ID: 998887147

View in Genome Browser
Species Human (GRCh38)
Location 5:146706377-146706399
Sequence CTATGCAGGTGGTGTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 6, 2: 10, 3: 30, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998887147_998887152 -2 Left 998887147 5:146706377-146706399 CCAAGCTCACACCACCTGCATAG 0: 1
1: 6
2: 10
3: 30
4: 252
Right 998887152 5:146706398-146706420 AGCCGCTGGTGGTCTTCGTATGG 0: 7
1: 6
2: 18
3: 10
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998887147 Original CRISPR CTATGCAGGTGGTGTGAGCT TGG (reversed) Intronic
900244156 1:1629966-1629988 CTATGGAGGGAGTGTGATCTGGG - Intronic
901432563 1:9225960-9225982 AAATGCACGTGGTGTAAGCTAGG - Intergenic
901525295 1:9818056-9818078 GAATGCAAGTGGTGTGACCTTGG + Intronic
901936440 1:12630294-12630316 CCATGGAGCTGGTGGGAGCTGGG + Intergenic
902534901 1:17113953-17113975 CTATGCAGGGACTGTGAGCCTGG + Intronic
902549292 1:17209729-17209751 CTTTGCAGGCTGTGTGACCTTGG + Intronic
903890863 1:26569534-26569556 CTATGGAGGTGGACTGTGCTGGG + Intronic
904280562 1:29415466-29415488 CTATGCAGCTGTTCTCAGCTTGG + Intergenic
905800668 1:40840218-40840240 CAGTGCAGGTGGGGTGAGCCAGG - Exonic
906223665 1:44103495-44103517 CTATGCAGGTGCGCTGAGCTCGG - Intergenic
906939882 1:50246475-50246497 CCGTGAAGGTGGTGTCAGCTAGG + Intergenic
907162497 1:52381551-52381573 CTATGCTGGTGCTCTGAGGTTGG - Intronic
909928927 1:81472582-81472604 GAATGCAAGTGGTGTGATCTTGG - Intronic
910365699 1:86462752-86462774 GAGTGCAGGTGGTGTGATCTCGG + Intergenic
912812618 1:112805452-112805474 CTGGGCAGGTGGTGTGATCTAGG + Intergenic
915619845 1:157074506-157074528 CTATGCAGGTGGTCTGAGCTCGG + Intergenic
916015047 1:160742324-160742346 CTTTGAAGGTGGAGGGAGCTGGG - Intronic
917742733 1:177976540-177976562 CTATGCTGGTTGTGTGAAGTTGG + Intronic
917839534 1:178966500-178966522 CTAAGGAAGTGGTGAGAGCTGGG + Intergenic
918178896 1:182069212-182069234 GCATGTAGGTGGTGTGACCTGGG - Intergenic
918736517 1:188071197-188071219 CTAGGCAGCTGGTGTGATGTTGG + Intergenic
920400897 1:205675791-205675813 CTGTGGAGGAGGTGTGAGATTGG - Intronic
924859289 1:247904806-247904828 GTGTGCATGTGGTGTGAGCGTGG - Intergenic
1063055635 10:2501548-2501570 CTTTGCTGGTGAGGTGAGCTGGG - Intergenic
1064691254 10:17920634-17920656 CTATGCAGGTGACTTGACCTTGG + Intergenic
1067527068 10:47045439-47045461 AGATGCAGGTGTTGAGAGCTCGG - Intergenic
1070096327 10:73340948-73340970 CCATGGAGCTGGTGGGAGCTGGG - Intronic
1070603017 10:77878850-77878872 GTATGTAGGTGGTGGGAGCCAGG - Intronic
1070913614 10:80138665-80138687 ATTTGCAGATGGTGTGACCTTGG + Intronic
1073061453 10:100736094-100736116 GTAAGCAGGGAGTGTGAGCTGGG + Intronic
1075335546 10:121606592-121606614 CTATACAGGTGGTTTTAGCCAGG + Intergenic
1075449617 10:122540801-122540823 CGATGCAGGTGGGGAGACCTAGG - Intergenic
