ID: 998883638

View in Genome Browser
Species Human (GRCh38)
Location 5:146671396-146671418
Sequence TTGCATAAACAAATAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998883633_998883638 15 Left 998883633 5:146671358-146671380 CCATTAAGAACCGCTAAATGGTG 0: 1
1: 0
2: 0
3: 8
4: 57
Right 998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 230
998883629_998883638 23 Left 998883629 5:146671350-146671372 CCTTCTCCCCATTAAGAACCGCT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 230
998883636_998883638 5 Left 998883636 5:146671368-146671390 CCGCTAAATGGTGGGTTTGATGA 0: 1
1: 0
2: 1
3: 6
4: 170
Right 998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 230
998883630_998883638 17 Left 998883630 5:146671356-146671378 CCCCATTAAGAACCGCTAAATGG 0: 1
1: 0
2: 0
3: 12
4: 95
Right 998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 230
998883632_998883638 16 Left 998883632 5:146671357-146671379 CCCATTAAGAACCGCTAAATGGT 0: 1
1: 0
2: 0
3: 6
4: 47
Right 998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998883638 Original CRISPR TTGCATAAACAAATAGAGCT GGG Intronic
900714414 1:4134846-4134868 TTGCTTAAAAGAATAGAGATGGG + Intergenic
900985411 1:6070230-6070252 TTGCAAAAACAGATAAAGCCTGG - Intronic
902125916 1:14211201-14211223 ATAAATAAACAAATAGAGATAGG - Intergenic
903583244 1:24388081-24388103 TTGAATAAATAAATACAGGTAGG - Intronic
903984581 1:27216808-27216830 TTGGATAAATAAATATAGATTGG - Intergenic
906445895 1:45897807-45897829 TTAAAAAAACAAATAGAGCCAGG + Intronic
907001238 1:50860014-50860036 TTGAATAAACAAACAGTGCTGGG + Intronic
907687795 1:56631138-56631160 TTATATAACCAAAGAGAGCTTGG + Intronic
908159643 1:61393873-61393895 TGGCATGAACAAATAGGCCTGGG - Intronic
908872808 1:68633931-68633953 TGGCATGAAGAAATAGAACTAGG + Intergenic
909364130 1:74799519-74799541 TTGCATAACTAAAAAGAGCCAGG - Intergenic
912830587 1:112949709-112949731 TTTCTTAAACAAATAGAGACAGG + Intronic
912919490 1:113852402-113852424 TTGCATAAAATAAAAGAGGTTGG + Intronic
913491931 1:119388672-119388694 TTTTATAAATAAATAGACCTGGG - Intronic
918302165 1:183214486-183214508 TTGCCTGAACCAAGAGAGCTGGG + Intronic
919545718 1:198915661-198915683 TTAAATAAAGAAATAAAGCTAGG + Intergenic
919546242 1:198922916-198922938 TTCCATAAACAACTAAAGTTCGG - Intergenic
919643292 1:200066387-200066409 TTCCCTAAACAGATAGAGCCAGG + Intronic
924161029 1:241232056-241232078 TTTTCTAAACAAATAGTGCTGGG - Intronic
1063493849 10:6489207-6489229 ATGCATAAGAAAATGGAGCTGGG - Intronic
1064155113 10:12897435-12897457 TTGCATAAAGAAGAAGAGATTGG + Exonic
1064863545 10:19853740-19853762 TTTCATAAGGAAATATAGCTGGG + Intronic
1065715088 10:28558957-28558979 TTATATTAACAAATTGAGCTGGG - Intronic
1066307833 10:34163680-34163702 ATGCATAAACAAATAGCCCTGGG + Intronic
1066312988 10:34216180-34216202 TTGCATACAAATATTGAGCTGGG - Intronic
1068091051 10:52432475-52432497 TTGAATAAAAACATAAAGCTTGG + Intergenic
1069795977 10:71052221-71052243 TTGCAAAAACAAGCAGAGCACGG - Intergenic
