGGAGGAAGG + Intronic
901226676 1:7617098-7617120 GGGAGCCAAGAGAAGGAGCCAGG + Intronic
901483254 1:9540093-9540115 AGGCCCCAGGAGAAGGGGGCGGG - Intronic
901508374 1:9700977-9700999 AGGGGGCAGGGGAAGGAGGCCGG - Intronic
901636275 1:10671675-10671697 TGGAGCCTGGAAAAGGAGGCAGG + Intronic
901685899 1:10943174-10943196 AGGAACCAGGAACAGGTGGGAGG + Intergenic
901934080 1:12616274-12616296 AGCCATCAGGAGAGGGAGGCAGG - Intronic
902035615 1:13455984-13456006 AGGAACCAGGGGAATGGAGCAGG + Intergenic
902099207 1:13971856-13971878 AGGAAGCAGGAGCAAGAGGGAGG - Intergenic
902113096 1:14099362-14099384 GGGAACCAGGGGAATGAGGAAGG - Intergenic
903283551 1:22263612-22263634 ACAAACCAGGAAACGGAGGCTGG + Intergenic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904201063 1:28819298-28819320 AGGAGGCAGCAGGAGGAGGCTGG + Intronic
904355660 1:29937445-29937467 AAGAGCTAGGAGAAGGAGACTGG + Intergenic
904383120 1:30124752-30124774 AGGAAACTTGAGAGGGAGGCTGG - Intergenic
905124215 1:35706007-35706029 AGGACCCAGGAGGCTGAGGCAGG + Intergenic
905226285 1:36481268-36481290 AGCACCCAGGGGAAGGATGCCGG - Intronic
905262337 1:36728798-36728820 AGAAAGGAGGAGAGGGAGGCAGG - Intergenic
905267666 1:36765888-36765910 AGAAAGCAGGGGCAGGAGGCTGG + Intergenic
905563461 1:38945084-38945106 AGGAATCAGGAATAGGAAGCTGG - Intergenic
906006076 1:42471665-42471687 GGGGACCAGGTGAAGGAGGTCGG + Intronic
906653186 1:47527991-47528013 AGAAACAAGGGGAAGGAGGGAGG + Intergenic
906747668 1:48233005-48233027 AGGAACGAAGAGAGGGAGGGAGG + Intronic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
907074516 1:51566268-51566290 TGGAGATAGGAGAAGGAGGCTGG - Intergenic
907720820 1:56970595-56970617 ATGAAACAGGAGAGGCAGGCAGG + Intergenic
907821471 1:57974039-57974061 TGGATCAAGGACAAGGAGGCAGG - Intronic
907837608 1:58125985-58126007 AGGAGCCAGGGGAAGGGAGCAGG + Intronic
908346271 1:63236739-63236761 AGGACCTAGGAGAAGGATGTTGG - Intergenic
908391941 1:63691123-63691145 GGAGACCAGGAGAAGGAGGCAGG + Intergenic
908395263 1:63719688-63719710 AGGGACCAGTAGAAGGTGGTAGG - Intergenic
908789163 1:67764290-67764312 GGGGACCAGGAGAAAGAGGTGGG + Intronic
908903862 1:68985778-68985800 AGGAACCTAGAGAAGCAGTCTGG - Intergenic
909608830 1:77532382-77532404 TGGAACCAGGAGAGGGGGGTGGG - Intronic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
909957841 1:81801332-81801354 GGGAAGGAGGAGGAGGAGGCTGG + Intronic
910159788 1:84260447-84260469 GGGAGCCAGGAGAAGCATGCAGG + Intergenic
910297481 1:85664609-85664631 AGGAACTAGGTGAAGGTGGAGGG + Intronic
910408432 1:86914688-86914710 AGGAAGGAAGAGAGGGAGGCGGG + Exonic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911292971 1:96080476-96080498 AGGCAGCAGGAGAAAGAAGCAGG + Intergenic
911732853 1:101308234-101308256 AGGAAACAGCAGAAGCAGGAAGG + Intergenic
912258440 1:108084986-108085008 AGGAATCAGGAGTAGTAGACAGG + Intergenic
913076456 1:115344423-115344445 AGGAGCCAGGAGAAGAATGCTGG + Intergenic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
914416763 1:147491274-147491296 AGGAAACAGGAGAGGCAAGCAGG - Intergenic
914439082 1:147687268-147687290 AGGAAGCAAGAGAGAGAGGCAGG - Intergenic
914832061 1:151177436-151177458 AGGAAAGAGAAAAAGGAGGCAGG + Intronic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915037740 1:152942835-152942857 AGGATGCACGAGATGGAGGCAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915213912 1:154327972-154327994 AGAGACTGGGAGAAGGAGGCTGG + Intronic
915304134 1:154968336-154968358 AGGAACCCAGAGAATGAGACTGG - Intronic
915311703 1:155008553-155008575 TGGGACCAGGAGAAGGAAGAAGG - Intronic
915543640 1:156583703-156583725 AGGAAACAGGAAAGGGAGGGGGG - Intronic
915998416 1:160589139-160589161 AGGAAGCAAGAGAAGGAAGAAGG - Intergenic
916079219 1:161222025-161222047 AGGAACTAGGAGAGGAAGGAAGG - Intergenic
916484369 1:165244940-165244962 AGGGACCAGGACAAAAAGGCTGG + Intronic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916579565 1:166095418-166095440 AGGAACCAGGACAGGCAGACAGG + Intronic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917975750 1:180236481-180236503 AGGAGCCGGGGGAAGGAGGATGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919563384 1:199152865-199152887 AGAAAGGAGGAGAAGGAGGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919731315 1:200915328-200915350 AGGAACCTGGGGGAGGATGCAGG + Intronic
920092427 1:203464127-203464149 AGGAAGGAGGAGGAGGAGGGAGG + Intergenic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
920649624 1:207827046-207827068 AGGAAACAGGACAGGGAGGCCGG - Intergenic
920653124 1:207853370-207853392 AGGAACCAAGAGAAGAGGGAAGG + Intergenic
920666150 1:207964065-207964087 AGGGAGGAGGAGGAGGAGGCAGG + Intergenic
920705989 1:208251009-208251031 AGGAAACAGAAGTTGGAGGCTGG - Intergenic
921034219 1:211360974-211360996 AAGGACCAGGAGAAGGAGAGAGG - Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922212096 1:223494254-223494276 AAGGTCCAGGAGAAGGAGACAGG - Intergenic
922671368 1:227510626-227510648 AGGGAAGAGGAGGAGGAGGCAGG + Intergenic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
923902175 1:238338069-238338091 AGGCACCAGCAAAAGGAGCCAGG - Intergenic
924089444 1:240487281-240487303 AGGAGCCGGGAGAAGAAGGATGG + Intergenic
924243804 1:242062602-242062624 AGGGAACAGGAGGAGGTGGCAGG + Intergenic
924539642 1:244969887-244969909 GGGAAGCGGGAGGAGGAGGCCGG + Exonic
924606026 1:245536307-245536329 AGAAACCTGGAGAAAGAGGAAGG - Intronic
924876870 1:248115677-248115699 TGGCATCAGGAGACGGAGGCTGG + Intergenic
1062812413 10:476898-476920 GGGATCCTGGAGAAGCAGGCAGG + Intronic
1063159455 10:3408759-3408781 AGGAAAGAGGAGGAGGAGGGAGG + Intergenic
1063216284 10:3928970-3928992 TGGGACCAGGAGAAGGAGAAAGG + Intergenic
1063323524 10:5074680-5074702 AGGAACCAAAAGAGGGAGGCAGG - Intronic
1063345327 10:5306606-5306628 AGGACACAGGAGAAGGAGAAAGG + Intergenic
1063394946 10:5678004-5678026 AGGAAGGAGGAGAGGGAAGCTGG - Intergenic
1063667617 10:8073578-8073600 AGGAGACAGGAGAAGGTGGGAGG + Intronic
1064336616 10:14448788-14448810 AGGAAGGAGGAGAGGGAGGGAGG + Intronic
1064340990 10:14484983-14485005 AGGGAGCAGGAGAAGGCTGCAGG - Intergenic
1064484858 10:15775754-15775776 AGGCACCAGGAGCTGGAGGGGGG - Intergenic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1065173843 10:23057898-23057920 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1065175103 10:23068133-23068155 AGGAAACTGGAGAGGGCGGCAGG - Intergenic
1065487617 10:26249917-26249939 AGGAGGGCGGAGAAGGAGGCAGG + Intronic
1066478699 10:35773816-35773838 TGGAACACGGAGAAGGAGGGGGG + Intergenic
1066617870 10:37314162-37314184 AGGTACCAGGAGAAATAGGAAGG - Intronic
1067341393 10:45407907-45407929 AGGAACCAAAAGGGGGAGGCAGG + Intronic
1067557813 10:47284874-47284896 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067557819 10:47284894-47284916 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067569428 10:47360595-47360617 AGGAACCAGGAGATGGGAGGTGG - Intergenic
1068086072 10:52374935-52374957 AGGAATCTAGAGAAGCAGGCTGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1069040156 10:63687444-63687466 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1069628037 10:69880385-69880407 GGGGGCCAGGAGCAGGAGGCCGG - Intronic
1069722811 10:70560493-70560515 AGCAACCCAGTGAAGGAGGCGGG - Intronic
1069868140 10:71516751-71516773 TGGAGCCAGGATTAGGAGGCAGG + Intronic
1069963742 10:72096261-72096283 ACGGACCAGCAGAGGGAGGCGGG - Intronic
1069969981 10:72159045-72159067 AGAAATCAGGAGAAGAAGGTTGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070336619 10:75461473-75461495 AGAAAACAGCAGAAGCAGGCAGG - Intronic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070487236 10:76942776-76942798 AGAAGCCAGCAGGAGGAGGCAGG - Intronic
1070524468 10:77283334-77283356 AGGAGGAGGGAGAAGGAGGCAGG + Intronic
1070581808 10:77725959-77725981 AGGAAGCAGGAGCAGGAGATGGG - Intergenic
1070706973 10:78646888-78646910 AGGATCCATGAAAAGCAGGCAGG - Intergenic
1071435957 10:85648411-85648433 TGGAACCTGGAGAGAGAGGCTGG - Intronic
1071508433 10:86246609-86246631 AGGGACCTGGAAAAGGAGGCAGG - Intronic
1071711820 10:88057345-88057367 AGAAAACTGGAGAAGTAGGCAGG + Intergenic
1072199429 10:93145086-93145108 AGGAAACAGGAGAAGGTCCCTGG + Intergenic
1072201265 10:93161062-93161084 AGGAACCAGCAGTAGCAGACAGG - Intergenic
1072421990 10:95297010-95297032 AGGAACAGGGCAAAGGAGGCAGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073444185 10:103571132-103571154 AGGAAGCAGGAGGCGGGGGCGGG - Intronic
1073468477 10:103708336-103708358 AGGAACCAGAGGAAAGAGCCTGG - Intronic
1074015560 10:109530457-109530479 AGGAATCTGGAGAAGGAGTCTGG - Intergenic
1074147067 10:110726159-110726181 AGTCATCAGGAGCAGGAGGCTGG - Intronic
1074280795 10:112049665-112049687 AGTAAACTGGAGAAAGAGGCAGG + Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1075002927 10:118811062-118811084 CGGGACCAGGAGAATGGGGCAGG - Intergenic
1075023207 10:118966225-118966247 AGGTGCCAGGGGAGGGAGGCTGG + Intergenic
1075244532 10:120809178-120809200 GGAACCCAGGAGACGGAGGCTGG + Intergenic
1075781139 10:125017979-125018001 AGGAAACAGGACAAAGTGGCTGG - Intronic
1075974734 10:126685592-126685614 AGGGAGCAAGAGAAGGAGGGAGG - Intergenic
1075974834 10:126686052-126686074 AGGAACCAGGAGCATGAAGCTGG - Intergenic
1076188759 10:128468404-128468426 AGCCGCCATGAGAAGGAGGCAGG - Intergenic
1076243090 10:128925125-128925147 AGGAACCAGTGGAAGGCAGCTGG - Intergenic