1076709093 10:132321304-132321326 CTCTGCAGGTGGGCTGGGCTTGG - Intronic
1077589582 11:3481186-3481208 GTGTGCGTGTGGTGTGAGCTTGG - Intergenic
1077730294 11:4722910-4722932 CTATGCAGGTGGTCTAAGCTCGG - Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1080748197 11:35127680-35127702 CTATGCTTGTGCTGTGGGCTGGG + Intergenic
1083143115 11:60737939-60737961 ATGAACAGGTGGTGTGAGCTTGG - Intronic
1084245304 11:67852960-67852982 GTGTGCGTGTGGTGTGAGCTTGG - Intergenic
1084827385 11:71741618-71741640 GTGTGCGTGTGGTGTGAGCTTGG + Intergenic
1088619880 11:111671129-111671151 CTACTCAGGTGGGCTGAGCTGGG - Intronic
1089662383 11:119993948-119993970 CAAGGCAGGTGTTCTGAGCTTGG + Intergenic
1089845525 11:121455093-121455115 CTATGGAGGTGCAGTGAGCTGGG + Intronic
1092184459 12:6468390-6468412 CTATGTAGGTGGAGTGAGTCAGG + Intronic
1092415871 12:8290092-8290114 GTGTGCGTGTGGTGTGAGCTTGG - Intergenic
1095312301 12:40714030-40714052 CTATCTATGTGGTGTGAGATGGG + Intronic
1095507057 12:42909076-42909098 CCATGAAGGTGGGGTGAGGTAGG + Intergenic
1096578191 12:52567877-52567899 CTATGCTAGTGGTGTGGTCTCGG - Intronic
1096626210 12:52897604-52897626 CTCACCAGGTGGTCTGAGCTCGG - Exonic
1097615602 12:61880576-61880598 CTACGCAGGAGGGCTGAGCTCGG + Intronic
1097684113 12:62676377-62676399 CCATGGAGCTGGTGGGAGCTGGG + Intronic
1098264738 12:68706876-68706898 CTATTCAGGTGGTCTGAGCTCGG + Intronic
1099195539 12:79610242-79610264 CTATGCAGCTTGGTTGAGCTGGG + Intronic
1101058952 12:100950747-100950769 CTGTGAAGGTGGTGAGAGGTAGG + Intronic
1105651129 13:22379191-22379213 CTATGCAAGTGTTGAGAGGTGGG + Intergenic
1107652823 13:42561736-42561758 CTATGAATGTGAAGTGAGCTTGG + Intergenic
1109802429 13:67398139-67398161 GTGTGCATGTGGTGTGAGCGTGG + Intergenic
1110653924 13:77974962-77974984 GTGTGCATGTGGTGTGAGCGTGG - Intergenic
1113434915 13:110283777-110283799 TTATGCTGGTGGGGTGAGCTTGG + Intronic
1113502949 13:110792938-110792960 CTGTGAAGTTGGTGGGAGCTGGG + Intergenic
1115572360 14:34678729-34678751 TTATTCAGGTGGTGTGAGCAAGG - Intergenic
1115662760 14:35512960-35512982 CTATGCAGGTGCTGGGGGCTTGG - Intergenic
1115951658 14:38728285-38728307 CTATGCAGGTGGGCTGAGCTCGG + Intergenic
1118057508 14:62096054-62096076 CTTTGCATGTGGTGTGAGGTAGG - Intronic
1118263241 14:64268073-64268095 CTAGCCAGGTGGAGAGAGCTGGG + Intronic
1120863543 14:89276226-89276248 GTGTGCAAGTGGTGTGATCTTGG - Intronic
1122007341 14:98716315-98716337 CTCTGCAGGTGCTGAGAACTTGG - Exonic
1122030338 14:98907410-98907432 CTGTGCTGGTGGTGTGGGCTGGG - Intergenic
1122096249 14:99375004-99375026 CCATGCAGGTGCTGGGTGCTGGG - Intergenic
1122878520 14:104679590-104679612 CCATCCATGTGGTGTGGGCTGGG - Intergenic
1124783390 15:32656979-32657001 CCATGCAGCTGGTCTGAGCTAGG - Intronic
