ID: 998885592

View in Genome Browser
Species Human (GRCh38)
Location 5:146690804-146690826
Sequence CCTTCTGTACTGAAGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998885592_998885596 13 Left 998885592 5:146690804-146690826 CCCTGTACCTTCAGTACAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 998885596 5:146690840-146690862 TTAGATAACGTGAACAACAGAGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998885592 Original CRISPR CCTTCTGTACTGAAGGTACA GGG (reversed) Intronic
901474120 1:9477372-9477394 CCTTCTGTACTTAAGTTAGTTGG + Intergenic
912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG + Intronic
915336696 1:155147569-155147591 GCCTCTGTACTGAAGATAAAAGG + Intergenic
915404985 1:155653218-155653240 CCTTCTGTAGTCAAAGTACCAGG - Intergenic
917995937 1:180438332-180438354 CCTACTCTATTTAAGGTACAGGG + Intronic
920392396 1:205616619-205616641 CCTTCTGTACTGAACAGTCATGG - Exonic
921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG + Intergenic
921398253 1:214692068-214692090 CCTTCAGTATGGAAGATACATGG + Intergenic
921435735 1:215118817-215118839 AATTCTGAACTGCAGGTACAAGG - Intronic
922032914 1:221821603-221821625 TCTTATGTAGTGAAGGTACCTGG + Intergenic
922926045 1:229347377-229347399 CCTTCAGTACTGTATGAACAAGG + Intergenic
924117032 1:240757971-240757993 CCGTCTCTACTAAAGGTACAAGG - Intergenic
924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG + Intronic
1065696362 10:28384207-28384229 CCTTCTGTTATTTAGGTACATGG + Intergenic
1065804590 10:29382905-29382927 GCTTCTGCACTGAAGGAAAAGGG + Intergenic
1065944541 10:30594827-30594849 GCTTCTGCACTGAAGGAAAAGGG - Intergenic
1068223844 10:54080821-54080843 CCTTCTGTACTGTAGGAAGCTGG - Intronic
1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG + Intergenic
1070121220 10:73579119-73579141 CCATCTGTACTAAAAATACATGG - Intronic
1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG + Intronic
1079893535 11:26089783-26089805 CAATCTGTACTTAAGTTACACGG + Intergenic
1085665853 11:78415643-78415665 CCTGATGGGCTGAAGGTACATGG + Intronic
1088291944 11:108248526-108248548 CTTTCTGAAATGAAGATACAGGG - Intronic
1089381418 11:118035538-118035560 CCTTCTGTTCTGATGGCACCTGG - Intergenic
1091644831 12:2265530-2265552 CTATCTGTAATGAAGGGACAGGG - Intronic
1094457841 12:30658772-30658794 CCTTCTGTATTGAAACTAAATGG - Intronic
1095751855 12:45721403-45721425 CCTACTGAACTGAAGGGAAAGGG - Intergenic
1095934781 12:47666052-47666074 CCTCCTGTACTAAACATACATGG - Intronic
1102109576 12:110354761-110354783 CCTTCTGAGCTGACAGTACAAGG - Intergenic
1103742274 12:123098891-123098913 CCTTCAGTACTCAAAGTGCATGG - Intronic
1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG + Intronic
1109628629 13:65013548-65013570 CCATCTGTACTAAAAATACAAGG - Intergenic
1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG + Intergenic
1112448414 13:99488215-99488237 CCTTCTGCAGTGAAAGTACTAGG - Intergenic
1113020081 13:105875298-105875320 ACTTCTGTCCAGAAGGTACCTGG - Intergenic
1115418453 14:33164874-33164896 CCTTCTGTACTGGTGAGACAGGG + Intronic
1115715576 14:36099338-36099360 CCTTCTGTATTGAATATTCAGGG - Intergenic
1117180545 14:53186970-53186992 ACTTCTGTTCTGAGGGTTCAAGG + Intergenic
1119754712 14:77107710-77107732 AAATCTGTACTGAAGCTACATGG - Intronic
1120686035 14:87538909-87538931 AGTTCTGTAGTGAAGGTATATGG + Intergenic
1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG + Intronic
1122244414 14:100391870-100391892 CCTTCTCTCCTGAGTGTACATGG + Intronic
1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG + Exonic
1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG + Intronic
1131171582 15:90182844-90182866 CCGTCTCTACTGAAAATACATGG - Intronic
1131918679 15:97300128-97300150 CCTTCTGTACAAAAGCTACTTGG - Intergenic
1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG + Intronic
1135176729 16:20236481-20236503 CCTTCTGTAGATAAGGTAAAGGG + Intergenic
1138426718 16:56939065-56939087 CCTTCTGTGCTTGTGGTACATGG + Intronic
1139433263 16:66922487-66922509 GCTCCTGTACTGAGGGTACTGGG + Intronic
1141277861 16:82604437-82604459 GCTTCTGTTCTGAGGGTCCATGG + Intergenic
1150271737 17:63871262-63871284 CCATCAGGACTGAAGGGACACGG - Intergenic
1151758650 17:76088647-76088669 ACTTCTGCTCTGAAGGTGCATGG - Intronic
1153945969 18:10017643-10017665 GCTTCTGTTCTGTGGGTACACGG + Intergenic
1157684473 18:49631264-49631286 CCTTCGGTACTAACGGCACATGG - Intergenic
1164832847 19:31335835-31335857 CCTTCTGTAATGAATGCACTTGG - Intronic