1076777629 10:132706824-132706846 GGGGACCAGGAGAAGGAGACAGG + Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076861400 10:133139887-133139909 AGGCAGCTTGAGAAGGAGGCAGG - Intergenic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1076897906 10:133323139-133323161 AGGAAGCAGGAGAAGGATGGAGG - Intronic
1076993731 11:288803-288825 AGGACCCAGGTGGAGGCGGCCGG + Intergenic
1077392580 11:2306935-2306957 GGGAAGGAGGAGAAGGAGGAGGG + Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077869559 11:6250497-6250519 AGGAGCCAGAAGCAGGAGGCAGG + Intergenic
1078095288 11:8292662-8292684 AGGGCCCAAGAGAAGGAGGCAGG + Intergenic
1078748872 11:14141090-14141112 AGGCCCCAGGAGCTGGAGGCGGG - Intronic
1078898315 11:15617854-15617876 AGGGAATAGGAGAAAGAGGCTGG - Intergenic
1079077553 11:17393456-17393478 TGGAACCTGGAGAAGGAGAGGGG + Intronic
1079112273 11:17611521-17611543 AGGGACCAGGAGCATGGGGCAGG - Intronic
1079330793 11:19531282-19531304 ATGAACCAGAGTAAGGAGGCAGG + Intronic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079623457 11:22584271-22584293 AGGGAGCAAGAGAAAGAGGCAGG - Intergenic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1081646066 11:44791547-44791569 AGTGCCCAGGAGAAGGAGGCGGG - Intronic
1083306559 11:61764819-61764841 AGGGCCCAGGAGAGGGCGGCAGG + Intronic
1083503658 11:63134880-63134902 ATGAAGCTGGAGAGGGAGGCAGG - Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083857722 11:65401356-65401378 GGGAAGCAGGGGAGGGAGGCAGG - Intronic
1083969194 11:66062803-66062825 AGGCAACAGGATAAGGAGACAGG - Intronic
1084169838 11:67395804-67395826 AGCTACCACGAGGAGGAGGCAGG + Exonic
1084434302 11:69129860-69129882 AGGAACCAGCAGAAGCTGGCAGG + Intergenic
1084760688 11:71268764-71268786 AGGAGGGAGGAGAAGGAGGGAGG + Intergenic
1084789944 11:71468040-71468062 TGGAGCCAGGAGACGGTGGCTGG + Intronic
1084837873 11:71817306-71817328 AGGAACCAGAAGGGGGAGGCAGG - Intergenic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085019497 11:73196571-73196593 AGTAAGCAGGAGAAAGAAGCAGG - Intergenic
1085258609 11:75191445-75191467 AGGAACCAGGGACAGGAGGCAGG + Intronic
1085267604 11:75246518-75246540 AGGAACCCGGAGCCAGAGGCAGG - Intergenic
1085466018 11:76723866-76723888 AGGAACCTGGGGAAGGGGGATGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086509526 11:87542057-87542079 AGGAACCAAAAGGGGGAGGCAGG + Intergenic
1086708488 11:89980387-89980409 AGGAGGCAGGCGCAGGAGGCGGG + Intergenic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1086998895 11:93392910-93392932 AGGAGGGAGGAGAAGGAGGAGGG - Intronic
1087272195 11:96123036-96123058 AGTATCCAGGAGTAGAAGGCTGG - Intronic
1087283854 11:96243302-96243324 AGGAAGCAGAGCAAGGAGGCGGG + Intronic
1087626801 11:100604508-100604530 AGGCACCTGTAGGAGGAGGCTGG - Intergenic
1087968106 11:104444023-104444045 AACAACCAGGAAAAGGATGCAGG - Intergenic
1087994058 11:104781731-104781753 AGGAACCAAAAGGGGGAGGCAGG - Intergenic
1088766366 11:112983528-112983550 GGGAACCCAGAGAAGAAGGCTGG + Intronic
1088803640 11:113330888-113330910 AGGTACCAGGAGAATGTGCCAGG + Intronic
1088815074 11:113415218-113415240 AGTCTCCAGGAGAGGGAGGCAGG - Intronic
1088836353 11:113580801-113580823 AGGAGCCAGGAGAACTAGGAGGG + Intergenic
1089318984 11:117612418-117612440 GGGAGGCAGGAGAAGGAAGCAGG - Intronic
1089383504 11:118052741-118052763 AGGTTCCAGGAGAGGCAGGCAGG - Intergenic
1089575640 11:119440910-119440932 AAAAAACAGAAGAAGGAGGCCGG - Intergenic
1089628224 11:119765171-119765193 ACCAGGCAGGAGAAGGAGGCTGG - Intergenic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1089657400 11:119960523-119960545 AGGCAGCAGGAGAAGGTGACAGG + Intergenic
1089666141 11:120021209-120021231 GGGCACCAGGAGCAGGAGGAGGG - Intergenic
1089821721 11:121234513-121234535 AGGAACCAAAAGGGGGAGGCGGG - Intergenic
1090407396 11:126485213-126485235 AGGAACAAGGAGCAAGACGCAGG + Intronic
1090457587 11:126863258-126863280 AGCAGCCAGGAAGAGGAGGCTGG - Intronic
1091011123 11:132001572-132001594 AGGAAGCAGGAGAGAGAGGGTGG + Intronic
1091036481 11:132238306-132238328 GGGAGGCAGGAGAAGGAAGCAGG + Intronic
1091195434 11:133726895-133726917 AGGGACCAGCAGAAAGAAGCAGG - Intergenic
1091410392 12:235280-235302 AGGAGGCAGGGGCAGGAGGCAGG + Intronic
1091504369 12:1051836-1051858 AGAAAACAAGAGAAGCAGGCAGG - Intronic
1091504375 12:1051924-1051946 AGAAAACAAGAGAAGCAGGCAGG - Intronic
1091504381 12:1052012-1052034 AGAAAACAAGAGAAGCAGGCAGG - Intronic
1091536194 12:1412196-1412218 AGGAAACAGGAGAAGGAAAGTGG - Intronic
1091561637 12:1618860-1618882 AGGCACCAGGAGTTGGAAGCTGG + Intronic
1091631786 12:2167142-2167164 AGAAAGCAGAAGAAGGAAGCAGG + Intronic
1092037751 12:5353747-5353769 AGGAAGGAAGAGAAGGAGGGAGG + Intergenic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092400828 12:8176767-8176789 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1092757087 12:11773943-11773965 AGCACCCAGGAGACGGAGGAGGG - Intronic
1093508404 12:19896785-19896807 AGGAAGAAGGAGAAGGAAGGAGG - Intergenic
1094329064 12:29273009-29273031 AGGTCCCAGGAGAAGGAGCAGGG - Intronic
1094491647 12:30964359-30964381 AGGAAACGGGATAAGGAGGAGGG - Intronic
1094646419 12:32328873-32328895 TGGAAACAGGAGATGGAGGGTGG + Intronic
1094845476 12:34359594-34359616 AGGAACCAGCCCAAGGCGGCTGG - Intergenic
1094851657 12:34385009-34385031 AGGGGCCAGCACAAGGAGGCAGG - Intergenic
1094852040 12:34386676-34386698 AGGAACCAGTCGAAGGGGGCAGG - Intergenic
1095221390 12:39620322-39620344 AGGAACCACGAAAATGAGGGAGG + Intergenic
1095953442 12:47793841-47793863 AGGAACCAGGGGAGGGGCGCTGG + Intronic
1096098788 12:48956668-48956690 AGGAGGCAGGAGAAGGAGGAGGG - Intronic
1096229888 12:49890899-49890921 AGGCACCAGGTAAAGGAGGGAGG + Intronic
1096254941 12:50057265-50057287 AGGAAGCAGCAGCAAGAGGCAGG + Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096496425 12:52041854-52041876 AGGGCCCAGCAGAAGGAGCCAGG - Exonic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097826274 12:64177500-64177522 AGGAGCCTGGGGAAGGAGCCGGG + Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098119716 12:67223069-67223091 AGGAATGAGGGGAAAGAGGCGGG + Intergenic
1098395033 12:70008021-70008043 AAGAAGCAGGAAAAAGAGGCGGG - Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099015692 12:77341477-77341499 TTGAACCAGGAGACGGAGGTTGG - Intergenic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1101292099 12:103381229-103381251 AAGAACCATGAGAAGTAGGAAGG - Intronic
1101432934 12:104641751-104641773 AGCAAACATGAGAAGGAGGATGG + Intronic
1102226237 12:111230185-111230207 AGGAAGCAGGAGAGGGGGGGAGG + Intronic
1102908447 12:116694873-116694895 AGGAAGAGGGAGGAGGAGGCAGG + Intergenic
1102983908 12:117263818-117263840 GAGAACCCAGAGAAGGAGGCTGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103465317 12:121137874-121137896 AAGAGCCAGGATAAGGAGACAGG + Intronic
1103533703 12:121620310-121620332 AGGATCCTGGGGCAGGAGGCAGG + Intergenic
1103562792 12:121800859-121800881 GGGAGCCCGGAGCAGGAGGCGGG - Intronic
1103825093 12:123731674-123731696 TAGAACCAGGAAAAAGAGGCTGG - Intronic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1104842318 12:131830981-131831003 AGGAACCAGGGGCGGGAGGGAGG - Intronic
1104959535 12:132481902-132481924 GGGAACCAGATGATGGAGGCTGG + Intergenic
1105014435 12:132777501-132777523 AGGATTCTGGAGACGGAGGCTGG + Intronic
1105249483 13:18685074-18685096 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1105302770 13:19150821-19150843 AGGAAGCTGGAGAAGGAACCAGG - Intergenic
1105708373 13:22982625-22982647 AGGAGCCAGAAGAAGGGGCCAGG + Intergenic
1106112979 13:26793064-26793086 AGGAAACAGCAGAAGCAGGAGGG + Intergenic
1106295904 13:28413318-28413340 AGAAGCCAGCAGAAGGAGCCAGG - Intronic
1106345407 13:28872141-28872163 AGGCTCCTGGAGAAGGAGTCTGG + Intronic
1106438933 13:29748334-29748356 ATGAACCAGGAAAAGGAGCACGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106775130 13:33001601-33001623 AGCAACCAGGGGAAGGAGAATGG - Intergenic
1107961424 13:45562806-45562828 AGGATTCAGGAGAGGCAGGCAGG + Intronic
1108001929 13:45911703-45911725 AGAAAGCAGGAGAAGGCAGCTGG + Intergenic
1108074639 13:46667081-46667103 AGGGTCCAGCAGAAGGAGGGAGG - Intronic
1108225154 13:48281875-48281897 AGGAGCCAGGGGAAGGAGATTGG + Intergenic
1108555100 13:51584321-51584343 GGAAACCTGGAGCAGGAGGCGGG - Intergenic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1108822363 13:54368747-54368769 AGGAAGGAAGAGAAGGAGGGAGG + Intergenic
1109085567 13:57966857-57966879 AGGAACCAAAAGGGGGAGGCAGG - Intergenic
1110073731 13:71212040-71212062 AGAAATTAGGAGGAGGAGGCAGG - Intergenic
1110128764 13:71980152-71980174 AGGAACCAGCATAAGGACTCTGG + Intergenic
1110808181 13:79782554-79782576 AAGACCCAAGAGAAGGAAGCAGG + Intergenic
1111056101 13:82953034-82953056 AGGAATCTAGAGAAGGAGTCTGG - Intergenic
1111654203 13:91131988-91132010 GGGAAGCAGGAGAGGGAAGCAGG + Intergenic
1112092178 13:96092836-96092858 AGGAAACAGGAAAAGGAGCAGGG - Intronic
1112262393 13:97888856-97888878 AGGAACCAAAAGGGGGAGGCAGG + Intergenic
1112350984 13:98632823-98632845 AAGAAACAGAAAAAGGAGGCCGG - Intergenic
1112379957 13:98879258-98879280 GGGAACCAGGGGAAGCAGGGGGG + Intronic
1113216043 13:108041915-108041937 AGGAACTAAAAGCAGGAGGCAGG - Intergenic
1113401821 13:110001315-110001337 AGGAACCAGGAGAAGCCCCCAGG + Intergenic
1113792334 13:113035549-113035571 AGGCAGCAGGCGAAGGAGCCAGG - Intronic
1114200664 14:20517053-20517075 AGGATACAGGAAATGGAGGCAGG - Intergenic
1114354688 14:21894472-21894494 AGGAGCTAGGAGCAGCAGGCAGG - Intergenic
1114645830 14:24255579-24255601 TGGGATCAGGGGAAGGAGGCCGG - Intronic
1114962112 14:27905385-27905407 AGAAGGCAAGAGAAGGAGGCTGG + Intergenic