1125840998 15:42801139-42801161 CTATGCAGGTGGTCAGAGCTTGG - Intronic
1126467357 15:48973165-48973187 CTATGCAGGTGCGCTGAGCTCGG + Intergenic
1126702405 15:51380131-51380153 CTAGGAAGGTGGTGGGAGTTGGG + Intronic
1127499461 15:59543077-59543099 TGATGCAGGTGGTCTGGGCTGGG + Intergenic
1127603932 15:60567313-60567335 CTAGGCAGGTGGTGTGAGTGTGG - Intronic
1127911312 15:63418333-63418355 CTTTGCTGGTTGTGTGTGCTTGG - Intergenic
1128802554 15:70505877-70505899 CTATGCGGGTGGGGAGAGGTGGG + Intergenic
1129246299 15:74280867-74280889 CTATGGAGGTGTGGTGAGGTGGG - Intronic
1129740383 15:77986971-77986993 CGAGGCAAGTGGTGTGGGCTGGG + Intronic
1129845369 15:78765626-78765648 CGAGGCAAGTGGTGTGGGCTGGG - Exonic
1130256479 15:82328233-82328255 CGAGGCAAGTGGTGTGGGCTGGG + Intergenic
1130598473 15:85261755-85261777 CGAGGCAAGTGGTGTGGGCTGGG - Intergenic
1131111639 15:89768160-89768182 GTGTGCAGGTGGCCTGAGCTTGG + Intronic
1132146152 15:99431231-99431253 CTCTGCTGGTGGCGTGACCTTGG + Intergenic
1133379163 16:5315514-5315536 CTCTGCAGGTGTTTTGAGCTGGG + Intergenic
1134765341 16:16752394-16752416 CTATTCAGGCTGTGTGACCTTGG - Intergenic
1134980715 16:18606817-18606839 CTATTCAGGCTGTGTGACCTTGG + Intergenic
1135743976 16:24999954-24999976 TTAAGAAGGTGGTGTGTGCTAGG - Intronic
1136711113 16:32238000-32238022 CTCTGCAGGCTGTGTGAGCCAGG + Intergenic
1136756794 16:32691407-32691429 CTCTGCAGGCTGTGTGAGCCAGG - Intergenic
1136811315 16:33178968-33178990 CTCTGCAGGCTGTGTGAGCCAGG + Intergenic
1136817791 16:33289048-33289070 CTCTGCAGGCTGTGTGAGCCAGG + Intronic
1136824355 16:33345577-33345599 CTCTGCAGGCTGTGTGAGCCAGG + Intergenic
1136829421 16:33444348-33444370 CTCTGCAGGCTGTGTGAGCCAGG + Intergenic
1139011868 16:62644653-62644675 CTGAGCGGGTGGAGTGAGCTTGG + Intergenic
1140753678 16:78048626-78048648 CTATGTAAGTGGTCTGAGCTCGG - Intronic
1140755088 16:78059622-78059644 GTGTGCGTGTGGTGTGAGCTTGG - Intronic
1142026227 16:87815460-87815482 CTTTGCAGATGGAATGAGCTAGG + Intergenic
1142365867 16:89649339-89649361 CTATGAAGGGGGTGAGTGCTGGG - Exonic
1202989893 16_KI270728v1_random:1937-1959 CTCTGCAGGCTGTGTGAGCCAGG + Intergenic
1203058944 16_KI270728v1_random:951759-951781 CTCTGCAGGCTGTGTGAGCCAGG - Intergenic
1142495744 17:305434-305456 CTAGGAGGTTGGTGTGAGCTGGG - Intronic
1142523251 17:519601-519623 CTGTGCAGGTGGTCTCAGCGGGG + Intronic
1143262914 17:5613721-5613743 CTAGGCAGTGGGTGTGGGCTGGG + Intronic
1143464143 17:7124397-7124419 CTGTTCAGGTGGCGTGAGCGGGG + Intergenic
1143994019 17:10991255-10991277 TGATGCAGGTGGTCTGGGCTGGG + Intergenic
1144386659 17:14754469-14754491 TGATTCAGGAGGTGTGAGCTGGG + Intergenic
1144742109 17:17589886-17589908 CTGTGCAGCTGGAGAGAGCTGGG - Intronic
1145736676 17:27238056-27238078 CTCTGCTGCTGCTGTGAGCTGGG - Intergenic
