ID: 998885596

View in Genome Browser
Species Human (GRCh38)
Location 5:146690840-146690862
Sequence TTAGATAACGTGAACAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998885591_998885596 29 Left 998885591 5:146690788-146690810 CCATCTGGATTCTCATCCCTGTA 0: 1
1: 0
2: 2
3: 13
4: 227
Right 998885596 5:146690840-146690862 TTAGATAACGTGAACAACAGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
998885595_998885596 6 Left 998885595 5:146690811-146690833 CCTTCAGTACAGAAGGTGCTCAA 0: 1
1: 0
2: 0
3: 15
4: 252
Right 998885596 5:146690840-146690862 TTAGATAACGTGAACAACAGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
998885594_998885596 12 Left 998885594 5:146690805-146690827 CCTGTACCTTCAGTACAGAAGGT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 998885596 5:146690840-146690862 TTAGATAACGTGAACAACAGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
998885592_998885596 13 Left 998885592 5:146690804-146690826 CCCTGTACCTTCAGTACAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 998885596 5:146690840-146690862 TTAGATAACGTGAACAACAGAGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998885596 Original CRISPR TTAGATAACGTGAACAACAG AGG Intronic
915422369 1:155793972-155793994 TTAGGTAAAGTGAACAAGACTGG - Intronic
916250278 1:162731207-162731229 TTAGTTAACATGAATCACAGTGG - Intronic
919088041 1:192944970-192944992 TGAGATAACATGAACACAAGTGG - Intergenic
919298206 1:195728328-195728350 ATAGATAACGTTAGGAACAGTGG - Intergenic
920760703 1:208781378-208781400 TCAGAAAAAGTGAATAACAGGGG - Intergenic
924922675 1:248647198-248647220 TAAGATAAGGTGCACAATAGAGG + Intergenic
1068754522 10:60636411-60636433 TTGGACAACGTTAAGAACAGAGG - Intronic
1070412955 10:76161075-76161097 TGAGATAATGGGAAAAACAGAGG + Intronic
1071890385 10:90000022-90000044 TTAGAAAACCTGAACAAAATTGG - Intergenic
1075103534 10:119522401-119522423 TTAGGTTACGTGCACAACAGAGG + Intronic
1080156526 11:29117913-29117935 TTATTTAAGGTGAACAACACTGG - Intergenic
1081242758 11:40727384-40727406 TTATATATGGTGAAAAACAGGGG - Intronic
1081459657 11:43260314-43260336 TAAGAAAGTGTGAACAACAGTGG + Intergenic
1086082405 11:82918351-82918373 TTTGACAAAGTGAACAATAGTGG - Intronic
1086151671 11:83618039-83618061 TTAGAAAACGTGAAAAATAATGG - Intronic
1086609226 11:88734160-88734182 TTAAATAACCTAAACAACAGAGG + Intronic
1092625662 12:10325295-10325317 AAAGATAACATGAACAACTGAGG - Intergenic
1094574638 12:31674105-31674127 TTATTTAAAGTGAACAACATTGG + Intronic
1099937596 12:89146350-89146372 TTAGTTAACCTAAAAAACAGTGG + Intergenic
1103094293 12:118120473-118120495 TTTATTAACGTGAACAAGAGGGG + Intronic
1108285705 13:48905889-48905911 TTAGAAAACGCGCAGAACAGAGG - Intergenic
1109393014 13:61718171-61718193 TTATATAAGGTGAAAAAAAGAGG + Intergenic
1109726840 13:66352260-66352282 TTAGATGAAGGGAACAAAAGAGG - Intronic
1112603015 13:100875401-100875423 TTAGAAAACATGCACAACAATGG + Intergenic
1113757573 13:112823918-112823940 TAAGATGATGTGAACTACAGGGG - Intronic
1114287798 14:21261497-21261519 CTAGTTAAAGTGAACACCAGAGG - Intronic
1114752963 14:25226344-25226366 ATAGACAAAGTGAACAACTGAGG - Intergenic
1114994659 14:28332881-28332903 ATAGAAAACCTGACCAACAGTGG + Intergenic
1118623800 14:67638441-67638463 TTGGATAACGTGTATATCAGAGG - Intronic
1119980379 14:79074039-79074061 TTAGATAATGTGAACAATGCAGG - Intronic
1121575146 14:94978702-94978724 TTAGATAACTAGTCCAACAGAGG + Intergenic
1124260485 15:28185230-28185252 CTATATAACGTGCTCAACAGCGG + Intronic
1126710983 15:51455589-51455611 TGAGACAACCTGAACAACAAAGG - Intronic
1129646233 15:77436355-77436377 TTAGAAAAGGATAACAACAGTGG - Intronic
1131876480 15:96812140-96812162 CCACATAACGTGAACACCAGAGG - Intergenic
1132295347 15:100730393-100730415 TTAGACAACGTTGACAGCAGAGG + Intergenic
1137995966 16:53213168-53213190 TTAGCTAACCTGATCAACAGAGG - Intronic
1156235275 18:35197289-35197311 TCAGATAACGTCTACAACAAAGG - Intergenic
1157132329 18:45018174-45018196 TTAAAGAAAGTGAAAAACAGAGG - Intronic