1071586600 10:86828954-86828976 TTGCAAAAGAACATAGAGCTGGG + Intronic
1071840195 10:89462465-89462487 TGGCAAAAGTAAATAGAGCTCGG - Exonic
1074067686 10:110032256-110032278 TTGCATTAAGAATGAGAGCTCGG + Intronic
1075336254 10:121610997-121611019 TCGCATGAACAAATAGTGCATGG + Intergenic
1075642887 10:124077599-124077621 TTGCAGAAACTAACAGAGCAGGG - Intronic
1075977039 10:126705118-126705140 TATCAAAAGCAAATAGAGCTTGG + Intergenic
1077757389 11:5047358-5047380 TGGGATAATCAAATAGAGATTGG - Exonic
1077837560 11:5937905-5937927 TTCTATAACCAAAAAGAGCTTGG + Intronic
1078554503 11:12310408-12310430 TTTCTTAAATAAATAGTGCTGGG - Intronic
1078555588 11:12323271-12323293 TTGTATAAACAAAGTGAGGTTGG + Intronic
1079472497 11:20791312-20791334 TAGCATAAAAAAATACACCTAGG - Intronic
1082132397 11:48506346-48506368 TTTCTTCAACAAATAGTGCTGGG + Intergenic
1083916592 11:65748962-65748984 TCTCATCAACAAATGGAGCTAGG - Intergenic
1084687926 11:70708134-70708156 TTGCATGAAGAAATGGACCTTGG - Intronic
1085045766 11:73352559-73352581 ATGTATGAACAAACAGAGCTTGG - Intronic
1085785999 11:79450230-79450252 TACCATAAACATATACAGCTAGG + Intergenic
1085837308 11:79970852-79970874 TTGCAGAAACCCACAGAGCTGGG - Intergenic
1086138817 11:83471580-83471602 TAGGAAAAACAAAAAGAGCTTGG - Intronic
1088631990 11:111782461-111782483 TTGCAAAAAAAATTAAAGCTGGG + Intronic
1089371970 11:117967479-117967501 TTACAAAAACAAAAACAGCTGGG + Intergenic
1090111834 11:123919645-123919667 TTTTAAAAACAAGTAGAGCTTGG + Intergenic
1090873345 11:130767265-130767287 TTACCTTAACAAATAGAACTGGG - Intergenic
1091023420 11:132121472-132121494 TTACTTAAATAAATGGAGCTGGG - Intronic
1091096652 11:132829149-132829171 TAGCATAAACAAGTATAACTTGG - Intronic
1093827971 12:23718409-23718431 TTGCATACAGAAAGAGAGATTGG + Intronic
1093869698 12:24273945-24273967 CTGCAAACAGAAATAGAGCTAGG - Intergenic
1095456446 12:42390835-42390857 TTGTATATAAAAATAGAGATGGG + Intronic
1098471629 12:70851526-70851548 TTGCAGAAACAAGGAGAGATAGG - Intronic
1099729106 12:86474795-86474817 TTGCAAAAATAAAAAGAGATAGG - Intronic
1099770703 12:87050757-87050779 TTGCATAATCAAATATTTCTAGG - Intergenic
1100208707 12:92378929-92378951 TTGCATAAAAGAATATTGCTTGG - Intergenic
1101938427 12:109079683-109079705 TTGCATAGGCAAACAGAGATTGG - Intronic
1104329107 12:127827500-127827522 TAGCACAAACAAAGAAAGCTTGG - Intergenic
1105909179 13:24845237-24845259 TGGCATTAAGAAATAGAGATAGG + Intronic
1106386264 13:29288978-29289000 ATGCAAAAACAAATCTAGCTGGG + Intronic
1106879254 13:34111537-34111559 TTGGATAAACAAAAGGATCTGGG - Intergenic
1109016695 13:57024820-57024842 TGGCATAAACCACTAGAGTTAGG - Intergenic
1110198111 13:72814096-72814118 TCCTATAAACAAATAGAGCTGGG - Intronic
1110772385 13:79364896-79364918 TTGAAAAATCAAATAGTGCTTGG - Intronic
1110819392 13:79897033-79897055 ATGCATGAACAATTAGAGCGAGG + Intergenic
1116261649 14:42635925-42635947 TGGCAAAAACTAATAGAGCAGGG + Intergenic
1116342532 14:43742930-43742952 TTGCATTTATAAATAGAGCATGG - Intergenic
1116628246 14:47294994-47295016 TTGCATAAAAAAATTTGGCTAGG - Intronic