1115086072 14:29516406-29516428 TGGAACCAGGAGGCTGAGGCAGG - Intergenic
1115257084 14:31414802-31414824 AGGAACCATGAGGAAGAGCCAGG - Intronic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1116255846 14:42554274-42554296 AGGAAGGAGGAGAAGAAGGAAGG + Intergenic
1116264601 14:42671504-42671526 AGGAAGGAAGAGAGGGAGGCAGG - Intergenic
1116541979 14:46110485-46110507 AGGAGCCAGGGCCAGGAGGCAGG - Intergenic
1116855281 14:49946536-49946558 ATGAAACAGGGGAAGGACGCTGG - Intergenic
1116999317 14:51356045-51356067 TGGAACCAGGAGAAGGACGAGGG + Intergenic
1117005787 14:51419563-51419585 AGGAACCAAATGAGGGAGGCAGG + Intergenic
1117038390 14:51749254-51749276 AGAAACCTGCAGAAGCAGGCTGG + Intergenic
1117043030 14:51785313-51785335 AGCAAGTAGGAGAAGGAGGAGGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117740574 14:58815269-58815291 AGGACTCAGGAGATGGAGGCAGG - Intergenic
1118107997 14:62682459-62682481 AGGAAACAAGAGAAAGAGGTAGG + Intergenic
1118459544 14:65976007-65976029 GGGAAGCAGGAGAAGGAGGGAGG + Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119345029 14:73916170-73916192 AGGAAGGAGGAAAAGGAGTCTGG + Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119972300 14:78984851-78984873 ATGAGACTGGAGAAGGAGGCAGG + Intronic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1120554993 14:85918798-85918820 AGGATCCAGGATAATGAGACAGG - Intergenic
1120873144 14:89355911-89355933 AAGAACGGGGATAAGGAGGCAGG + Intronic
1121092377 14:91191564-91191586 GGGAACAGGGAGAATGAGGCTGG - Intronic
1121279190 14:92687392-92687414 GGGGACCGGGTGAAGGAGGCTGG - Intronic
1121443489 14:93963896-93963918 GGGAGCCAGAAGAAGGAGACAGG + Intronic
1121533847 14:94677638-94677660 AGGAGCCACGAGAGGGAGCCAGG + Intergenic
1121535385 14:94687136-94687158 AGGGAACAGGAGAAGGGGGCTGG + Intergenic
1121682572 14:95805974-95805996 AGGAAGCAGGAGAGGAAGGGAGG - Intergenic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1122027246 14:98886884-98886906 AGGAGCCAGAAGAATGGGGCAGG + Intergenic
1122096585 14:99376831-99376853 AGGAACCAAGAGCTGGAGGCTGG - Intergenic
1122099815 14:99398872-99398894 AGAAACCTCGAGGAGGAGGCTGG - Exonic
1122118339 14:99538592-99538614 GGGAACCAGCAGGGGGAGGCGGG - Intronic
1122435746 14:101695494-101695516 AGGAAAAAGGGGAGGGAGGCTGG + Intergenic
1122487433 14:102090418-102090440 AGGAAGGAAGAGGAGGAGGCTGG - Intronic
1122508914 14:102250305-102250327 AGGGACGAGGAGATGGGGGCCGG - Intronic
1122615758 14:103016558-103016580 GGGAACCAGGTGAGGGAGGGTGG + Intronic
1122976815 14:105174208-105174230 AGGCACCAAGGGAAGGAGCCTGG + Intronic
1202889555 14_KI270722v1_random:143177-143199 AGGAACCAAAAGGAGGAGGCAGG - Intergenic
1123437114 15:20262659-20262681 AGAAAACTGTAGAAGGAGGCCGG - Intergenic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124239942 15:28020440-28020462 AGGAACCTGAAGGGGGAGGCTGG - Intronic
1124693415 15:31844606-31844628 AGGAACCAGGAGACACAGGCAGG - Intronic
1124836416 15:33199720-33199742 AAGAGACAGGAGCAGGAGGCGGG + Intergenic
1124904387 15:33855151-33855173 ATCAACCAGGAGAGGGAGGGAGG + Intronic
1126853568 15:52815439-52815461 TGGAATCAGCAGAAGGAGGGTGG - Intergenic
1126894557 15:53244123-53244145 GGAAACCAGGAAAAGGAGGAAGG + Intergenic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127600675 15:60533724-60533746 AGGAATCAGGGTAAGGAGGCTGG - Intronic
1127860339 15:62988730-62988752 AGTAACCAGGAGAAAAAAGCAGG + Intergenic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1128056264 15:64702436-64702458 TGGGACCAGGAGGAAGAGGCTGG + Intronic
1128086999 15:64893558-64893580 AGGAACTCGGTGAAGGAGTCAGG + Intronic
1128146916 15:65337046-65337068 GGGAGCCAGGAGCAGGAGCCAGG - Intronic
1128237990 15:66080460-66080482 AGGAGGGAGGAGGAGGAGGCAGG - Intronic
1128255085 15:66190472-66190494 AGGAAACAGGAGGAGGGGGCAGG + Intronic
1128776027 15:70321250-70321272 AGGGACCAGGAAGGGGAGGCTGG + Intergenic
1128904042 15:71451733-71451755 AGGGACCTGGAGAAGGAGGGAGG - Intronic
1129219087 15:74121079-74121101 AGGCACCAGGAGAAGAAGCTTGG - Intronic
1129360622 15:75021703-75021725 AGGAAGTAGAAGAAGCAGGCTGG + Intergenic
1129382725 15:75178229-75178251 AGGAGACAGGAGCAGGAGACAGG + Intergenic
1129394318 15:75235881-75235903 AGGACCCAGGAGATGGGGGAAGG - Intergenic
1129744290 15:78007454-78007476 GGGATACAGGGGAAGGAGGCAGG + Intronic
1130077850 15:80705081-80705103 AGGCATCAGGTGAAGAAGGCAGG + Intronic
1130229075 15:82082618-82082640 AGGGCCCAGAAGAAGGAGCCAGG - Intergenic
1130381479 15:83375927-83375949 AGGAGCCATGAGAAGGTTGCTGG + Intergenic
1130943859 15:88535847-88535869 AGGAAGCAAGGGAAGGAGGAAGG + Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131030623 15:89183588-89183610 AGGGATCAGGACAAGGATGCTGG - Intronic
1131047053 15:89322916-89322938 AGGAAGCAGGGGCTGGAGGCAGG + Intronic
1131174076 15:90199271-90199293 AGTAACCAGGAGAAAGAGGGTGG + Intronic
1131680807 15:94721011-94721033 AGGAGCCAGGAGATGGAGAGAGG - Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132027476 15:98415655-98415677 AGGAAACAAGAGGAGGAGGGAGG + Intergenic
1132248574 15:100316552-100316574 AGGAAGCAGGAGAGAGAGACAGG - Intronic
1132966234 16:2656480-2656502 AGGCACCTGGAGAAGGATTCTGG + Intergenic
1133035769 16:3033336-3033358 GGGACTCAGGAGAAGGTGGCTGG + Intronic
1133063552 16:3190452-3190474 TGGACCCAGCACAAGGAGGCAGG + Intergenic
1133320970 16:4913697-4913719 AGAAAACAACAGAAGGAGGCTGG - Intronic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1133605645 16:7385252-7385274 GGGGCCCAGGAGAAGAAGGCAGG + Intronic
1133971911 16:10574376-10574398 AAGAACCTGGCTAAGGAGGCAGG - Intronic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134250552 16:12570956-12570978 AGGTACCAGGAGCAGGCAGCTGG - Exonic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134868693 16:17632086-17632108 AGGAACCATGAGAAGGGAGGTGG - Intergenic
1135140334 16:19915922-19915944 AGGATCCAAGAGAAGGAGGTTGG - Intergenic
1135202957 16:20454709-20454731 AGGAACCAGGAAAACGATTCTGG + Intronic
1135216143 16:20573157-20573179 AGGAACCAGGAAAACGATTCTGG - Intronic
1136144968 16:28311136-28311158 GGGAACCAGGAAAGGGATGCAGG + Intronic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136737493 16:32477109-32477131 AGGCAGCAGGAGCAAGAGGCAGG + Intergenic
1136847454 16:33588173-33588195 AGAAAACTGTAGAAGGAGGCCGG + Intergenic
1136994624 16:35181358-35181380 AGGCACCAGGTGAATGAGGATGG + Intergenic
1137384855 16:48031884-48031906 AGGCACCAGGGGCAGCAGGCGGG - Intergenic
1137655773 16:50156638-50156660 AGAAATCAGGATAATGAGGCCGG - Intronic
1137708207 16:50549263-50549285 AGGAGCCAAGAGAGGGACGCGGG - Intronic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138002710 16:53298559-53298581 AGGACCCAGGAACAGGAGCCAGG + Intronic
1138305613 16:55971840-55971862 AGGAACCAAAAGGAGGAGGCAGG + Intergenic
1138343899 16:56308422-56308444 AGAAAGCTGGAGAATGAGGCAGG + Intronic
1138564813 16:57825264-57825286 AGGGACAAAGAGAAGGAGCCTGG - Intronic
1138649363 16:58450296-58450318 AGGATGGAGGAGAAGGAGCCTGG + Intergenic
1138853271 16:60656196-60656218 AGGAAACAGGAGAGAGAGGGAGG + Intergenic
1139330319 16:66183550-66183572 AGGAGAGAGGAGAAGGAGGAAGG + Intergenic
1139374647 16:66489302-66489324 ATGAACCAAGAGATTGAGGCAGG - Intronic
1139742145 16:69044583-69044605 AGGAACCAGGAGATTGAGTGTGG + Intronic
1139907076 16:70373648-70373670 AGGAACCAGGAGATAAATGCCGG - Intergenic
1139946390 16:70645171-70645193 AGGAAGGAGGAAAAGGAGGAAGG + Intronic
1139956969 16:70697781-70697803 AGGAACCACAGGAGGGAGGCAGG + Intronic
1140079563 16:71732514-71732536 GGGAACCAGTAGAAAAAGGCAGG + Exonic
1140947777 16:79786305-79786327 AGACACCAAGAGAAGGATGCTGG + Intergenic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141463846 16:84194425-84194447 AGGGACCTGGGGAAGGAGCCAGG - Exonic
1141575841 16:84963190-84963212 AGGATACAGGAGAAGCAGGGAGG - Intergenic
1141665223 16:85462386-85462408 AGGCACCAGGAGAGGAGGGCAGG - Intergenic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141775797 16:86121877-86121899 AGGAGGCAGGAGTAGGAGGGAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141952388 16:87347310-87347332 AGGAACCCCGAGAGGGAGGAAGG + Intronic
1203015578 16_KI270728v1_random:352468-352490 AGGCAGCAGGAGCAAGAGGCAGG - Intergenic
1203033913 16_KI270728v1_random:625626-625648 AGGCAGCAGGAGCAAGAGGCAGG - Intergenic
1203109162 16_KI270728v1_random:1436828-1436850 AGAAAACTGTAGAAGGAGGCCGG + Intergenic
1142478749 17:205198-205220 AGGCAGGAGGAGGAGGAGGCAGG - Intergenic
1142638502 17:1271764-1271786 AGGATCCGGGAGAGGCAGGCAGG + Intergenic
1143135686 17:4711042-4711064 AGGAAGGAGGAGCAGGTGGCTGG + Intronic
1143249076 17:5509327-5509349 AGGAAGCAGGGGAAGGAAGAAGG - Intronic
1143473516 17:7190657-7190679 AGGGCCCAGGTGATGGAGGCAGG + Exonic
1143714162 17:8755167-8755189 GGGAACCTGGAGAAGGAGGATGG + Intronic
1143742417 17:8964450-8964472 ATGAATCAGGAGACTGAGGCTGG + Intronic
1143755640 17:9065330-9065352 GGAAACCAGGAGAGGCAGGCTGG - Intronic
1143759487 17:9090777-9090799 GGGAGCCAAGAGAAGGGGGCAGG + Intronic
1143964089 17:10743940-10743962 AGGAAGGAAGAGAAGGAGGGAGG - Intergenic
1144023927 17:11261098-11261120 AGGAACCAGAGCAAGGAGGGGGG + Intronic
1144890191 17:18489972-18489994 AGGATCCACGACAAGGAGGTGGG + Intronic
1145081121 17:19895240-19895262 AGTACCCAGGAGACTGAGGCAGG - Intergenic
1145103879 17:20098740-20098762 AGGCAGCAGGAGGAGGAGGATGG - Intronic
1145142025 17:20454346-20454368 AGGATCCACGACAAGGAGGTGGG - Intronic
1145901380 17:28492583-28492605 ATGAAGCTGGAGAAGTAGGCAGG + Intronic
1146430027 17:32784302-32784324 AGGAACCAGGAAAAGGTGTGAGG - Intronic