1146407924 17:32555739-32555761 CTTTGCACGTGGTGTGAGGAGGG - Intronic
1146572614 17:33965939-33965961 ATAGGCAAGTGGTCTGAGCTGGG - Intronic
1146893264 17:36522457-36522479 GAGTGCAGGTGGTGTGATCTCGG - Intronic
1148373287 17:47117376-47117398 ATGTGAAGGTGGGGTGAGCTGGG - Intergenic
1149914844 17:60599828-60599850 CTAGGAAGGTGGTGTGGGCTCGG - Intergenic
1152845307 17:82596171-82596193 ACCTGCAGTTGGTGTGAGCTGGG - Intronic
1203190317 17_KI270729v1_random:178060-178082 CTCTGCAGATGGTCTGAGATGGG - Intergenic
1153352138 18:4092727-4092749 CTCTCTAGGTGGTGTGAGCCTGG - Intronic
1154192520 18:12242743-12242765 TTTTGCAGGTGGTGTGAGAGAGG + Intergenic
1155043223 18:22082440-22082462 CTATGGAGGCGGTGAGACCTTGG - Intergenic
1157833790 18:50879891-50879913 CTCTGCATGTGGTGTTACCTAGG + Intronic
1158872285 18:61699578-61699600 CTGTGCAGGTGCTGGGGGCTGGG + Intergenic
1160203047 18:76810817-76810839 CTCTGCAGGTCCTGTGAGGTTGG + Intronic
1160393011 18:78549027-78549049 TTATGCAGGTGGAGTGGCCTGGG + Intergenic
1160759370 19:775318-775340 CCATGCTGGTGGCCTGAGCTGGG + Intergenic
1161673809 19:5630862-5630884 TTTTGCATGTGGTGTGAGGTAGG + Intronic
1162031260 19:7918134-7918156 GTATGGAGGTGGAGGGAGCTGGG + Intronic
1162281714 19:9703314-9703336 GTGTGCATGTGGTGTGAGCGTGG + Intergenic
1162851067 19:13431304-13431326 CTGTGAAGGTGGTGAGAGGTGGG + Intronic
1163692595 19:18745612-18745634 GTAGGGAGGGGGTGTGAGCTGGG - Intronic
1163966934 19:20754610-20754632 GTGTGCATGTGGTGTGAGCTTGG - Intronic
1164121817 19:22272622-22272644 GTATGCATGTGGTGTGAGCATGG - Intergenic
1165146890 19:33736522-33736544 CTATGCATCTTGTCTGAGCTTGG - Intronic
1165506906 19:36238820-36238842 CCATGCAGCTGGGGGGAGCTGGG - Intronic
925942643 2:8835606-8835628 GAGTGCAGGTGGTGTGATCTTGG - Intronic
927064456 2:19457438-19457460 CTCTGTCGGTGGTGTGATCTTGG + Intergenic
927168456 2:20348876-20348898 CAGTGCAGGTGGTGAGATCTGGG - Intronic
927312979 2:21651300-21651322 CTGGTCAGGTGCTGTGAGCTAGG - Intergenic
927432366 2:23037728-23037750 CAATGCAGTTGGTGTGGTCTGGG + Intergenic
927825212 2:26303922-26303944 CTATTCAGGTGGGGCGATCTGGG - Intergenic
928431565 2:31223051-31223073 CTATGCTGGTGCCGTGATCTCGG + Intronic
930552532 2:52852952-52852974 CTAGGCAGCTGGTGTGACCCAGG - Intergenic
931058120 2:58495507-58495529 CTATGGATGTGTTGTTAGCTTGG - Intergenic
932501737 2:72188163-72188185 CCATGGAGCTGGTGGGAGCTGGG - Intronic
933878052 2:86638883-86638905 CTTTGCATGTGGTGTGAGCTTGG + Intronic
934961832 2:98682610-98682632 TGATGAAGGTGGTGTCAGCTAGG - Intronic
935934815 2:108170426-108170448 CTGCCCAGGTGGTCTGAGCTGGG - Intergenic
936261828 2:110966398-110966420 CTAACCAGGAGGTGTGAGCAGGG + Intronic
937116058 2:119405755-119405777 CTATCCATGTGGGGGGAGCTTGG - Intergenic
939018155 2:136926104-136926126 CTATGAAGGTGGTGGGATTTGGG - Intronic