1117223543 14:53632196-53632218 TTGCTTAAACCAATTGAGTTAGG - Intergenic
1117368436 14:55053422-55053444 GTGCCTAAAAAAATAGTGCTTGG - Intronic
1117373110 14:55096836-55096858 TTTAAAAAACAAATAGGGCTGGG - Intergenic
1119973151 14:78995143-78995165 CTGCATAAAAACATAGAACTGGG + Intronic
1120517955 14:85492182-85492204 TTGCCCAAACATACAGAGCTGGG + Intergenic
1121352909 14:93187946-93187968 TAACATAAATAAATACAGCTAGG - Intronic
1121487995 14:94333987-94334009 TTTCTTCAACAAATAGTGCTGGG - Intergenic
1125459020 15:39890618-39890640 TTTGCTAAGCAAATAGAGCTTGG - Intronic
1126130292 15:45334399-45334421 TTGCTTTAACCAATAGAGCAGGG - Intergenic
1126219745 15:46198620-46198642 TTTCCTCAACAAATAGTGCTGGG - Intergenic
1127585956 15:60378151-60378173 TTGCATCAAGAAATAGAAATGGG - Intronic
1128611932 15:69081030-69081052 TTGCAGGAAGAAATAGAGCAAGG - Intergenic
1130879253 15:88041068-88041090 TTTCACAAACAAAGAGTGCTTGG + Intronic
1131500057 15:92953574-92953596 GTGTGTAAACAAAAAGAGCTGGG + Intronic
1131964432 15:97826259-97826281 TTTCTTAAACAAATAGAAATTGG - Intergenic
1132255915 15:100375411-100375433 TTTCTTCAACAAATAGTGCTGGG - Intergenic
1132832808 16:1937490-1937512 TTGCAAAAAAAAATATGGCTGGG - Intergenic
1135600216 16:23776519-23776541 GTGAATAATCAAATAGAGATGGG - Intergenic
1135797033 16:25455854-25455876 TAGCATAAACACATAGTTCTAGG - Intergenic
1139195349 16:64911566-64911588 TTGGATAAATATATAGAGATAGG + Intergenic
1139249319 16:65479876-65479898 TTGCCTGAAGAAATAGAGGTAGG + Intergenic
1139638741 16:68275432-68275454 CTGAAAAAACAAATATAGCTGGG + Intronic
1140443921 16:75008801-75008823 TTGAATAAACAAATAAATGTAGG + Intronic
1144333343 17:14245295-14245317 TTGTATCAACAAACAGGGCTCGG - Intergenic
1146102600 17:29998580-29998602 TTGCATAATCATCTGGAGCTTGG + Intronic
1146116936 17:30149219-30149241 TTACTTAAAAAAATAGAGATGGG + Intronic
1146821701 17:35988091-35988113 ATGAATAAACAAATTGAGCCAGG + Intronic
1147704138 17:42414402-42414424 TTAAAAAAAAAAATAGAGCTTGG - Intronic
1149295823 17:55261779-55261801 TTGGATAAACAAATAGGAGTAGG - Intergenic
1149499689 17:57142831-57142853 TTGAATAAATAAATGAAGCTGGG - Intergenic
1149675849 17:58460807-58460829 TTTCATTAACAAATATATCTTGG - Intronic
1154495472 18:14955558-14955580 TTGATTAAAAAAATAAAGCTTGG - Intergenic
1155828999 18:30488070-30488092 TTGCTTTAAAAAATAGAGATGGG + Intergenic
1156885126 18:42126487-42126509 TTACATGAAGAAATAGAGATGGG + Intergenic
1157120729 18:44908425-44908447 TTCAATAAATAAATAGTGCTGGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159272501 18:66170464-66170486 GTGCAGAAACAAATGGATCTTGG - Intergenic
1159910032 18:74137391-74137413 TTGAACAAAAAAACAGAGCTGGG + Intronic
1161848890 19:6728541-6728563 AAGCAGAAACAAATATAGCTGGG - Intronic
1167412392 19:49352535-49352557 TCTCAAAAAAAAATAGAGCTGGG - Intronic
925681501 2:6426786-6426808 TTGCATGAATAAACACAGCTTGG - Intergenic
926002503 2:9345159-9345181 TTCCAGAGACAAAGAGAGCTGGG - Intronic
927268220 2:21177083-21177105 TTGGAAAAAAAAATACAGCTGGG - Intergenic