1146884200 17:36460002-36460024 AGGCACCAGGGGTAGGAGGGTGG + Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147257676 17:39191811-39191833 AGCAAGCAGGAGATGAAGGCAGG + Intronic
1147584503 17:41646167-41646189 AGGGACAGAGAGAAGGAGGCAGG - Intergenic
1147723020 17:42550258-42550280 GGGCACTAGGGGAAGGAGGCAGG + Exonic
1148071958 17:44913867-44913889 AGGAATGGGGAGAAGGAGCCTGG - Intronic
1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG + Intergenic
1148535072 17:48431908-48431930 GGGAAACAGTACAAGGAGGCAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148782175 17:50128665-50128687 GGGACCCAGGAGAAGGAGAAAGG + Intronic
1148790485 17:50170052-50170074 AGGGGCCAGGACTAGGAGGCAGG - Intronic
1149114907 17:53081551-53081573 ATGAAGCAGGAGAGGAAGGCAGG + Intergenic
1149422151 17:56521455-56521477 TGAAACCAGGAGAAGGGGGTGGG + Intergenic
1149639489 17:58193598-58193620 GGAATCCAGGAGAGGGAGGCAGG + Intronic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1149728822 17:58924277-58924299 AGGAACAAAGGGAAGGAGGGAGG + Intronic
1149865624 17:60149704-60149726 AGGGACCAGGAGTAGGATGGGGG + Intergenic
1149891260 17:60392146-60392168 AGGAGGCAGGGGAAGGGGGCGGG - Intronic
1150226431 17:63527082-63527104 AGGACCCAGGAAAGGCAGGCTGG - Intronic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1151316074 17:73323488-73323510 AGGAACAAGGGGAAGGAGCGTGG + Intergenic
1151557475 17:74853968-74853990 AAAAGCCTGGAGAAGGAGGCGGG - Intronic
1151690257 17:75679660-75679682 AGGAGATTGGAGAAGGAGGCTGG + Intronic
1151816226 17:76472771-76472793 AGGGACCTGGAGAAGCTGGCCGG - Exonic
1151825991 17:76524661-76524683 AGGTACGAGGAGGAGGAGGATGG - Intergenic
1151911097 17:77083842-77083864 AGGAACCAGGGCCAGGAAGCAGG - Intergenic
1152007864 17:77693871-77693893 AGGTGCCTGGAGAAGGAGGAGGG + Intergenic
1152055352 17:78021122-78021144 AGGTAGCTGAAGAAGGAGGCTGG + Intronic
1152188540 17:78874113-78874135 TGGAAGGAGGAGGAGGAGGCTGG - Intronic
1152380857 17:79941689-79941711 GGGAACACTGAGAAGGAGGCTGG - Intronic
1152630292 17:81407972-81407994 AGGAGCCAGGAGACGGAGGATGG - Intronic
1152647244 17:81475092-81475114 TGTTACCAGGAGAAGGTGGCAGG - Intergenic
1152720344 17:81920614-81920636 AGGAACTGAGAGCAGGAGGCAGG + Exonic
1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG + Intergenic
1152929278 17:83101676-83101698 CGGGACCAGGACATGGAGGCCGG + Intergenic
1152984132 18:306666-306688 AGGAACCAGAAGGAGGAGGCAGG - Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153515343 18:5895968-5895990 AGGCACGAGGGGAGGGAGGCAGG - Intergenic
1153733786 18:8043662-8043684 AGGAAGCAGGAGAGGGAAGAGGG - Intronic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1154439350 18:14373827-14373849 AGGAATAGGGAGAAAGAGGCAGG + Intergenic
1154486499 18:14875759-14875781 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1155030284 18:21978349-21978371 AGGAACCAGAAAAAGGAGGAGGG - Intergenic
1155116502 18:22773556-22773578 AGGAAGCAGGAGAGAGAGGAGGG - Intergenic
1155292713 18:24357551-24357573 AGGAACCAAAAGGGGGAGGCAGG + Intronic
1155356488 18:24958617-24958639 AGGGATCAGGAGAGGAAGGCAGG + Intergenic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155388482 18:25307551-25307573 ATGAACCAGGAAAGGAAGGCAGG - Intronic
1155591817 18:27436097-27436119 AGGAACCATGAGAATGAAGATGG - Intergenic
1155708230 18:28843007-28843029 AGGAGACAAGAGAAGGAGGTAGG + Intergenic
1155806634 18:30178348-30178370 AGGACATAGGGGAAGGAGGCAGG + Intergenic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1156398631 18:36721008-36721030 TGGGACCAAGAGAAGGAGGGAGG - Intronic
1156560383 18:38118629-38118651 AGGAAACTGGAGAAGTAAGCAGG - Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157422475 18:47558441-47558463 AGGATGCTAGAGAAGGAGGCAGG + Intergenic
1157737991 18:50067657-50067679 AGGAAGCAAGAGAAGCAGGGAGG - Intronic
1157753435 18:50197453-50197475 AGAAACCAGGAAGAGGACGCAGG - Intergenic
1158195721 18:54883053-54883075 AGACACCAGGTGAAGGAGGAAGG + Intronic
1159102264 18:63970311-63970333 AGGAACTAGGAGAATGACGGCGG + Intronic
1159877708 18:73830351-73830373 AGGAAACAGGAGAGGGAAACTGG + Intergenic
1159889113 18:73938094-73938116 AGGGAACAGGAGAAGGATGAAGG + Intergenic
1159919064 18:74211645-74211667 AGGAGCCAGGGGAAAGGGGCTGG + Intergenic
1160021799 18:75187035-75187057 AGGAGTCAGGAGGAGGAGGCAGG - Intergenic
1160724195 19:610451-610473 GGGCTCCAGGAGAGGGAGGCCGG - Intronic
1160794818 19:940447-940469 TGGAGCTGGGAGAAGGAGGCTGG + Intronic
1161327318 19:3670080-3670102 AGGAACCTGGGGCAGGCGGCAGG + Intronic
1161433235 19:4246520-4246542 AGGAGGCTGGGGAAGGAGGCTGG + Intergenic
1161799870 19:6411696-6411718 AGGAACCCGAACAAGGGGGCTGG - Intergenic
1162126888 19:8504287-8504309 AGGAACCAGGAGACAGAGACAGG + Intergenic
1163242785 19:16074708-16074730 AGGAAGCAGGAGAATGAAGCTGG + Intronic
1163459754 19:17429965-17429987 GGGAGCCAGGAGATGCAGGCAGG - Intronic
1163718557 19:18886694-18886716 AGGAAGCCGCAGATGGAGGCTGG - Intronic
1163741129 19:19013573-19013595 AGGCACAAGGGGAAGGAGGGAGG - Intronic
1163769327 19:19181113-19181135 TGGAACCCAGAGAGGGAGGCTGG + Intronic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164515558 19:28932459-28932481 TAGAACCAGGAGATGGAGGGGGG - Intergenic
1164792936 19:31003376-31003398 AGAAGCCAGAAGGAGGAGGCTGG + Intergenic
1164898455 19:31897646-31897668 AGGAACCAAGGGATGGAAGCAGG - Intergenic
1165057979 19:33190784-33190806 AGGAGACAGGAGATGGTGGCTGG + Intronic
1165157109 19:33795673-33795695 AGGAAACAGGAGGAAGAGGAAGG + Intergenic
1165405871 19:35630793-35630815 AGAAGCCAGGAGATGGAGGAAGG + Intronic
1165410145 19:35654831-35654853 AGGCATCAGCAGAAGGAGACAGG - Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1165908988 19:39212372-39212394 AGGAAGCCGGTGAAGGAAGCTGG + Intergenic
1166147833 19:40849622-40849644 AGGAATCAGGACAGGGACGCTGG + Intronic
1166151929 19:40881135-40881157 TGTTACCAGGAGATGGAGGCTGG + Intronic
1167045506 19:47046667-47046689 CGGAACCAGGAGAGGAAGGCTGG + Exonic
1167154559 19:47730192-47730214 AGGAAGCAGGGGAAGGTGCCAGG - Intronic
1167221728 19:48203819-48203841 AGGAACAAGGTTAAGGAAGCTGG - Intronic
1167270179 19:48501958-48501980 AGGAGCCAGGGGAGGGGGGCAGG - Intronic
1167570107 19:50281609-50281631 CGGCGCCAGGAGGAGGAGGCAGG + Exonic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1168058474 19:53877020-53877042 GGGATGGAGGAGAAGGAGGCTGG - Intergenic
1168298710 19:55390769-55390791 AGGAACCAGGAGAGGGCTGGAGG + Intronic
1168451676 19:56471163-56471185 TGGGAGCAGGAGAAAGAGGCAGG - Intronic
1168510196 19:56967510-56967532 AGGAGGGAGGAGAAGGAGGAAGG - Intergenic
1168630259 19:57950626-57950648 AAGAAGCATGGGAAGGAGGCCGG - Intergenic
1202664959 1_KI270708v1_random:109946-109968 AGGAACCAAAAGGAGGAGGCAGG - Intergenic
925034257 2:673775-673797 AGGAAGGAGGGGAAGGAGGAGGG + Intronic
925157148 2:1657180-1657202 AGGTCCCAGGAGGAGGTGGCAGG - Intronic
926082011 2:9994936-9994958 AAAAACCAGGGGAAGGAGGCTGG - Intronic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926689800 2:15725408-15725430 ATGAGCCAGGAGACGGAGGAAGG - Intronic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
928234198 2:29525708-29525730 TGAACCCAGGAGACGGAGGCTGG + Intronic
929802982 2:45120257-45120279 AGGAGCCAAAGGAAGGAGGCAGG + Intergenic
929842182 2:45479157-45479179 AGGCCCCAGGAGAGGGAGGGAGG - Intronic
929951126 2:46410334-46410356 AGGAAGCAGGAGATGGAGGTAGG + Intergenic
929969949 2:46565332-46565354 AGGAAGTAGGAGAAGAATGCTGG + Intronic
931065579 2:58582385-58582407 AGAAACCTGGAGATGGAGGGTGG - Intergenic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931429676 2:62197867-62197889 AAGAACCAGGAGCAGGAGTTAGG - Intronic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
932422655 2:71610806-71610828 AGGAGGCAGGAGAACCAGGCTGG + Intronic
932594622 2:73086385-73086407 GGGAAGCAGGAGAAAGAGGATGG + Intronic
933157488 2:78992141-78992163 AGGAACTAGCAGAGGGAAGCTGG - Intergenic
933840908 2:86284850-86284872 AGGAGCCAGGCGGAGGATGCTGG - Intronic
934115345 2:88785380-88785402 AGGAACCAGTGGAAGCAGGAAGG + Intergenic
934161464 2:89253458-89253480 AGGAAACAGGAGAAGCAGCTGGG + Intergenic
934205817 2:89928957-89928979 AGGAAACAGGAGAAGCAGCTGGG - Intergenic
934517616 2:94998622-94998644 AGGGCCCTGGAGAAGGAGGGTGG - Intergenic
934678547 2:96266393-96266415 AGGAACCAGCAGCGGGAGTCCGG - Exonic
934760398 2:96852526-96852548 AAAAACCTGGAGAAGGGGGCAGG + Intronic
934832191 2:97539422-97539444 AGGAACCAGTGGAAGCAGGAAGG - Intronic
935163757 2:100551659-100551681 AGGATTCAGGGGCAGGAGGCAGG - Intergenic
935922164 2:108027880-108027902 TGGAACCAGCAGCAGGAGGCTGG - Intergenic
936236786 2:110748960-110748982 AGGGACCAGGAAAAAGGGGCAGG + Intronic
937318182 2:120945231-120945253 AGCAACAAGGAGCAGGAGCCCGG - Intronic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938210830 2:129464679-129464701 AGGGACCTGGAGAAGAGGGCAGG - Intergenic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
938938890 2:136151864-136151886 AGGAAACAGAAGAACGAGGAGGG - Intergenic
939103605 2:137924544-137924566 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939354087 2:141078395-141078417 ATTAGCTAGGAGAAGGAGGCAGG - Intronic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940538551 2:154979880-154979902 AGGAAGCAGGAGAGGCAGACAGG + Intergenic
940704236 2:157083843-157083865 AGGAACCAGGAGAAGAAAAGTGG - Intergenic
940860847 2:158769281-158769303 AGGAGTCAGGAGAGGGAGGGAGG - Intergenic
940887343 2:159001148-159001170 ATGCACCAGGAAAAGGGGGCAGG - Exonic