1159107469 18:64019554-64019576 TTATATAACGTGAAAGAGAGTGG - Intergenic
1159632765 18:70767983-70768005 TTGTATAAGGTGAACAAAAGGGG - Intergenic
926522505 2:13933028-13933050 TAAGATGATGTGAACAAAAGTGG + Intergenic
927087393 2:19685756-19685778 TTACATAACCTGAAAAAAAGTGG - Intergenic
933578592 2:84099343-84099365 TAAGATAATGTGAACTAGAGAGG + Intergenic
933717908 2:85375392-85375414 TAACATAATATGAACAACAGAGG - Intronic
935038919 2:99406777-99406799 TTAGTTGACGAGAACATCAGTGG - Intronic
938594155 2:132769482-132769504 TTAGACAACATGAAGAACAGTGG + Intronic
939378005 2:141395725-141395747 TAAGAAAACATGAAAAACAGAGG + Intronic
939595131 2:144113393-144113415 TTAGCCAATTTGAACAACAGTGG + Intronic
940607989 2:155952370-155952392 TTAGATAACCCTAATAACAGAGG + Intergenic
941494013 2:166178745-166178767 TTAGATATAGTGAAGAATAGGGG - Intergenic
1170226694 20:13998382-13998404 TTAAATAACTGGAACAACAGAGG + Intronic
1181403806 22:22667847-22667869 TTAGATGAAATGAACAAGAGGGG + Intergenic
1181406129 22:22686283-22686305 TTAGATGAAATGAACAAGAGGGG + Intergenic
1181414083 22:22746943-22746965 TTAGATGAAATGAACAAGAGGGG + Intronic
1185155244 22:49189723-49189745 CAAGATACCGTGAACTACAGAGG + Intergenic
956968869 3:74497438-74497460 TCAGATAACATGAATAACAAGGG + Intronic
965471022 3:169091862-169091884 TTTGATAACATCAAAAACAGAGG + Intronic
967564462 3:190957700-190957722 TTATTTAATGTGAACAATAGTGG + Intergenic
968475585 4:805248-805270 TTAGATAATCCTAACAACAGGGG - Intronic
976640238 4:87330112-87330134 TTAGACAGCTTGAGCAACAGAGG - Intergenic
977399678 4:96516457-96516479 ATAGAAAACTTGAACAACATAGG + Intergenic
977901279 4:102425008-102425030 TTATATAACGTGAAGAAAATGGG - Intronic
982467943 4:155753653-155753675 TTATATAAGGTGGACAAAAGGGG + Intergenic
987658254 5:20837527-20837549 GTAGATAACATGAACAAAAATGG - Intergenic
988765430 5:34368415-34368437 GTAGATAACATGAACAAAAATGG + Intergenic
995916353 5:117250067-117250089 TAAGATAATGTGAACAACATTGG - Intergenic
998885596 5:146690840-146690862 TTAGATAACGTGAACAACAGAGG + Intronic
1002612646 5:180431579-180431601 TTCTATAACGTGCACAACACTGG + Intergenic
1002629300 5:180559386-180559408 TCAGATAAAGTGGACATCAGAGG - Intronic
1003004814 6:2370805-2370827 TTAGATTACTAGAACAAAAGGGG + Intergenic
1004842785 6:19606125-19606147 CTAGATAAACTGAAGAACAGAGG + Intergenic
1012134083 6:95534156-95534178 TTAGATAAATTGAATAAAAGTGG + Intergenic
1012417650 6:99026947-99026969 CTAGATAGAGTGAACAACACAGG - Intergenic
1013836123 6:114337620-114337642 TGACATAACCTGAACCACAGCGG - Intronic
1014442645 6:121491294-121491316 TCAGATAACGTGAACCTCAAAGG + Intergenic
1014859868 6:126452573-126452595 TTATATAAGTAGAACAACAGAGG + Intergenic
1017323373 6:153118363-153118385 TTAGACAATGTGATGAACAGTGG - Intronic
1023467446 7:40472537-40472559 TTAAAAAACGTGGAAAACAGTGG - Intronic
1023996909 7:45164180-45164202 TTAGAAAACGTGAACAGAGGAGG - Intronic
1025228908 7:57186233-57186255 TTTGATAGAGTAAACAACAGAGG + Intergenic
1025770288 7:64498957-64498979 TTACACAAAGTAAACAACAGTGG + Intergenic
1028264781 7:88709487-88709509 TCAGATAACGAGACCAACATGGG - Intergenic
1031052530 7:116958526-116958548 TTAGACAACAGGCACAACAGGGG - Intronic
1031154361 7:118092011-118092033 TTTGATAACTTGATCAAAAGAGG + Intergenic
1038387458 8:27162537-27162559 TTAGATAATGTGCATAACAATGG + Intergenic
1048513931 8:135088024-135088046 TTAGATAAGGGTAAAAACAGTGG - Intergenic
1055002976 9:71474227-71474249 TTACCCAATGTGAACAACAGAGG - Intergenic
1060599298 9:124867446-124867468 TTAGATAAAGTGATCAAAGGAGG - Intronic
1186992099 X:15080951-15080973 TTAGATAACCTGAAGGACAAAGG + Intergenic
1190954613 X:55180322-55180344 TTTGATAGAGTAAACAACAGAGG - Intronic
1193324242 X:80160893-80160915 TTAAATAAGTTGAATAACAGTGG - Intergenic
1194247642 X:91535626-91535648 TTATATAAAGTGAAAAACATAGG - Intergenic
1194429553 X:93784554-93784576 TTAGATCACAGAAACAACAGTGG + Intergenic
1195974035 X:110505823-110505845 TTATATACCATGACCAACAGTGG + Intergenic
1200566663 Y:4777156-4777178 TTATATAAAGTGAAAAACATAGG - Intergenic