942558683 2:177198355-177198377 CTATGCAGGTGGTCTGAGCTCGG + Intergenic
943064400 2:183071216-183071238 CTATGCAGGTGGTCTGAGCTCGG - Intergenic
944763410 2:202840507-202840529 CTATGCAGGTGGTCTGAGCTCGG - Intronic
946023390 2:216657119-216657141 CAATGCAGGTGGTGGGAGTGGGG + Intronic
947279611 2:228435874-228435896 CTATTCATGTGGTTTTAGCTTGG - Intergenic
948470316 2:238173298-238173320 CTAGGCATGTGCTGTGTGCTGGG - Intronic
1169206257 20:3741966-3741988 CTATGAAGATGGTGTGAGGTGGG + Intronic
1170048600 20:12114296-12114318 ATATGCAGGGAGTGTGAACTGGG + Intergenic
1170456475 20:16538097-16538119 CTATGCAGGTGAGATGAACTAGG - Intronic
1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG + Intergenic
1171481324 20:25457992-25458014 CAGTGCAGGTGGTGGGAGATGGG - Intronic
1172829128 20:37817545-37817567 TTATACAGCTGGTGTGAGCTGGG - Intronic
1172920697 20:38479535-38479557 CTCTGGAGGTTGTGTGTGCTGGG - Intronic
1173528660 20:43751865-43751887 CTTTGCTGGTGGTGTGACTTTGG + Intergenic
1174871621 20:54187932-54187954 CTAAGGAGATGGTGAGAGCTTGG - Intergenic
1176104463 20:63379400-63379422 CTGTGGAGCTGGTGGGAGCTGGG + Intergenic
1178364866 21:31981032-31981054 CTTTGCAGATGGTGTGAGACAGG + Intronic
1180973154 22:19826281-19826303 CTCTCAAGGTGGTGTGAGTTAGG - Intronic
1180976949 22:19853861-19853883 CTTGGCTGGTGGTGGGAGCTGGG - Intronic
1182155195 22:28065087-28065109 CTATGCAAGGGGTGTGGCCTGGG - Intronic
1182575218 22:31268289-31268311 CTATGCAACTTGTGTGGGCTGGG + Intronic
1182772974 22:32809192-32809214 GGTTGCAAGTGGTGTGAGCTTGG - Intronic
1183830238 22:40415006-40415028 CTGGGCAGGTGGTGGCAGCTGGG - Intronic
1184335872 22:43852797-43852819 CTCAGCTGGTGCTGTGAGCTGGG - Intronic
1184699673 22:46162212-46162234 CCTGGCAGGTAGTGTGAGCTTGG + Intronic
1185020036 22:48369031-48369053 CTTTGCATGTGGTGTGAGTCAGG - Intergenic
1185083102 22:48720607-48720629 CTATGCAGGTGCGGGGAGCCTGG + Intronic
949845238 3:8362970-8362992 CTATGTGGGTGGTGTGTGGTAGG + Intergenic
950028661 3:9837561-9837583 CTAGGCAGTGGGTGTGATCTTGG + Intronic
953051711 3:39350179-39350201 CTATTCAGATGGGGTGATCTGGG - Intergenic
953160033 3:40410388-40410410 CAGTGCAGTTGGTGTGATCTCGG - Intronic
953880544 3:46689176-46689198 TGATGCAGGTGGTGCGATCTTGG - Intronic
955517306 3:59739204-59739226 TTTTGCATGTGGTGTGAGGTAGG + Intergenic
956190989 3:66608299-66608321 CTATGAACATGGTGTGAACTTGG + Intergenic
959955391 3:112232301-112232323 TTATGCAGGTGGTCTGAGCAGGG - Intronic
960634407 3:119768807-119768829 CCATGGAGCTGGTGGGAGCTAGG - Intergenic
962265872 3:133943936-133943958 CTGTGCAGTTAGTGTAAGCTAGG - Intronic
962712781 3:138101657-138101679 CTATGCAGGTGGTCTGAGCTCGG - Intronic
964522978 3:157587021-157587043 GTGTGCATGTGGTGTGAGCGTGG - Intronic
964802276 3:160569048-160569070 CTATGCAGGTGATCTGAGCTCGG + Intergenic