941558744 2:167017651-167017673 AGGAACCAAGAGGTGGAAGCAGG - Intronic
941995997 2:171602528-171602550 AGGAAGTAGGAGAAGGAAGAGGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942745460 2:179226912-179226934 AGGAAGCAGGAGAAAAAGGAAGG + Intronic
943304602 2:186244396-186244418 AGGAAGCAGGGGAAGGATGATGG + Intergenic
944900344 2:204207560-204207582 AGGAAACAGCAGAAGTAGGAAGG - Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
946427723 2:219608334-219608356 GGGAAGGAGGAGAAGGAGGAGGG + Exonic
947087795 2:226475154-226475176 TGGAAGCAGGAGAAGGAAGAAGG - Intergenic
947536287 2:230942273-230942295 AGGAGGCAGAAGAAGGAGGCAGG - Intronic
947806141 2:232969496-232969518 AGGAAGCAGGGGAGGGAGGGAGG - Intronic
948087873 2:235266283-235266305 AGGAGTCAGGAGAAGCAGGTGGG + Intergenic
948091759 2:235301652-235301674 AGGAGGGAGGAGAAGGAGGGAGG - Intergenic
948142031 2:235680555-235680577 AGGCACCGAGAGCAGGAGGCTGG + Intronic
948635382 2:239331275-239331297 AAAAGCCACGAGAAGGAGGCAGG + Intronic
948797427 2:240412136-240412158 AGGATCCGGGAGAAGGTGGCTGG - Intergenic
1169198698 20:3697228-3697250 CGGAACCAGGAGAAGTTAGCAGG + Exonic
1169814781 20:9645164-9645186 GGGTACCAGGGGAAGAAGGCAGG + Intronic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1171228431 20:23460857-23460879 AGGAACCAAAAGGTGGAGGCAGG - Intergenic
1171259420 20:23718482-23718504 AGGAAACAGAAGAAGGGGACTGG + Intergenic
1171274362 20:23843023-23843045 AGGAAATAGAAGAAGGGGGCTGG + Intergenic
1171453873 20:25255571-25255593 AGGAACCAGTAGAGGGCGGCTGG + Intronic
1171725926 20:28620817-28620839 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1171752204 20:29062563-29062585 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172429320 20:34876698-34876720 AGGAAGCTGGAGCCGGAGGCCGG + Exonic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1172701147 20:36854451-36854473 AGAAACCAAGGGAAGGAGCCGGG + Intronic
1172775331 20:37403666-37403688 AGGAACCAGGAGAAGGGCTGGGG + Exonic
1172933765 20:38604190-38604212 AGGAACCAGGAGATTAAGGGAGG - Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173351964 20:42253533-42253555 GGGAACTGGGAGAAGGAGGAGGG + Intronic
1173393268 20:42654242-42654264 AGCACCCAGGAGGAGAAGGCTGG + Intronic
1173596937 20:44264541-44264563 AGGAAGCTGGAGAACGAGGGTGG + Exonic
1173861629 20:46287622-46287644 ATGAGACAGGAGAAGCAGGCAGG + Intronic
1173965976 20:47113257-47113279 AGGATCCAGGAGAAGAATGGAGG + Intronic
1174116540 20:48230289-48230311 AGTAAAGATGAGAAGGAGGCGGG - Intergenic
1174166089 20:48584517-48584539 GGGAAGCAGAAGAAGGAAGCAGG - Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174399389 20:50267767-50267789 AGGGAGCTGGAGTAGGAGGCGGG - Intergenic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174513766 20:51075579-51075601 AGGCAGCGGGAGAAGGCGGCTGG - Intergenic
1174766179 20:53255886-53255908 GGGACCCTGGAGGAGGAGGCTGG - Exonic
1174837616 20:53873150-53873172 AGGAACGGGGAGAGGGAGGGAGG + Intergenic
1175069682 20:56322726-56322748 AGGAGAAACGAGAAGGAGGCAGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175163036 20:57022812-57022834 AAGAGCCAGGAGAGGGAGACAGG - Intergenic
1175499858 20:59442086-59442108 AGGAAGGAAGAGAAGGAGGGAGG - Intergenic
1175540965 20:59747357-59747379 AGGAACCACGGAAAGGAGCCCGG + Intronic
1175653622 20:60750221-60750243 AGAAAGGAGGAGAAGGAGACAGG - Intergenic
1175867083 20:62184625-62184647 TGGAGGCAGGAGCAGGAGGCCGG - Intronic
1175871156 20:62210148-62210170 CGGATCCTGGAGCAGGAGGCAGG - Intergenic
1175996023 20:62812693-62812715 AGGAGCCAGGGGGATGAGGCAGG + Exonic
1176371213 21:6062225-6062247 AGCCACCAGGAGCAGGAGGAAGG - Intergenic
1176456333 21:6915581-6915603 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1176794799 21:13363617-13363639 ATCATACAGGAGAAGGAGGCAGG - Intergenic
1176834507 21:13780641-13780663 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1177161534 21:17553484-17553506 AGGAACCAGGAAAAGGAATATGG + Intronic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1177586519 21:23102725-23102747 TGGACCCAGGAAAAGAAGGCGGG + Intergenic
1178805382 21:35834784-35834806 GGGAGCCAGGAGAGGGTGGCGGG + Intronic
1179423369 21:41253606-41253628 AAGAAGCAGGAGGAGAAGGCAGG + Intronic
1179585030 21:42369371-42369393 AGGAAGCAGGAAAAGGTGGCGGG + Intergenic
1179752306 21:43476316-43476338 AGCCACCAGGAGCAGGAGGAAGG + Intergenic
1179898735 21:44377965-44377987 AGGTGCCTGGAGGAGGAGGCTGG + Intronic
1180988034 22:19917159-19917181 AGCCACCTGCAGAAGGAGGCTGG - Intronic
1181260176 22:21591763-21591785 AGCAGCCTGGCGAAGGAGGCAGG + Intronic
1181450962 22:23020394-23020416 ATGCATCAGGAGTAGGAGGCAGG + Intergenic
1181616909 22:24061209-24061231 AGGCACCAAGTGGAGGAGGCTGG - Intronic
1181631586 22:24154612-24154634 GGGACACAGAAGAAGGAGGCTGG - Intronic
1181845055 22:25700110-25700132 AGGCACTTGGAGAAGGAGTCTGG + Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181915874 22:26279444-26279466 AGGAAAGAAGAGAAGGAGGATGG - Intronic
1181964400 22:26646443-26646465 AGGAACCACGAGAGGCAGGGAGG + Intergenic
1182043432 22:27256133-27256155 TGGAAGCAGGAGAGTGAGGCAGG - Intergenic
1182084906 22:27554857-27554879 AGGCACCAAGAGAAGGAAGAGGG + Intergenic
1182285867 22:29246585-29246607 GAGAACCAGGAGAAGCAAGCAGG + Intronic
1182355981 22:29722408-29722430 AGGGCCCAGGAGAAGGGGACAGG - Intronic
1182364208 22:29766972-29766994 AGGACGCAGGAGGAGGAGCCCGG - Intronic
1182727900 22:32462691-32462713 AGGAACCAGAAGAACAAGGTTGG - Intronic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1182865333 22:33599449-33599471 TGGTACCAGGAGTTGGAGGCCGG + Intronic
1182931381 22:34177464-34177486 AGGAGGGAGGAGAAGGAGGGAGG - Intergenic
1182931463 22:34178272-34178294 AGGAGGGAGGAGAAGGAGGGAGG - Intergenic
1183062796 22:35346203-35346225 AGCACCCAGGAGGAGGAGGGCGG + Intronic
1183103139 22:35596271-35596293 AGGACCCAGGAGAAGGAGCCTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183301587 22:37061508-37061530 AGGAAACGTGAGGAGGAGGCCGG - Intronic
1183507001 22:38214861-38214883 GGGCACTAGGAGCAGGAGGCCGG - Exonic
1183684988 22:39356601-39356623 AGAAGCCAGGAGGAGGAGGGAGG + Intronic
1183956307 22:41382336-41382358 AGGAGCCTGGAGGACGAGGCCGG + Intronic
1184212218 22:43042844-43042866 AGGAGCCAGGAGAGGACGGCTGG + Intronic
1184233289 22:43169717-43169739 AGGAGGCAGGAGATGGAGTCTGG + Intronic
1184616149 22:45639979-45640001 AGGGGCCTGGAGCAGGAGGCGGG + Intergenic
1184645102 22:45891209-45891231 AGCTACCAGGAGAGGGAGGGCGG - Intergenic
1184686503 22:46098763-46098785 AGGGGCAAGGAGCAGGAGGCCGG - Intronic
1185004095 22:48265242-48265264 TGGACCCAGGAGGAGGAGTCTGG - Intergenic
1185184010 22:49381767-49381789 AGTTAACAGGAGAAGGAGGGCGG - Intergenic
1185237643 22:49724256-49724278 AGGAAGCCGGAAGAGGAGGCAGG + Intergenic
1185245248 22:49769850-49769872 AGGAACCAGGGGCAGCAGGTAGG - Intergenic
1185294173 22:50045281-50045303 AGGGACCAGAGGGAGGAGGCCGG - Exonic
1185356117 22:50371931-50371953 AGACAACAGGAAAAGGAGGCAGG - Intronic
1185382087 22:50514169-50514191 AGGCAGCTGGAGAGGGAGGCTGG + Intronic
949190624 3:1244549-1244571 AGGAACAAAGAGCAGGAGGACGG + Intronic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949748236 3:7320599-7320621 AGGAAACAGAAGAAGCAGGAAGG - Intronic
949984238 3:9527004-9527026 AGGAAGGAAGAGAAGGAGGGAGG + Intronic
950188525 3:10960309-10960331 AGGAACCTGGAGGATGAGGAAGG - Intergenic
950189889 3:10969420-10969442 AGATACCAGGTGAAGGAGCCAGG + Intergenic
950240672 3:11367265-11367287 AGGAGCCAGGAAGAGGAGGAGGG - Intronic
950451341 3:13067450-13067472 AGCACCCAGGACAAGCAGGCTGG + Intronic
950550899 3:13665332-13665354 AGCAACCATGTGAAGGAGGCAGG - Intergenic
950880802 3:16321356-16321378 GGAAACCAGGAGAATGAGGTGGG + Intronic
951238012 3:20257481-20257503 AGGAACCAGAAGAAGAATCCTGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952173161 3:30831812-30831834 AGGCAAGAAGAGAAGGAGGCTGG + Intronic
952266623 3:31793180-31793202 TGCCATCAGGAGAAGGAGGCAGG - Intronic
952649400 3:35707214-35707236 GGGAAGGAGGAGAAGGAGGTTGG - Intronic
952735908 3:36691369-36691391 GGGAGGCAGGAGAAGGAGGAAGG + Intergenic
952849270 3:37714285-37714307 AGGAACCCAGAGGAGGAGGAAGG - Intronic
952952047 3:38533187-38533209 AGGAGCCAGAAGTAGAAGGCAGG - Intronic
953007767 3:38994048-38994070 AGGACAGAGGAGAATGAGGCAGG - Intergenic
953151773 3:40331590-40331612 GGGACCCAGGAGGAGGAGCCTGG + Intergenic
953182294 3:40607215-40607237 AGGACCCAGCAGGAGGAGGAAGG - Intergenic
953507699 3:43502437-43502459 AGGAAGCAGGAGAAGCGGGGAGG - Intronic
953657579 3:44865743-44865765 AGGAGGCAGGAGAGTGAGGCAGG + Intronic
953878210 3:46678392-46678414 GGGAGCCAGGAGAAGGAGCAGGG + Intronic
954149170 3:48648652-48648674 GGGATCCAGGGGCAGGAGGCTGG + Intronic
954366973 3:50151415-50151437 AGGGACCTGCAGCAGGAGGCCGG + Intergenic
954367420 3:50154107-50154129 AGGAAAGAGGAGAAAGAGGAGGG + Intergenic
954408112 3:50356728-50356750 GGCTACCAGGAGAGGGAGGCAGG - Intronic
954432433 3:50477981-50478003 GGGAACTCGGAGCAGGAGGCAGG + Intronic
954508512 3:51100401-51100423 AGGAACCAAGAGATGGAACCTGG + Intronic
954951135 3:54474708-54474730 AACAAACAGAAGAAGGAGGCTGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
956514605 3:70033238-70033260 AGGAAGTAGGAGAGGGAGGTAGG - Intergenic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
956701952 3:71966490-71966512 AGGCAAGAGGAGAATGAGGCTGG + Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
957090980 3:75729785-75729807 AGGAACCAAAAGAAGGAGGCAGG + Intronic