927670861 2:25067849-25067871 TTGGAAAAAAAAATAGAGATGGG + Intronic
927984424 2:27398267-27398289 TGGTTTAAACAAATAGTGCTGGG + Intronic
931461587 2:62454680-62454702 ATACATAAATAAATAAAGCTGGG - Intergenic
931854665 2:66289839-66289861 TTGAATCAACAAATAGATATAGG + Intergenic
932533356 2:72563108-72563130 TTACATAAACTAAGAGAACTAGG + Intronic
933258343 2:80105807-80105829 TAGCACAAACAAACAGAACTAGG - Intronic
933340610 2:81021183-81021205 TTCAATAAACAAATGGTGCTTGG - Intergenic
935217012 2:100982486-100982508 TTTCATAAGCAAATGGGGCTTGG - Intronic
935253399 2:101285636-101285658 TTTCAGAATCAAATAGACCTGGG - Intronic
937542220 2:122970501-122970523 TTGCAAAAATAAATAGCACTTGG - Intergenic
939042780 2:137211174-137211196 TTGTATAAACAAATAGATACTGG + Intronic
939751086 2:146046873-146046895 TTTAATAAATAAATACAGCTAGG + Intergenic
940098705 2:150008569-150008591 TTGCATCAATAAATAGATTTGGG - Intergenic
940980314 2:159994307-159994329 TTGCATTAACAAATAAAGGCAGG + Intronic
941581192 2:167297595-167297617 TTGCATAAAAGAATAGAACCTGG - Intergenic
942947617 2:181686698-181686720 TTGCATAAGCAATTAGTGCAAGG - Intergenic
943259406 2:185639835-185639857 TTACATAAAGAAATAAAGCTGGG - Intergenic
944082122 2:195799566-195799588 ATACCTAAACTAATAGAGCTAGG - Intronic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
945233781 2:207615820-207615842 TTACATAAACACATATAGATTGG + Intronic
945637334 2:212372035-212372057 TAGCATAAACAAGAAGACCTGGG + Intronic
946743262 2:222821002-222821024 TTTAATATAGAAATAGAGCTGGG + Intergenic
947522556 2:230859028-230859050 TTTCTTAAACAAATACTGCTGGG + Intergenic
948780177 2:240315903-240315925 TTGCAAAAAAAAATCTAGCTAGG - Intergenic
1168872291 20:1140245-1140267 TAGGATAAACATATAGAGCAAGG + Intronic
1169370642 20:5026791-5026813 TTTCTTCAACAAATAGTGCTGGG - Intergenic
1169725747 20:8727629-8727651 TTGCCTAAAGACACAGAGCTTGG - Intronic
1170944960 20:20883104-20883126 TTGCATAAAGAAATACAGGGAGG + Intergenic
1173437058 20:43042802-43042824 TGGCATAAACCATTAGCGCTTGG - Intronic
1178607217 21:34049525-34049547 TTTCTTCAACAAATAGTGCTGGG + Intergenic
1179070446 21:38066062-38066084 TTTCATAAAGAACTAGAGATGGG - Intronic
1179956508 21:44742557-44742579 TCTCATAAGCAAATATAGCTGGG - Intergenic
1181648622 22:24246970-24246992 TTATTTAAACAAATAGAGATGGG - Intergenic
1185359742 22:50398473-50398495 TTAAATAAAGAAATAGAGATGGG - Intronic
950936935 3:16848512-16848534 TTACTAAAACAAATAGAGCTAGG - Intronic
951723579 3:25729073-25729095 TTGTTTAAACAAATATAGATTGG - Intronic
953343370 3:42154724-42154746 TTAAATAAACAAATAAGGCTGGG - Intronic
954094294 3:48312299-48312321 TTTCTTCAACAAATAAAGCTGGG + Intronic
958725591 3:97902049-97902071 TTACTTAAACAAACAGATCTTGG + Intronic
959515989 3:107267774-107267796 TTCCATGAACAAATAAAGTTAGG + Intergenic
961324359 3:126101543-126101565 TTTCAGACACAAACAGAGCTTGG - Intronic
961480399 3:127175849-127175871 TTGCACAAACCAATAGTCCTAGG - Intergenic
964406628 3:156355204-156355226 TTACAGAAACAAATACAGATTGG + Intronic
964769928 3:160213447-160213469 TTGCAGAAACAGGAAGAGCTAGG - Intergenic