1166538581 19:43591498-43591520 CCTTCTGTCCTGAAGGGAGTTGG - Exonic
1167234117 19:48303531-48303553 CCATCTGTGCTGGAGGAACAAGG - Intronic
926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG + Intronic
936752928 2:115668085-115668107 ACTACTGTACTGAAGATATATGG - Intronic
942946735 2:181681352-181681374 TTTTCTGTACTGAAGGAACTGGG - Intergenic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
944452950 2:199861643-199861665 CCTTCTTTGCTGATTGTACATGG - Intergenic
1170488263 20:16842695-16842717 CCTTCCTTACTTAGGGTACAGGG + Intergenic
1171773556 20:29345840-29345862 CCTTCTGAACTCAGGGAACAAGG + Intergenic
1178802559 21:35809693-35809715 CCTTCTGGTCTCAAGTTACAAGG - Intronic
1184832589 22:46998587-46998609 CCTTCTGTGCTAAAGGCGCAGGG - Intronic
949113396 3:290631-290653 CCTACTGTACTCTAGGAACAGGG - Intronic
949811181 3:8007927-8007949 GCTTTAGTACTGAAGGAACATGG - Intergenic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
951706831 3:25552125-25552147 CCCTCTGTAGTCAAGGTACATGG + Intronic
956343189 3:68249065-68249087 CCTTCCCTACTGAAGGTAATAGG + Intronic
957197023 3:77081913-77081935 CCTTCTGAAGTGAAGGTATGGGG - Intronic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
966221353 3:177554421-177554443 CTTTCAGTGCTGAAGGTACTTGG + Intergenic
966243321 3:177778725-177778747 CATTCTCTACTGAAAGAACAAGG + Intergenic
968315309 3:197719149-197719171 CATTCTGTACTGATCTTACAAGG + Intronic
977048809 4:92100929-92100951 CCTTCTGTACTGGAAGAAAAAGG - Intergenic
980134962 4:128849927-128849949 GCTTTTGTGCTGTAGGTACACGG + Intronic
982731570 4:158961273-158961295 CATTCTGAACTGAAGCTTCAGGG - Intronic
982796560 4:159653254-159653276 CCTTCTGAATTGAAGTGACAGGG - Intergenic
983971579 4:173882012-173882034 CCTCCTGTACTGATGCCACATGG - Intergenic
987001650 5:13666264-13666286 CTTTCTTTACTCTAGGTACATGG - Intergenic
992262794 5:74987573-74987595 CCTTCTTTTCTGATGGCACAGGG + Intergenic
992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG + Intronic
993598089 5:89884736-89884758 CCTTCTGTACTCTAGCTACTGGG - Intergenic
996681624 5:126233726-126233748 CCTTCTGTTCTCAAGGTATTTGG - Intergenic
997071254 5:130625103-130625125 CCTTCTGTATTCAAGGTTCAAGG - Intergenic
997477660 5:134154950-134154972 CCTTGTGAAATGCAGGTACAGGG - Exonic
998005254 5:138652523-138652545 CCTCCTGGACTGAAAGCACAGGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1002866311 6:1125278-1125300 CCTTCTGGACTGAGGGTAGGTGG - Intergenic
1006979529 6:38135865-38135887 CCTTCTGGACTGCAGGCTCAAGG - Intronic
1008481691 6:51992874-51992896 CCTTCAGTATTGCTGGTACAAGG + Intronic
1018904000 6:168064702-168064724 CCTTCTGTCCTGAAGGCCCAAGG - Intronic
1024246216 7:47472289-47472311 CCATCTGTAGGGGAGGTACAGGG - Intronic
1026063393 7:67046871-67046893 CTTTCTCTAGTGAAGGGACAGGG + Intronic
1026680540 7:72463320-72463342 CCATCTGTACTAAAAGTACCTGG - Intergenic
1034731608 7:153392034-153392056 TCTTGTGTACTTAAGGAACATGG + Intergenic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1035917867 8:3644631-3644653 CCCTCTTTACTGAAGGTAATAGG - Intronic
1036991729 8:13605645-13605667 CTCTCTGTACTCCAGGTACATGG + Intergenic
1043454277 8:80398410-80398432 GCTTCTGCACTGAGGGTCCATGG + Intergenic
1044936867 8:97301821-97301843 CCTTCAGTTCTGAAAGGACAAGG - Intergenic
1048908002 8:139106874-139106896 CCTTCAGTAGTGAAGGCACATGG - Intergenic
1051589070 9:18757671-18757693 CCTTCTACACTGAAGCCACATGG + Intronic
1051880078 9:21831036-21831058 CCTCCTGTACTTGTGGTACATGG + Intronic
1051925709 9:22322467-22322489 TCTTCTCTTCTGAAGCTACAGGG + Intergenic
1052201074 9:25781021-25781043 TCTTCTGTACTGAAGGAAAAGGG - Intergenic
1052670385 9:31549839-31549861 TCTTCTGTAGTGAAGGCATATGG - Intergenic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057351744 9:94304416-94304438 CATTCGGTGCTGAAGGAACAGGG - Intergenic
1057397425 9:94692467-94692489 CCTTCTGTTCTGAGGGCAAAGGG + Intergenic
1185953152 X:4458589-4458611 CCGTCAGACCTGAAGGTACAGGG - Intergenic
1187023492 X:15408682-15408704 CCTTTTCCACTGAAGGCACATGG - Intronic
1189808322 X:44757348-44757370 TCTTCTGGACTAAAGGTACTTGG - Intergenic
1190003035 X:46707908-46707930 CCTTCTCTACTAAAAATACAAGG - Intronic
1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG + Exonic
1193361786 X:80587274-80587296 CCTTCTGTACTGATCTTACTGGG + Intergenic
1201788334 Y:17809219-17809241 CTTCCTGTTCTGAAGATACATGG - Intergenic
1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG + Intergenic