957315806 3:78575200-78575222 AGGAAACAGCAGAAGTAGGAAGG - Intergenic
957885005 3:86275488-86275510 AAGAACTAAGAAAAGGAGGCAGG - Intergenic
958508290 3:95011439-95011461 AGGAAACAGAAGCAGGAGTCAGG + Intergenic
959520449 3:107317787-107317809 AGGCACCTGTAGAAGGTGGCTGG + Intergenic
959619771 3:108387220-108387242 AACCACCAGGACAAGGAGGCAGG - Intronic
959693195 3:109221375-109221397 AGGAAGCAGGATCAGGAGGGAGG - Intergenic
959951298 3:112183756-112183778 AGGAACCTGGGGGAGGATGCAGG - Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960399023 3:117173057-117173079 AGGAACAAGTAGAAGGAAGTTGG - Intergenic
961003394 3:123388980-123389002 AGGGACCTGGGGAAGGAGGCGGG + Intronic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
961402710 3:126658310-126658332 TGGAGCCAGCAGATGGAGGCCGG + Intergenic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
962360715 3:134740591-134740613 AGGAAAGAAGAGAAAGAGGCGGG - Intronic
962370741 3:134818978-134819000 TGGAAACAGGAGGTGGAGGCAGG + Intronic
962446077 3:135467067-135467089 AGGAACCAGGAGAAGACAGCAGG - Intergenic
962704005 3:138026176-138026198 GGGGAACAGGAGAAGGAGGGGGG - Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
963349285 3:144132987-144133009 ATGAACAAAGAAAAGGAGGCTGG - Intergenic
963453135 3:145510005-145510027 AGAAACCAGGAGAAAGAAACTGG - Intergenic
963534703 3:146513154-146513176 AGGAAGGGGGAGAAGGAGGGAGG - Intergenic
964202316 3:154131623-154131645 AGGATCCAGGAGAAGAAAGAAGG + Intronic
965733040 3:171792544-171792566 ACAAACCAGGAGAAGGAAGAGGG + Intronic
965756210 3:172029909-172029931 AGGAAGCAAGAGAAGGAAGGAGG - Intergenic
966020525 3:175203305-175203327 AGGAAGCAGCAGAAGGACCCTGG - Intronic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
966929528 3:184666862-184666884 CGGAAACCAGAGAAGGAGGCTGG + Intronic
967355886 3:188570707-188570729 AGCACACAGGAGAATGAGGCAGG - Intronic
967865139 3:194183902-194183924 ACCAAGCAGGAGAAGGAGGTGGG + Intergenic
968442801 4:633092-633114 AGGCACCACGACAAGCAGGCAGG + Intronic
968451674 4:678885-678907 AGGAACCGGGAGCAGGGGGCGGG + Intronic
968844030 4:3029809-3029831 AGGAGCATGGGGAAGGAGGCAGG - Intronic
968981747 4:3853854-3853876 AGGAGCCGTGTGAAGGAGGCAGG - Intergenic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969278323 4:6152047-6152069 AGGAAGCAGGCGAAGGAGGAAGG + Intronic
969402001 4:6961839-6961861 AGGCAGGAGGACAAGGAGGCTGG + Intronic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969667371 4:8567864-8567886 AGGAACCAAAAGATGGAGGCAGG + Intronic
969705640 4:8789720-8789742 AGGACCCAGGTGAAGCACGCAGG - Intergenic
969727482 4:8930395-8930417 AGGAACCAGGAAAAGGAACCAGG + Intergenic
969779292 4:9384808-9384830 AGGAACCAGAAGGGGGAGGCAGG - Intronic
970176075 4:13340762-13340784 AGGCACCAGGAGAAGGGGGTTGG - Intergenic
970268057 4:14311771-14311793 AGGAACCAAGAGATGGAAGCAGG + Intergenic
970421928 4:15913014-15913036 AGGAAGCAGGAGAAGGAAATTGG + Intergenic
971757091 4:30719611-30719633 AGGGCCCGGGATAAGGAGGCGGG - Intergenic
972574526 4:40339552-40339574 AGGCACCAGGAGGCTGAGGCAGG + Intronic
973177074 4:47220355-47220377 TGGAACAGGGAGAAGGAAGCAGG - Intronic
974188386 4:58469754-58469776 AGGAACCAAAAGAAGGAGGCAGG + Intergenic
974831474 4:67194718-67194740 AGGAAGGAAGAGAAGGAGGAAGG + Intergenic
974880404 4:67749678-67749700 AGGAACGAAGGAAAGGAGGCAGG - Intronic
975421126 4:74166195-74166217 TGGAAACAGTGGAAGGAGGCTGG + Intronic
975739282 4:77413076-77413098 AGGAAGGAGGACAAGGATGCTGG - Intronic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
978855884 4:113394353-113394375 AGGAAGGAGGAGAGGGAGGGAGG - Intergenic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
979497841 4:121404671-121404693 AGGAAGCAAGACAAGGAGGAGGG + Intergenic
979512959 4:121574824-121574846 AGGAAGCAGGGGATGGAGGTGGG + Intergenic
980069538 4:128228914-128228936 GGGAAACAGGAGATGGGGGCAGG - Intergenic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
980773492 4:137409384-137409406 AGGAACCAGGAGAGGGAGGGAGG + Intergenic
982068890 4:151677931-151677953 AGGAAGAAGGAGGAGGAGGGAGG - Intronic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
982593621 4:157349440-157349462 AGGAAGCGGGGGAAGGAGGGAGG - Intronic
982786160 4:159539307-159539329 AGTAACCTGGAAAAGGTGGCTGG - Intergenic
983169572 4:164520752-164520774 AGGAATCTAGAGAAGGAGTCTGG + Intergenic
983525146 4:168753333-168753355 AGGAAGCAGGGGAAGGAGGGAGG - Intronic
983672455 4:170254171-170254193 AGAAAGGAGGAGAAAGAGGCTGG + Intergenic
984181055 4:176482558-176482580 AGAAAGCAAGGGAAGGAGGCTGG + Intergenic
984447333 4:179853459-179853481 AGGAACCATGAAAAAGAGGAGGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984850123 4:184145304-184145326 AGGAAGAAAGAAAAGGAGGCAGG - Intronic
985434625 4:189916978-189917000 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
985679913 5:1250464-1250486 AGGTTCCAGGAGAAGGACGTGGG + Intergenic
985747642 5:1656114-1656136 AGGAGGCAGGAGAAGGCGGCCGG + Intergenic
985774115 5:1831780-1831802 AGGAGCCGGGGGAAGGGGGCTGG - Intergenic
986016742 5:3764037-3764059 AGGAGTCAGGAGAAGGCGGGAGG + Intergenic
986716925 5:10531540-10531562 AGAAACCAGGATAGGGAGGTTGG - Intergenic
986853996 5:11847476-11847498 GGGAAGGAGGAGGAGGAGGCAGG + Intronic
986970043 5:13322766-13322788 AGGACCTAGGTGAAGGGGGCTGG - Intergenic
987062366 5:14254641-14254663 AAGAAACAGGAGGAGGAGGGTGG - Intronic
987157859 5:15109159-15109181 AGGAACCAAAAGGGGGAGGCAGG - Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988021471 5:25627360-25627382 AGGAATCTAGAGAAGCAGGCTGG - Intergenic
988022488 5:25639335-25639357 AGGAAGTAGGAGAGGGAGGGAGG - Intergenic
989756214 5:44958755-44958777 AGGAAGGAGGAGAAGGAAGAAGG - Intergenic
990365012 5:55061671-55061693 AGGAGCTATGAGGAGGAGGCTGG + Intergenic
990385138 5:55253036-55253058 AGTCACTAGGAAAAGGAGGCGGG - Intergenic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991272138 5:64796764-64796786 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991272151 5:64796808-64796830 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991529012 5:67594988-67595010 AGGAATTAGGAGGAAGAGGCAGG + Intergenic
991997710 5:72404458-72404480 AGGCACCATGAGAAGGAGGAAGG + Intergenic
992321276 5:75615429-75615451 AGGAACGAAGAGAAGGATCCAGG + Intronic
992495239 5:77286377-77286399 AGGAACCAGAAGATGGAGCCTGG - Intronic
992654539 5:78895525-78895547 AGGTATCAGGTGAAGAAGGCAGG - Intronic
992829994 5:80584785-80584807 AGAGACTTGGAGAAGGAGGCAGG - Intergenic
993217982 5:85049595-85049617 AGGAACCAGCAGAAGAATTCTGG + Intergenic
994810273 5:104508590-104508612 AGGGACAAAGAGAAGGAGGGAGG + Intergenic
996035325 5:118752228-118752250 AGGAACTGGGACAAGGAGGTTGG - Intergenic
996242542 5:121221349-121221371 AGGAACCTAGAGAAGCAGTCTGG - Intergenic
996245764 5:121262673-121262695 AGGAACCAGTACAAGAACGCTGG - Intergenic
996441923 5:123500983-123501005 AGGGAACAGAAGAAGGAAGCTGG + Intergenic
996778562 5:127159515-127159537 AGGCACCTGGAGGAGGTGGCTGG + Intergenic
997402337 5:133612413-133612435 AGAAACCAGCCGAAGGACGCGGG - Exonic
997579049 5:135005839-135005861 TGGCCCCAGGAGGAGGAGGCAGG - Intronic
998813231 5:145986937-145986959 AGGGACCAGGAGATAAAGGCTGG + Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999001985 5:147934062-147934084 AGGAATCAGGAAAAGGGGGATGG - Intergenic
999261054 5:150239192-150239214 TGGAACCAGAAGAGGGAGGTGGG + Intronic
999297425 5:150468458-150468480 AGAAACCAAGGGAAGGAGGCAGG + Intergenic
999334426 5:150703355-150703377 AGGAACCAAAAGCGGGAGGCAGG - Intergenic
999334521 5:150704229-150704251 AGGAACCAAAAGCAGGAGGCAGG + Intergenic
1000132197 5:158310256-158310278 AGGAAGCAAGAAAAGGAGGGAGG - Intergenic
1000432666 5:161168532-161168554 AGGAGCCAGGAGTACAAGGCAGG - Intergenic
1000660537 5:163933221-163933243 AGGAATCAAGAGAAGCAGTCTGG - Intergenic
1001023986 5:168207627-168207649 AGCAACCAGCAGAGGGAGGGAGG + Intronic
1001055002 5:168441951-168441973 AGGAAGTAGGAGAAGAAGACAGG + Intronic
1001095197 5:168770698-168770720 AGAAACAGGGAGAAGGAGCCAGG - Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001209494 5:169796757-169796779 AGGAGTCAGGAGAAGATGGCTGG + Intronic
1001274880 5:170343336-170343358 AGAAAAGAGGAGAGGGAGGCTGG - Intergenic
1001401005 5:171446389-171446411 AGGCCCCAGTAGAAAGAGGCAGG + Intronic
1001511080 5:172322409-172322431 AGGAAGGAGGAAAAGGAGGGAGG - Intergenic
1001763297 5:174225078-174225100 ACGAGCCAGGAGGAGGAGTCTGG - Intronic
1001865199 5:175097851-175097873 AGGAACAAGGAGCAGGAGATGGG - Intergenic
1001922189 5:175609451-175609473 AGGATGCAGGATAAGGAGACAGG - Intergenic
1001956409 5:175850933-175850955 AGGAACCAGAGGCAGGAGGGAGG + Intronic
1002000964 5:176196034-176196056 AGGATGCAGGAGAAAGAGGAGGG - Intergenic
1002078830 5:176725925-176725947 GGGCACCAGGAGCAGGCGGCTGG + Intergenic
1002118228 5:176981706-176981728 TGGGACCAGGAGAAGGAAGGTGG + Intronic
1002253370 5:177942938-177942960 AGGATGCAGGAGAAAGAGGAGGG + Intergenic
1002422219 5:179154615-179154637 AGGAACCAATTGAAGGAGGAAGG - Intronic
1003024672 6:2543538-2543560 AGGAACTTGGAGCAGGAGCCTGG - Intergenic
1003091985 6:3112081-3112103 AGGAACCAGTAGAAGGAGAGAGG + Intronic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003528715 6:6920072-6920094 AGGAAGCTGAAGAAAGAGGCGGG - Intergenic
1003695278 6:8399798-8399820 AGGAACTAGGAGATGGGGGAGGG + Intergenic
1003720877 6:8700898-8700920 AGAGACCAGGAAAAGGAGACTGG - Intergenic
1004016474 6:11736588-11736610 AGGAAGCAGGGACAGGAGGCTGG - Intronic
1004132488 6:12933835-12933857 AGGAGCTAAGAGAAGGAGGGTGG + Intronic