964933321 3:162051738-162051760 GTGTGCATGTGGTGTGAGCATGG - Intergenic
965176965 3:165347211-165347233 CTATGCAAGTGCTCTTAGCTGGG - Intergenic
966508296 3:180731700-180731722 GTGTGCAGGTGGTGTGATCTCGG - Intronic
966820218 3:183918131-183918153 CTAGGGAGGTGGTGTGTACTGGG - Intergenic
967147885 3:186621345-186621367 CTATGCATGTGAGGGGAGCTGGG - Intergenic
969662383 4:8537848-8537870 CTCGGCAGGTGGGGTGAGGTGGG + Intergenic
969749344 4:9098420-9098442 GTGTGCGTGTGGTGTGAGCTTGG + Intergenic
972600240 4:40565703-40565725 CTCTGAAGATGGTGTGAGCTGGG - Intronic
972600411 4:40567015-40567037 CTCTGAAGATGGTGTGAGCTGGG + Intronic
974555110 4:63436233-63436255 CTTTGCATATGGTGTGAGGTAGG - Intergenic
975205406 4:71639271-71639293 GTGTGCATGTGGTGTGAGCTTGG + Intergenic
977928636 4:102728898-102728920 TTATGCAGGTGATCTGAGCTCGG - Intronic
979009948 4:115355123-115355145 CAATGGAGGTGGTGTTGGCTTGG + Intergenic
979819942 4:125158558-125158580 CTTTGCAGGTGGTCTTGGCTAGG + Intergenic
980903197 4:138924498-138924520 CTATGCAGGTGGGTTGAGATGGG + Intergenic
984526868 4:180867438-180867460 CCACGGAGGTGGTGTGGGCTGGG - Intergenic
986318009 5:6604058-6604080 AAATGCAGGTGGTGTGCGTTGGG - Intronic
989107606 5:37878433-37878455 CTCTGCTGCTGATGTGAGCTTGG + Intergenic
996432874 5:123401068-123401090 CTATGCAAGTGGTCTGAGCTCGG - Intronic
998887147 5:146706377-146706399 CTATGCAGGTGGTGTGAGCTTGG - Intronic
1001250298 5:170141818-170141840 CTATGCAGGCGCTGGGGGCTCGG - Intergenic
1002525147 5:179811409-179811431 CTATGCAGGGGGGAGGAGCTTGG + Intronic
1003418922 6:5938488-5938510 CTCTGCAGGTGGTGTGGGATTGG - Intergenic
1004408156 6:15354341-15354363 CTGTGCTGGTGGTGTTAGCAAGG - Intronic
1004742030 6:18471500-18471522 CAATCCAGGTGGTGTGGGGTTGG + Intergenic
1006060057 6:31412765-31412787 GCATCCAGGTGGGGTGAGCTGGG + Intronic
1006358728 6:33575708-33575730 CTGTGCAGGTCCTGGGAGCTGGG - Intronic
1009631230 6:66203178-66203200 CTGAGCAGGTGGAGTGAGCCTGG + Intergenic
1010897390 6:81381410-81381432 CAATGCGGGTGGTGTGGGGTGGG - Intergenic
1012698477 6:102420608-102420630 CATTGGAGGTGGTGTTAGCTTGG + Intergenic
1013189471 6:107789834-107789856 CTTTGCTGGTCCTGTGAGCTGGG - Intronic
1014902300 6:126982503-126982525 TTTTGCATGTGGTGTGAGGTAGG - Intergenic
1016808607 6:148237943-148237965 CTATGTAGGTGGTGTCCACTGGG - Intergenic
1017588217 6:155949412-155949434 CCATGCAGGAGGTGAAAGCTAGG + Intergenic
1018317295 6:162569530-162569552 CTATGCAGATGGTCTGAGCTTGG + Intronic
1018423508 6:163660624-163660646 CTATGGAGGTGCAGTGGGCTGGG + Intergenic
1019100815 6:169627815-169627837 CTCTGCATGGGCTGTGAGCTGGG - Intronic
1019138466 6:169927494-169927516 AGAGGCAGGTGGTGTGAACTTGG + Intergenic
1019778545 7:2926496-2926518 CTGTGCAGAGGGTGCGAGCTAGG - Intronic
1020323649 7:6958220-6958242 GTGTGCGTGTGGTGTGAGCTTGG - Intergenic
