ID: 998882287

View in Genome Browser
Species Human (GRCh38)
Location 5:146656186-146656208
Sequence AGAGGTATGCTCTTTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998882283_998882287 5 Left 998882283 5:146656158-146656180 CCTGAGTTGGGTAAGGGGCTAGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 998882287 5:146656186-146656208 AGAGGTATGCTCTTTGAGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998882287 Original CRISPR AGAGGTATGCTCTTTGAGGT GGG Intronic
901640018 1:10688415-10688437 AGAGTTCTGCTCTTGGAGGGAGG + Intronic
903542368 1:24104006-24104028 AGAGTTATGCGCTTAGAGGCAGG + Intronic
905709833 1:40092237-40092259 AGAGGTAAACTCATTTAGGTTGG + Intronic
906657467 1:47559167-47559189 AGAGGTAGGCTCTTCCAGGAGGG + Intergenic
910425550 1:87116940-87116962 AGAGAGATGCTGTTTGAGCTAGG - Intronic
913179349 1:116305986-116306008 AGAGTTATTTTCTTTGTGGTTGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
1064907216 10:20359571-20359593 ACAGGTCTGCTCTCTGAGTTTGG - Intergenic
1065656674 10:27958884-27958906 AGAAGCATGATCTTTGACGTTGG - Intronic
1068279181 10:54846494-54846516 GGAGGTAAGGTCTTTGAGGCAGG + Intronic
1071441427 10:85700710-85700732 TGAGGTATGTTCATTGAGGAGGG - Intronic
1072506663 10:96074660-96074682 TAAGGCATGCCCTTTGAGGTAGG - Intergenic
1072525741 10:96269939-96269961 AGAGGTAGGCTTTGAGAGGTGGG - Intronic
1077739379 11:4828483-4828505 ATAGATATGCTGTTTGTGGTAGG + Intronic
1078390780 11:10933675-10933697 AAAGGTGTGCTCCTTGGGGTGGG + Intergenic
1079956038 11:26865921-26865943 AGAGGTCTGTTGCTTGAGGTTGG + Intergenic
1081363140 11:42204558-42204580 AGAGGTACACACTTTGAGCTGGG - Intergenic
1083109116 11:60387645-60387667 AGTGGTATTGTCTTTGAGTTTGG - Intronic
1085065395 11:73490717-73490739 AAAGGTTTGCACTTTTAGGTAGG - Intronic
1086656474 11:89363111-89363133 AAAGGTATGCTCTGAGAGTTTGG + Intronic
1089008524 11:115113467-115113489 AGAGCAATGCTCTTTGGGGGTGG - Intergenic
1089186426 11:116618615-116618637 AGAGGAATTCTGTTTGATGTTGG - Intergenic
1090035442 11:123245889-123245911 AGAGCTATGCTATTTGAGCCTGG - Intergenic
1097043832 12:56172696-56172718 AGAGGTCTGCTATTTGTGGAGGG + Exonic
1097610074 12:61808474-61808496 ACAGGTATTTTCTATGAGGTGGG - Intronic
1098158886 12:67628798-67628820 GAATGTATGCTTTTTGAGGTTGG - Intergenic
1099078746 12:78147483-78147505 TGAGAAATGCTCTTTGAGTTTGG + Intronic
1104072843 12:125361363-125361385 AGAGGCATGAGCTTTGAAGTGGG - Intronic
1104548045 12:129730383-129730405 AGGGGTATGCTCCCTGAGGGTGG + Intronic
1107104647 13:36630301-36630323 AGGGGTTTGCTCTCTGAGGAGGG + Intergenic
1115418633 14:33166479-33166501 AGAGGTAGACTCTTGGAGGGAGG + Intronic
1117294203 14:54364322-54364344 AAATGTATGCTCAATGAGGTGGG - Intergenic
1119077552 14:71657454-71657476 ACAGGTATTCCCTTTGAGTTGGG + Intronic
1121582489 14:95041325-95041347 ATGGGGATGCTCTGTGAGGTGGG - Intergenic
1121951048 14:98171538-98171560 AGAGGCAAGCTCTGTGTGGTGGG + Intergenic
1127298044 15:57627226-57627248 AGAGGTCAGCTGTTTGAGCTGGG + Intronic
1128087859 15:64898133-64898155 AGAGGTATGTTTTGGGAGGTGGG - Intronic
1128215928 15:65934083-65934105 ACAGGTATGGTCTTGGAGGACGG + Intronic