1004310083 6:14537711-14537733 TGGAACCTGGAGGAGGAGCCAGG - Intergenic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1004564368 6:16781728-16781750 AGGACCCAGGCGTAGGTGGCTGG - Intergenic
1005306244 6:24516984-24517006 AGAAACCATGAGAAGCAGGAGGG + Intronic
1005536444 6:26760729-26760751 AGGTCCCAGGAAAAGGAGGGAGG + Intergenic
1005993791 6:30919903-30919925 GGGAACCAGGAGGAAGAGGAAGG + Intronic
1006094722 6:31648858-31648880 GGGATCTGGGAGAAGGAGGCTGG - Intronic
1006509557 6:34514778-34514800 AGAAACGAGCAGAAGGAGGTGGG + Intronic
1007357735 6:41333412-41333434 AGGAACCCAGAGAAGGAGCTGGG - Intergenic
1007649128 6:43406833-43406855 AGCTACCAGGAGACTGAGGCAGG + Intergenic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1008584565 6:52937048-52937070 AGTAACCAAGTGGAGGAGGCAGG - Intergenic
1008863194 6:56176658-56176680 AGGAAGGAAGAGAAGGAGGGAGG + Intronic
1009998988 6:70928753-70928775 AGGTACCAGGAGGAGCTGGCAGG + Intronic
1011175051 6:84551045-84551067 AAGAACCAGGAGACTGAGACTGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1013152907 6:107463291-107463313 AGGAAACAGGTGGAGGAGACAGG + Intergenic
1014294198 6:119598401-119598423 AGGCACAAGGAGAAGGAGAAGGG + Intergenic
1015156533 6:130102593-130102615 ATGAACCGGGAGAAGCAGGCAGG - Intronic
1016050972 6:139529831-139529853 AAGAACCAGTAGAAGGAGATTGG + Intergenic
1016093374 6:140006413-140006435 ATGATACAGGACAAGGAGGCAGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1018380456 6:163253997-163254019 AGGATCCAGGAGAAAGGGACGGG + Intronic
1018625669 6:165776661-165776683 AGGAACGAAGAGAAGGAGAGAGG - Intronic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018890066 6:167976858-167976880 AAGACCCAGGGGCAGGAGGCCGG - Intergenic
1019018200 6:168895990-168896012 AGGAAGCAGGAAAAAGAGACAGG - Intergenic
1019070851 6:169343550-169343572 AGGAACCAAAAAGAGGAGGCAGG - Intergenic
1019093860 6:169563226-169563248 AGGAAAGAGGTGGAGGAGGCTGG - Intronic
1019104381 6:169656648-169656670 AGGGCCCAGGAGGAGGAGGCTGG + Intronic
1019457331 7:1137247-1137269 AGGAAGCAGGAGGAGGAGTGAGG - Intronic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1019517584 7:1446611-1446633 AGGAGCGGGGAGGAGGAGGCCGG + Intronic
1019603345 7:1896126-1896148 GGGCCCCAGGAGGAGGAGGCAGG - Intronic
1019767771 7:2864054-2864076 AGAAGCCAGGAGAAAGAGGAAGG - Intergenic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1020004327 7:4774322-4774344 AGGAAGGAGGAGGAGGAGGGAGG - Intronic
1020748672 7:12111801-12111823 AGGGATCAGAAGCAGGAGGCAGG - Intergenic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1022480544 7:30740593-30740615 AGGAAGCAGCAGGCGGAGGCTGG - Intronic
1022806685 7:33829572-33829594 AGGAAAAAGGAGAAGGAAACAGG - Intergenic
1022992934 7:35726283-35726305 AAGAACCAAGAGGAGGAGGTTGG + Intergenic
1023258315 7:38334273-38334295 AGGAAGTAAGAGAAGGAGGGAGG + Intergenic
1023333960 7:39149028-39149050 AAGATCCAGGAGAGGGAGGGAGG + Intronic
1023693434 7:42818642-42818664 AGGAAGAAGGAGAAGGAAGGAGG + Intergenic
1023712193 7:43006684-43006706 AGGAACCAAAAGGTGGAGGCAGG + Intergenic
1023991692 7:45132556-45132578 AGGAAGGAGGAGAGGGAGGGAGG + Intergenic
1024033375 7:45484112-45484134 AGGAAAGAGGAAAAGGAGGCAGG + Intergenic
1024263170 7:47587042-47587064 AGGGAACAGGAGAGGGAGCCTGG + Intergenic
1024356826 7:48422113-48422135 AGGAAGGAAGAGAAGGAAGCAGG + Intronic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026015389 7:66667459-66667481 AGGGACCAGGTGAGGGAGGAGGG - Intronic
1026154191 7:67812910-67812932 AGAAGCTAGGAGCAGGAGGCTGG - Intergenic
1026284404 7:68950568-68950590 AGGGATCAGGAGAAGGACTCTGG - Intergenic
1026600522 7:71773759-71773781 GAGAACCAGGGGAAGGAGGATGG + Intergenic
1026891801 7:73986611-73986633 AGGGACCAGGTGAGGGAGGAGGG - Intergenic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027144901 7:75687798-75687820 AGGCACCATGGAAAGGAGGCTGG - Intronic
1027173557 7:75889300-75889322 AGGAACCAGGAGTGAGGGGCGGG + Intergenic
1027568381 7:79829088-79829110 AGGATACAGGAGAATTAGGCTGG - Intergenic
1027683113 7:81245213-81245235 AGGAAGGAGGAGAAGGAAGAAGG + Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027971703 7:85091180-85091202 AGGAAGGAAGAGAAGGAGGGAGG + Intronic
1028261366 7:88670328-88670350 AGGAAGAAGGAAAAGGAGCCTGG - Intergenic
1028382275 7:90212251-90212273 AGGAACCAAGAGGAGGAGGAGGG - Intronic
1028429930 7:90735519-90735541 AGGAATCTAGAGAAGGAGTCTGG + Intronic
1028516900 7:91687856-91687878 AGGAAAGAAGAGAAGGAGGGAGG - Intergenic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030065158 7:105653758-105653780 AGGCTACAGGAGAAGGTGGCTGG - Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031078615 7:117237642-117237664 AGGAACCAGGAGAAGAACAGTGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031927153 7:127649903-127649925 AGGATCCAGGAGAAGGCAGAGGG + Intergenic
1031967525 7:128037764-128037786 ATGAGCCAAGAGAAGGGGGCAGG + Intronic
1032059230 7:128709995-128710017 TGAACCCAGGAGATGGAGGCGGG - Intronic
1032069515 7:128795139-128795161 AGGAACCAGAAAAAGGAATCCGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032253765 7:130280780-130280802 AAGAGCTAGGAGAAGCAGGCTGG - Intronic
1032345308 7:131110720-131110742 AGGAACTTGGGGAAGGAGGATGG - Intronic
1032423735 7:131803528-131803550 AGACCCCAGGAGAAGGAGGAGGG + Intergenic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032494721 7:132352407-132352429 TGGAAGCAGGAGGGGGAGGCTGG - Intronic
1033273447 7:139953390-139953412 ATGAGCCAGGAGAAGGTCGCAGG - Exonic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1034489563 7:151386095-151386117 AGGAACCAGGAGTCAGAAGCGGG + Intronic
1034726414 7:153340235-153340257 AGCATCCCGGTGAAGGAGGCGGG + Intergenic
1034859339 7:154582536-154582558 AGGAAACAGGAGGAGGAGGAAGG - Intronic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035105254 7:156436668-156436690 AGGAGCTGGGAGAACGAGGCGGG - Intergenic
1035301587 7:157901105-157901127 AGGAAGCAGGAGAGGGCGGAGGG + Intronic
1035315415 7:157994605-157994627 AGGAACCAGGAGTTGTAAGCTGG - Intronic
1035315468 7:157994970-157994992 AGGAACCAGGAGTTGTAAGCTGG - Intronic
1035323070 7:158046669-158046691 AGGAACCAGGAGAGGATGCCGGG + Intronic
1035611787 8:971435-971457 AGCAACCAGCAGATGGATGCAGG + Intergenic
1035643374 8:1200280-1200302 AGGACCCCGGAGCAAGAGGCTGG - Intergenic
1036152014 8:6307767-6307789 AGGGAGCAGGACACGGAGGCCGG + Intergenic
1036164300 8:6418173-6418195 AGAGACCAGGGGAAGGAGACTGG - Intronic
1036222750 8:6934391-6934413 AGAGCCCAGGAGAAGGAAGCAGG - Intergenic
1036234467 8:7026330-7026352 AGCACCCAGGAGAAGGAAGCAGG - Intergenic
1036276728 8:7358770-7358792 AGGAACCAGAAGGGGGAGGCAGG - Intronic
1036344605 8:7951575-7951597 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1036619054 8:10410987-10411009 AGGAAAGACGAGAAGGAGGGAGG - Intronic
1036754312 8:11462197-11462219 AGGAATCAGGAGCAGGAGAAAGG + Intronic
1036809468 8:11857705-11857727 GGGAACCATGAAAAGGAGGGCGG - Intronic
1036839946 8:12112342-12112364 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1036861737 8:12358581-12358603 AGGAACCAGAAGGGGGAGGCAGG + Intergenic
1037017356 8:13925179-13925201 AGGAACCAAAAGGTGGAGGCAGG + Intergenic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1037731317 8:21526112-21526134 AGGATCCAGGGGCTGGAGGCTGG + Intergenic
1037766906 8:21777759-21777781 AGGGACCTGGATAAGGAGTCGGG + Intronic
1037876491 8:22551420-22551442 CGGAGCCAGGACAAGGGGGCAGG - Intronic
1037918608 8:22788102-22788124 GAGAACCAGGAGCAGCAGGCAGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038525025 8:28265560-28265582 GGGAACCAGGAGAACTAGACTGG + Intergenic
1038565188 8:28614075-28614097 AGGGATCAGGAGACCGAGGCAGG - Intronic
1039118236 8:34116255-34116277 TGGCACCATGAGAAGGAGGAAGG + Intergenic
1039615175 8:38950010-38950032 AGGAACCAGGAACATGAAGCTGG - Intronic
1039755337 8:40516730-40516752 AGGAACCAAAAGGGGGAGGCAGG + Intergenic
1039886285 8:41655933-41655955 AGGGAGCAAGAGAAGGAGGGCGG - Intronic
1039957139 8:42216317-42216339 AGACTCCAGGAGCAGGAGGCAGG + Intergenic
1040548728 8:48422317-48422339 TGGAGCCAGGAGGAGGAGGAGGG + Intergenic
1040857727 8:51967446-51967468 AGGAAACTGGAGAAAGAGGAAGG + Intergenic
1041243854 8:55872622-55872644 TGGAAGCAGGAGTAGGAGGTTGG - Intergenic
1041291165 8:56310117-56310139 AGGAAGGAGGAGGAGGAGGGAGG + Intronic
1041291176 8:56310149-56310171 AGGAAGGAGGAGGAGGAGGGAGG + Intronic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041758525 8:61339202-61339224 AGGAAACAGGAGAAGCATGGTGG + Intronic
1042107924 8:65348588-65348610 GGGCAGCAGGAGCAGGAGGCAGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042498025 8:69477625-69477647 TGGAGCCAGGAAAAAGAGGCAGG + Intronic
1043121672 8:76332989-76333011 AGTAACCAGAGGAAGGAGGACGG + Intergenic
1043610433 8:82055817-82055839 AGGAAAGTAGAGAAGGAGGCAGG + Intergenic
1044319705 8:90788952-90788974 AAAAACCACGAGAAGGAGGGGGG - Intronic
1045455665 8:102376448-102376470 AGGAAACAGAAGAGGGAGGGAGG + Intronic
1045913159 8:107434303-107434325 ATGAAACAGGAAAAGGAGTCTGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046111290 8:109729151-109729173 AGGACCTAGGTGAAGGAAGCAGG + Intergenic
1047248814 8:123166517-123166539 AGGACCCAGAAGAAGAAGGAAGG + Intergenic
1048026049 8:130587846-130587868 AGGATGCAGGAGAAGCAGACAGG + Intergenic
1048317294 8:133371606-133371628 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1048763499 8:137822495-137822517 AGGAACCAAAAGAATGTGGCAGG + Intergenic
1048895112 8:138985207-138985229 AGGAACTAGAAAAAGCAGGCAGG + Intergenic
