ID: 998885129

View in Genome Browser
Species Human (GRCh38)
Location 5:146686198-146686220
Sequence GTTCCAGGTGCCGGAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998885125_998885129 -7 Left 998885125 5:146686182-146686204 CCATGTGCCATGGATTGTTCCAG 0: 1
1: 0
2: 2
3: 35
4: 392
Right 998885129 5:146686198-146686220 GTTCCAGGTGCCGGAGTTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998885129 Original CRISPR GTTCCAGGTGCCGGAGTTGC AGG Intronic