1130936170 15:88472648-88472670 AGAGGAGAGCTCTCTGAGGTGGG + Exonic
1135275579 16:21109709-21109731 AGAGGTATGCAAGTTGAGGCAGG - Intronic
1139412884 16:66779793-66779815 AGATGTATGCTCTTTTAGAACGG - Intronic
1140277604 16:73524704-73524726 AGAGGTTTGCTCTTTAAGCAGGG - Intergenic
1141407831 16:83808931-83808953 AGACGTATGCTCCTTGAGCCAGG - Intronic
1143049533 17:4112876-4112898 AAATGTAAGCTCTTTGAGGTGGG - Intronic
1146834383 17:36098602-36098624 AGAGGTAGCCTCTAGGAGGTGGG - Intergenic
1150132537 17:62677127-62677149 AGAGACATGCTCTCTGGGGTTGG - Intronic
1152305826 17:79519662-79519684 ACAGGGATGCTCTTTCAGGCAGG - Intergenic
1152379817 17:79936620-79936642 AGAGGCATGCCCTTGGGGGTTGG - Exonic
1156384126 18:36590910-36590932 AGAGGGAGCCTCTGTGAGGTGGG + Intronic
1158958830 18:62570228-62570250 AGAGGTTTGCTCTTTGAAGTGGG + Exonic
1159808818 18:72991408-72991430 AGAGATATGCTTTTTTAGATAGG - Intergenic
1159826315 18:73215388-73215410 AGAGGTATGTTTTGGGAGGTGGG + Intronic
1162460046 19:10809609-10809631 AGAGGTGAGCTCCTTGAGCTGGG - Intronic
1164418341 19:28065138-28065160 AGAGAGAAGCTCTATGAGGTTGG - Intergenic
1165047131 19:33114071-33114093 AGATGTTTACTCTTTGGGGTTGG + Intronic
926147860 2:10407626-10407648 GGGTGGATGCTCTTTGAGGTGGG + Intronic
929328015 2:40642110-40642132 AGAAGTATTTTCTTTGAAGTAGG + Intergenic
929329410 2:40662578-40662600 AGAGGGATGTTATTTGAGGTTGG + Intergenic
929571910 2:43028016-43028038 AGAGTGATGCTCTTTGAAGATGG - Intergenic
929961341 2:46498453-46498475 AGAGGTATGCCCTTTTTGGGGGG - Intronic
932606483 2:73169181-73169203 ACAGGTATGCACATTCAGGTGGG + Intergenic
933925945 2:87091250-87091272 ACAGGTATGCACATTCAGGTGGG - Intergenic
937389702 2:121474300-121474322 AAATATATGCTCTTTGAGGATGG - Intronic
938393967 2:130928248-130928270 AGAGGTCTCTTCTCTGAGGTGGG + Intronic
942761881 2:179408966-179408988 AAGGGTATCCTATTTGAGGTAGG + Intergenic
946879830 2:224165409-224165431 AGAGTGATGCTCTTTGATGATGG - Intergenic
1171104963 20:22424037-22424059 AAAGGTGTGCTCCCTGAGGTGGG + Intergenic
1178106250 21:29322483-29322505 AGAGGAATTCTCTTTTGGGTGGG + Intronic
1179448292 21:41449396-41449418 AGAGGTTTGCTCGTTGGTGTGGG - Intronic
1181853040 22:25763557-25763579 AGAGATGTGCTGTTTGAGCTGGG - Intronic
1183235665 22:36615032-36615054 AGAGGTCTGCTCTTGGAGAACGG + Intronic
1185233036 22:49694177-49694199 AGGGGTGTGCTCTGTGGGGTGGG - Intergenic
949154014 3:807582-807604 ACAAACATGCTCTTTGAGGTAGG - Intergenic
954932343 3:54295202-54295224 TGAGGTGTGCTTTTTGAGGCTGG + Intronic
955115993 3:56002655-56002677 AGGGTTACGCTCTTTGAGATTGG - Intronic
955811484 3:62795377-62795399 AGATGTAAGCTCCATGAGGTAGG + Intronic
957926793 3:86824493-86824515 AAAGGTATGCTCTTTGACCCTGG + Intergenic
959156861 3:102677491-102677513 AGAAATTTGCTTTTTGAGGTTGG + Intergenic
959315869 3:104805813-104805835 AAAAGTATGCTTTTTGAGCTGGG + Intergenic
964628516 3:158783155-158783177 GGAGGTCTGCTGTTTGGGGTTGG + Intronic
967817407 3:193811126-193811148 AGAGGTGAGCTCCTTGAGGCAGG - Intergenic
970597385 4:17612893-17612915 AGAGGGGTGTTCTTTGAGATAGG - Intergenic
972207735 4:36798391-36798413 AGAGTTGTGCTCCTTGGGGTTGG - Intergenic
973553068 4:52054421-52054443 AGAGGCAGGCACTTGGAGGTAGG + Intronic