1048898210 8:139013691-139013713 AGGAGCCTGGGGAAGGAGCCAGG + Intergenic
1049286435 8:141777954-141777976 TGGAACCAGGAGGAGGAGGCTGG + Intergenic
1049356804 8:142193077-142193099 AGGAAAAAGGAGCAGGAGGGAGG + Intergenic
1049758077 8:144319638-144319660 AGGAAGCAGAAGAGGCAGGCGGG - Intronic
1050173979 9:2851134-2851156 AGGAACCAGGGGAAAGAAGCAGG - Intergenic
1050353719 9:4763539-4763561 AGGAAAAAGGGGGAGGAGGCAGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051261963 9:15273473-15273495 AGGAACGCGGAGGAGGAGGGAGG - Intronic
1051632279 9:19151376-19151398 AGGAGCCAGGAGAGGCTGGCAGG + Intergenic
1051653462 9:19353822-19353844 AGCAACCAGGAGGCTGAGGCAGG + Intronic
1051896025 9:21989982-21990004 AGGATCCAGGAGGAGGATGGTGG + Intronic
1052379026 9:27750107-27750129 ATGTACCAGGAGAAGGAAACTGG - Intergenic
1053144865 9:35705506-35705528 AGGAACAAGGGGCAGGGGGCAGG + Intronic
1053350722 9:37411768-37411790 AGGAGCAAGGGGATGGAGGCAGG - Intergenic
1053723685 9:40975051-40975073 AGGAACTAGGTGAAGAAGGGAGG + Intergenic
1053887427 9:42654574-42654596 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1054226449 9:62462025-62462047 ATCATACAGGAGAAGGAGGCAGG + Intergenic
1054342275 9:63876948-63876970 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1055122585 9:72679382-72679404 AGGAAACAGAAGAAGGTGGATGG - Intronic
1055212762 9:73817170-73817192 AGGAAAAAGGAGAAAAAGGCGGG + Intergenic
1055856525 9:80694541-80694563 AGGAGACAGGAGTAGGAGGAAGG + Intergenic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1056554776 9:87679277-87679299 AGCAACCAGGAGGAGATGGCAGG + Intronic
1056662340 9:88553464-88553486 AGAGACAAGGAGAAGGAGGGTGG - Intronic
1056850887 9:90082621-90082643 GGGAACCAGGAGGCAGAGGCAGG + Intergenic
1056860230 9:90174478-90174500 AGGAAGTAGGAGGTGGAGGCCGG - Intergenic
1057455504 9:95206167-95206189 AGGAGGCGGGAGAAGGAGGAAGG + Intronic
1057750660 9:97790190-97790212 AGGAACAAGGAGAGCGAAGCAGG + Intergenic
1057852031 9:98573180-98573202 GGGAACCAGGAGATGAAGGAAGG + Intronic
1057911581 9:99023906-99023928 AGTAGCCTGGAGAGGGAGGCAGG - Intronic
1057997652 9:99833983-99834005 AGGAACCAGGTGACACAGGCAGG - Intronic
1058727885 9:107820678-107820700 AGGAGGTAGGAGAGGGAGGCAGG + Intergenic
1058849290 9:108994938-108994960 AACAACCATGAGAGGGAGGCTGG + Intronic
1058915118 9:109558081-109558103 AGGCACTAGGGCAAGGAGGCTGG - Intergenic
1058939923 9:109803656-109803678 GGGAACCAGCTGCAGGAGGCAGG + Intronic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072458 9:111152943-111152965 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059350635 9:113662460-113662482 GGGGGGCAGGAGAAGGAGGCAGG - Intergenic
1059657350 9:116368683-116368705 AGAAACCGAAAGAAGGAGGCCGG + Intronic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059983643 9:119800288-119800310 AGGAACCATGACAAGAAAGCTGG - Intergenic
1060035224 9:120249743-120249765 AGGAACCAAGACTAGAAGGCAGG + Intergenic
1060200404 9:121649044-121649066 AGGAAGAAGGAAAAGGAGCCTGG + Intronic
1060477843 9:123999341-123999363 AGGAAGCCGGAGAGGGAGGGAGG + Intergenic
1060670688 9:125466751-125466773 GGGACCCAGGGGAAGGAGGAAGG - Intronic
1061057459 9:128232171-128232193 AGGAGCAGGGAGAAGGAGGGAGG - Intronic
1061205762 9:129162363-129162385 AGGGACCAGGAGAAGGTGGCAGG + Intergenic
1061242443 9:129382496-129382518 AGGCACCAGGAGAAGCAGGGAGG - Intergenic
1061559455 9:131393757-131393779 AGGAGCCAAGAGAAGGGGCCTGG - Intergenic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1062008259 9:134252615-134252637 GGGAACCAGGACAAGTGGGCAGG + Intergenic
1062287526 9:135779645-135779667 TGGAACCAGGAGATGGAGGCAGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062715891 9:138009895-138009917 AGGTGCCAAGGGAAGGAGGCTGG + Intronic
1203786659 EBV:132130-132152 CGGAACCAGGAGAAGGGGTCTGG + Intergenic
1203451474 Un_GL000219v1:120947-120969 AGGAACTAGGTGAAGAAGGGAGG - Intergenic
1203486677 Un_GL000224v1:62580-62602 AGGAACCAAAAGGAGGAGGCAGG - Intergenic
1203499299 Un_KI270741v1:4480-4502 AGGAACCAAAAGGAGGAGGCAGG - Intergenic
1185722890 X:2396047-2396069 AGGAACTAGGAGAGGCAGGGAGG - Intronic
1185775485 X:2799743-2799765 AGGAACCAAAAGGGGGAGGCAGG + Intronic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186788059 X:12971761-12971783 TGGAACCCGGAAAAGGTGGCAGG - Intergenic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025757 X:15433978-15434000 AGAAAGCAGGAGGAGGAGGAAGG + Intronic
1187277440 X:17828321-17828343 AGGAATCAGGAGAGAGAGGGAGG - Intronic
1187289591 X:17940310-17940332 ATGAGCCTGGAGAGGGAGGCAGG + Intergenic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1187529713 X:20085252-20085274 AGGAAAGAGGAGAAGAAGGATGG + Intronic
1187969818 X:24647917-24647939 GGCAGCCAGGAGTAGGAGGCAGG - Intronic
1189110815 X:38286810-38286832 AGAAACCAAGAGATGGAGGAGGG - Exonic
1189551618 X:42099407-42099429 AGAAAGGAGGAGGAGGAGGCTGG - Intergenic
1189729579 X:44004864-44004886 AGAAACCAGGAAATGAAGGCAGG - Intergenic
1190178424 X:48170603-48170625 AGGAACCAGGAGTGAGAGCCAGG - Intergenic
1190179747 X:48182148-48182170 AGGAACCAGGAGTGAGAGTCAGG + Intergenic
1190184813 X:48224316-48224338 AGGAACCAGGAGTGAGAGCCAGG - Intronic
1190192759 X:48291361-48291383 AGGAACCAGGAGTGAGAGTCAGG + Intergenic
1190197385 X:48331177-48331199 AGGAACCAGGAGTGAGAGCCAGG - Intergenic
1190341962 X:49303987-49304009 AGGGGCCAGGACAAGGAGGAAGG + Intronic
1190344078 X:49321887-49321909 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190345172 X:49331432-49331454 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190346266 X:49340998-49341020 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190347518 X:49532027-49532049 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190348619 X:49541583-49541605 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190349720 X:49551139-49551161 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190350824 X:49560692-49560714 AGGAAACAGCAGAGGGAGGTGGG + Intronic
1190351925 X:49570250-49570272 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190353026 X:49579799-49579821 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190354127 X:49589346-49589368 AGGAAACAGCAGAGGGAGGTGGG + Intergenic
1190355229 X:49598870-49598892 AGGAAACAGCAGAGGGAGGTGGG + Intronic
1190446136 X:50526256-50526278 AGGAAACACGGGAAGGAGGAAGG + Intergenic
1190480787 X:50874758-50874780 AGGATGCAGAAGAGGGAGGCAGG + Intergenic
1190659278 X:52639843-52639865 AGGAACCAGGAGTGAGAGTCAGG + Intergenic
1190664126 X:52681587-52681609 AGGAACCAGGAGTGAGAGCCAGG - Intronic
1190669518 X:52727392-52727414 AGGAACCAGGAGTGAGAGTCAGG - Intergenic
1190669899 X:52731012-52731034 AGGAACCAGGAGTGAGAGTCAGG + Intergenic
1190675296 X:52776835-52776857 AGGAACCAGGAGTGAGAGCCAGG + Intronic
1190677455 X:52794428-52794450 AGGAACCAGGAGTGAGAGTCAGG - Intergenic
1190955890 X:55193044-55193066 AGGAACCAAAAGTGGGAGGCAGG + Intronic
1191107964 X:56783955-56783977 AGAATCCAGAAGAAGGAGGGAGG - Intergenic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192369089 X:70498655-70498677 AGGGACCTGGAGGAGGAGGAAGG + Intronic
1192703149 X:73497745-73497767 AGGAATCAGGAGAGGCAGTCTGG + Intergenic
1193640022 X:84001468-84001490 AGGAACCAAATGATGGAGGCAGG - Intergenic
1193675300 X:84444443-84444465 TGGAACCAGGGTAAGGAGGTAGG + Intronic
1194161233 X:90454778-90454800 AGGAACCAAAAGAGGTAGGCAGG + Intergenic
1194294450 X:92110774-92110796 AGGAACCAAAAGGGGGAGGCAGG + Intronic
1194695216 X:97039688-97039710 AGAAAGCAGGAGAAGCTGGCTGG - Intronic
1194927009 X:99837018-99837040 AGGAAGCAGCAGAAGGACCCTGG - Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195018245 X:100799488-100799510 AGGAACCAAAAGGGGGAGGCAGG - Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195334042 X:103832074-103832096 AGGAAACAGGAGAGGGCCGCGGG + Exonic
1195982251 X:110591594-110591616 AGGAACCAAAAGTGGGAGGCAGG + Intergenic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1197360523 X:125497098-125497120 AGGTAACAGGAAAAGGAGACTGG - Intergenic
1197424065 X:126273268-126273290 TGCAACCAGCAGCAGGAGGCTGG - Intergenic
1197645061 X:129008436-129008458 AGTTACCAGGGGAAGGAGGTTGG + Intergenic
1197888341 X:131241021-131241043 AGGAACCTGGAGAAGGAATGTGG - Intergenic
1198399475 X:136255102-136255124 AGGTACTAGGAGGCGGAGGCAGG + Intronic
1198614751 X:138444586-138444608 AGGAAACAGGAGTAGGCAGCAGG + Intergenic
1198645615 X:138802680-138802702 AGCAACTAGGAAAAGGAGGCAGG - Intronic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1200090295 X:153632850-153632872 AGGTGCCAGGAGAAGGGAGCAGG + Intergenic
1200166336 X:154038216-154038238 AGGACCCAAGGGAGGGAGGCTGG + Intronic
1200185085 X:154177117-154177139 AGGAGCTAGGAGAGGGAGGTGGG + Intergenic
1200190738 X:154214255-154214277 AGGAGCTAGGAGAGGGAGGTGGG + Intergenic
1200196489 X:154252057-154252079 AGGAGCTAGGAGAGGGAGGTGGG + Intergenic
1200202144 X:154289175-154289197 AGGAGCTAGGAGAGGGAGGTGGG + Intronic
1200229104 X:154435257-154435279 ATGAACCTGGGGAAGGTGGCAGG - Exonic
1200337447 X:155365151-155365173 AGGAACTTGCAGAAGAAGGCAGG + Intergenic
1200349023 X:155476076-155476098 AGGAACTTGCAGAAGAAGGCAGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200507521 Y:4031712-4031734 AGGAACCAAAAGAGGTAGGCAGG + Intergenic
1200611954 Y:5335293-5335315 AGGAACCAAAAGGGGGAGGCAGG + Intronic
1200844958 Y:7822633-7822655 TGGAGCCAGGAGGAGCAGGCTGG - Intergenic
1201294429 Y:12451613-12451635 AGGAACCAAAAGGGGGAGGCAGG - Intergenic