966250930 3:177864270-177864292 TTGCATAAACATTTAGAACTGGG - Intergenic
966446800 3:180009713-180009735 TTGAAAAGAAAAATAGAGCTAGG - Intronic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
970244802 4:14049549-14049571 TTGCTGAAACAAAGGGAGCTGGG - Intergenic
971012773 4:22457004-22457026 TTGCATAAACAAGCATATCTAGG + Intronic
971591965 4:28480010-28480032 TTGTATTAAAAAATAGTGCTAGG + Intergenic
971915315 4:32862561-32862583 TTGCCTATAAAAATAGAGCTAGG + Intergenic
972331963 4:38072125-38072147 TTGCATAATGAATGAGAGCTGGG + Intronic
972938669 4:44170144-44170166 TTTCATAAACAAATATAACTAGG + Intergenic
973570169 4:52230747-52230769 TTTCATAAGAAAATAGAACTTGG + Intergenic
975105338 4:70561825-70561847 TTGAAAAAAGAAATAGGGCTGGG - Intergenic
976579380 4:86717544-86717566 TTATAAAAACAAAGAGAGCTAGG - Intronic
978375475 4:108071152-108071174 TTGCATAAATAAAAAGTACTTGG - Intronic
982163505 4:152593467-152593489 ATGCATAAACAAATCGACATTGG + Intergenic
984993181 4:185401697-185401719 TTGTGTATACAAATAGAGCAAGG + Intronic
990110475 5:52316974-52316996 TTACATAACCAAATATAGGTTGG - Intergenic
990252309 5:53928547-53928569 TTTTACAAACAAATAGAGCCAGG + Intronic
990771733 5:59254221-59254243 TGGTATTAGCAAATAGAGCTGGG - Intronic
991917615 5:71620635-71620657 TTGCCTAAACAAATAGAGACTGG - Intronic
992551036 5:77860310-77860332 TTGCATACAAAATTAGAGGTTGG + Intronic
992792161 5:80223167-80223189 TTTCATAAACAAATATGCCTGGG + Intronic
993227095 5:85181311-85181333 TTTCATAATCAAGGAGAGCTGGG + Intergenic
993748368 5:91630869-91630891 TTGCATAAGCAAAGAGATTTGGG + Intergenic
993973073 5:94443592-94443614 TTTCATAAACCAATAATGCTTGG - Intronic
994173486 5:96684106-96684128 TTGCCTAAAGACACAGAGCTAGG - Intronic
995891111 5:116952693-116952715 TTCCTTACAAAAATAGAGCTGGG - Intergenic
996104586 5:119484490-119484512 TTGCATAAGTAAATAAAGGTAGG - Intronic
997147367 5:131451281-131451303 TTGCAAAAACAAAGACACCTAGG + Intronic
998661555 5:144244393-144244415 TTGTATAGATAAATAGAGATAGG + Intronic
998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG + Intronic
1000665554 5:163991842-163991864 ATGCATAATCAAATGCAGCTGGG - Intergenic
1003339253 6:5204098-5204120 TTGCCTAAACTCATAAAGCTTGG + Intronic
1004418764 6:15448946-15448968 TTACATAAAAAAATAGAACAAGG - Intronic
1004782385 6:18924308-18924330 TTTCTTCAACAAATAGTGCTGGG - Intergenic
1004839553 6:19567477-19567499 TTTCACAAGAAAATAGAGCTGGG + Intergenic
1008622623 6:53286264-53286286 TTGCATAAACCCACATAGCTGGG + Intronic
1009474459 6:64071968-64071990 TTGAAGAAACATATAGAGCCGGG + Intronic
1009663332 6:66643829-66643851 TTGCATAAACATATTGAGGGAGG - Intergenic
1009775695 6:68203610-68203632 ATGAATAAACAAATAGGTCTTGG + Intergenic
1012219543 6:96631829-96631851 TTGAATAAAAATATAGAGCATGG - Intergenic
1013309559 6:108880538-108880560 GTACATAAACAAAAAGAGCAAGG + Intronic
1015796677 6:137019422-137019444 TTAAAAAAACAAATAGGGCTGGG - Intronic
1017441335 6:154466915-154466937 TTCCATAAAAAAATACAGGTGGG - Intronic