976516270 4:85970700-85970722 AGAGGTGTGCTCTGAGAAGTTGG - Intronic
984779138 4:183507449-183507471 AGAGTTAAGCTATTTGAAGTTGG + Intronic
985547876 5:519165-519187 AGAGGTATGCTCAGTGGGTTTGG - Intronic
985665003 5:1177505-1177527 AGAGCTATTCTCTCTGGGGTGGG - Intergenic
986133684 5:4954565-4954587 TGAGGTATGCTTTTAGAGGTGGG + Intergenic
986889024 5:12277481-12277503 AAAGGTTTGCTCTTGGATGTGGG + Intergenic
987912864 5:24171044-24171066 AGAGGTCTTCTATTTTAGGTTGG - Intronic
988274169 5:29058986-29059008 ATAGGTAAGCTCATTGAGGCTGG + Intergenic
993568178 5:89501704-89501726 GAATGTAAGCTCTTTGAGGTGGG + Intergenic
997199697 5:132002461-132002483 AGAGGGAAGCTCCTTGAAGTAGG + Intronic
998882287 5:146656186-146656208 AGAGGTATGCTCTTTGAGGTGGG + Intronic
999221258 5:149979962-149979984 AGAGGTCTGTTCTTTGTGATGGG + Intronic
1002797385 6:485520-485542 AGAGGAATTCTCTTTGTAGTCGG - Exonic
1005233788 6:23736095-23736117 ATATGTATGATCTTTGAAGTTGG - Intergenic
1006562101 6:34922471-34922493 CCAGGTGTGCTCATTGAGGTGGG - Intronic
1007913263 6:45536838-45536860 AGAGAGATGCTGGTTGAGGTAGG - Intronic
1009957111 6:70469146-70469168 GGATGTAAGCTCTATGAGGTCGG + Intronic
1010376481 6:75176354-75176376 AGAGGGATGCTGTGGGAGGTGGG + Intronic
1012319520 6:97825566-97825588 AGAGGTATGATCTCTCAGGGGGG - Intergenic
1014992495 6:128098901-128098923 TGCTGTATGCTCTTTGAGGAGGG + Intronic
1017187682 6:151618602-151618624 AGAGGTATGGCTTTTGAGGCAGG - Exonic
1017370160 6:153695530-153695552 AGAGGTATGTTCATTGGAGTAGG + Intergenic
1017436285 6:154418515-154418537 AGAGGTATGGACTGTGAGGTGGG - Intronic
1017467648 6:154709406-154709428 ATAAACATGCTCTTTGAGGTTGG + Intergenic
1018452603 6:163922981-163923003 AGAGCTTTGCTATTTCAGGTTGG + Intergenic
1022628821 7:32066037-32066059 AAAGGTCTTCTCTATGAGGTGGG + Intronic
1023653637 7:42397281-42397303 AGAGGTAGTTTCTTAGAGGTTGG - Intergenic
1026618736 7:71931735-71931757 ACAGGGATTCTCTTTGAGGAGGG + Intronic
1026937132 7:74263992-74264014 CGAGGTATGACCTTTGAGCTGGG + Intergenic
1030105539 7:105983912-105983934 AGGGTGATGCTGTTTGAGGTGGG - Intronic
1030652590 7:112131519-112131541 AGAGGTATTGTCTTTGGGGCTGG - Intronic
1031448035 7:121879069-121879091 ATAGGCATCCTCTATGAGGTTGG + Intronic
1032216811 7:129963843-129963865 AGTGGCATGCGCTTTGACGTTGG - Intergenic
1033772579 7:144568846-144568868 ACAGGTATGCTGTATGAGGAAGG + Intronic
1034391791 7:150792988-150793010 AGATGTAGGCTCTTTGAGCTTGG - Intronic
1038630313 8:29236071-29236093 TGTGGTCTGCACTTTGAGGTTGG - Intronic
1040614055 8:49017510-49017532 AGAGGTAGGCTTTAGGAGGTCGG - Intergenic
1043910634 8:85859388-85859410 AGAGGTTTTCTCTGTGTGGTAGG - Intergenic
1045747161 8:105436655-105436677 AGAGGCATGGTCTTTGGAGTCGG + Intronic
1046281558 8:112039920-112039942 AGAAGTATGCTTTTTGAAATGGG + Intergenic
1046784512 8:118251768-118251790 AGAGACAAGGTCTTTGAGGTTGG - Intronic
1047399157 8:124531605-124531627 CGATGTATTCTCATTGAGGTAGG - Intronic
1059538595 9:115108511-115108533 AGAGGAGTGCTCTTTTAGATGGG - Intronic
1060195928 9:121623286-121623308 AGAGGCCTCCTCTTTGAGGCAGG + Intronic
1186321853 X:8436229-8436251 AGAAGTATGGTTTTGGAGGTAGG + Intergenic