1020492085 7:8799546-8799568 TTGCTTAAACCACTACAGCTTGG + Intergenic
1021168686 7:17371719-17371741 TTGCATAAAGAAATCAAGCAAGG - Intergenic
1022354536 7:29600332-29600354 TTGTATAAACAAATAGGAATGGG + Intergenic
1022617184 7:31943449-31943471 TTGCATAAAAAAATAGAATATGG - Intronic
1022643701 7:32211719-32211741 CTGAAGAAAGAAATAGAGCTGGG + Intronic
1023673913 7:42609989-42610011 TTACAGAAACAATAAGAGCTCGG + Intergenic
1024268697 7:47626010-47626032 ATGCAGAAACACATAGCGCTGGG + Intergenic
1027562454 7:79748983-79749005 ATGTATAAACAAATAGGGGTTGG - Intergenic
1028263766 7:88697096-88697118 TTGCATGAATAAATAAAGTTTGG + Intergenic
1030286552 7:107832814-107832836 TGGTATAAACTAATAGAACTTGG + Intergenic
1030727654 7:112944797-112944819 TTGCATTAACCAACAGAGCAAGG + Intergenic
1030917004 7:115327885-115327907 TTGCATAAAGAAATTGTGCAAGG + Intergenic
1034817881 7:154189289-154189311 TTGCCTAAGCAAACATAGCTAGG - Intronic
1036162698 8:6404643-6404665 TTGCACAAAAAAATACTGCTGGG - Intergenic
1041794298 8:61730071-61730093 TTTCAAGAAGAAATAGAGCTTGG - Intergenic
1043432468 8:80208185-80208207 TCGGATAATCAAATGGAGCTGGG + Intronic
1044579964 8:93814999-93815021 TTGTATAAAGAAATAGAGAAAGG + Intronic
1044621836 8:94197956-94197978 TTGCCTAAAGACATACAGCTAGG + Intronic
1045161061 8:99544610-99544632 TTGCATAAGCAAAAAGCGGTAGG - Intronic
1050616141 9:7403637-7403659 TGGCAGAAACAGATAGAGATCGG - Intergenic
1051090323 9:13399706-13399728 TTTCATAAAAAAATACAGCAGGG - Intergenic
1051839416 9:21378482-21378504 TTGAGTAAACAAGTAGTGCTGGG + Intergenic
1051897890 9:22007375-22007397 ATAAATAAATAAATAGAGCTTGG + Intronic
1051972034 9:22900091-22900113 ATGGAAAAACATATAGAGCTGGG - Intergenic
1055394496 9:75859642-75859664 TTTGGAAAACAAATAGAGCTTGG - Intergenic
1055849321 9:80606827-80606849 TTCTATAAACAACTAGACCTAGG + Intergenic
1056536935 9:87536620-87536642 TTGCATAAATAAATAAATCAGGG + Intronic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1186073644 X:5851852-5851874 TTGCATAAACAACTAAAGCTGGG - Intronic
1186328088 X:8501676-8501698 TTTCATAAACAATGAAAGCTTGG + Intergenic
1186873916 X:13798531-13798553 TTGCATAAATAAATATATGTAGG + Intronic
1186992824 X:15087923-15087945 TTGTATAAACAAACACAGCTGGG - Intergenic
1187771314 X:22700083-22700105 TTGCAATATCAAATAGAGCCAGG - Intergenic
1189669588 X:43394128-43394150 TTGCAAAAACAAATGAAGCATGG + Intergenic
1193349343 X:80441576-80441598 TTGTCTAAACAAATAAATCTAGG - Intronic
1193987438 X:88261333-88261355 TTTCTTCAACAAATAGTGCTAGG - Intergenic
1194876385 X:99193749-99193771 TAGCATAAAAATATAGACCTGGG - Intergenic
1195130480 X:101845955-101845977 TGGAATAAATAAATAGAGGTTGG - Intronic
1195416460 X:104625362-104625384 GTACATAAAAAAATACAGCTTGG + Intronic
1195682380 X:107558323-107558345 TAGCATATACAAATAGAGTTGGG + Intronic
1198238336 X:134758555-134758577 TTTCTTCAACAAATAGTGCTGGG + Intronic
1198547186 X:137704809-137704831 TTCAATAAAAAAATTGAGCTGGG - Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1201522994 Y:14897621-14897643 TTGCATAAACAACTGAAGCTGGG + Intergenic