1022489882 7:30808494-30808516 TTGTGCATGTGGTGTGAGCGTGG + Intronic
1022609151 7:31851319-31851341 ACATGCAGATGGTGTCAGCTGGG + Intronic
1023133006 7:37022077-37022099 CTTTGCAGATGGTATGAGGTAGG - Intronic
1023826315 7:44012289-44012311 CCATGCCCGTGGTGTGATCTGGG + Intergenic
1026724403 7:72859350-72859372 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1026746563 7:73017707-73017729 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1026750215 7:73045850-73045872 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1026753862 7:73073960-73073982 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1026757513 7:73101996-73102018 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1027032666 7:74902265-74902287 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1027089891 7:75291490-75291512 CCATGCCCGTGGTGTGATCTGGG + Intergenic
1027093536 7:75319418-75319440 CCATGCCCGTGGTGTGATCTGGG + Intergenic
1027097179 7:75347385-75347407 CCATGCCCGTGGTGTGATCTGGG + Intergenic
1027119483 7:75506473-75506495 CCATGCCCGTGGTGTGATCTGGG + Intergenic
1027272342 7:76529138-76529160 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1027322169 7:77020285-77020307 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1027325801 7:77048204-77048226 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1029177402 7:98674763-98674785 ATATGCAGATGTTGAGAGCTGGG + Intergenic
1029398288 7:100324386-100324408 CCATGCCCGTGGTGTGATCTGGG + Intergenic
1029718012 7:102343559-102343581 CCATGCCCGTGGTGTGATCTGGG - Intergenic
1029754602 7:102565686-102565708 CCATGCCCGTGGTGTGATCTGGG + Intronic
1029772553 7:102664770-102664792 CCATGCCCGTGGTGTGATCTGGG + Intronic
1030064497 7:105648926-105648948 ATGTGCAGGTGGTGAGACCTGGG + Intronic
1030900464 7:115117248-115117270 CAATGCAGTTGATGTGAGCATGG + Intergenic
1031860759 7:126977553-126977575 CTTTGGAGGTGATGTGTGCTAGG - Intronic
1035163189 7:156966461-156966483 CTTTGCAGGTGGGTTGAGCCAGG - Intronic
1035393073 7:158518033-158518055 CAATGCAGTTGGCGAGAGCTGGG - Intronic
1036372415 8:8172763-8172785 GTGTGCGTGTGGTGTGAGCTTGG + Intergenic
1036798677 8:11773672-11773694 CGATGGAGGTGGAGTGAGCAGGG + Intronic
1036817211 8:11911102-11911124 GTGTGCGTGTGGTGTGAGCTTGG - Intergenic
1036878488 8:12492878-12492900 GTGTGCGTGTGGTGTGAGCTTGG - Intergenic
1036918311 8:12826668-12826690 ATCTGCTGGTGGTGTGATCTTGG - Intergenic
1037154398 8:15682677-15682699 CTATCGTGGTGGTGTTAGCTGGG + Intronic
1038660292 8:29491368-29491390 CTATGCAGGTGCTGGGAGGGTGG - Intergenic
1041781178 8:61579473-61579495 CTATGCAGGTGGTCTGAGCTCGG + Intronic
1042131730 8:65593980-65594002 GAGTGCAGGTGGTGTGATCTTGG - Intergenic
1042364961 8:67925305-67925327 TTAGGCAGGTGGTGTGAACCTGG - Intergenic
1043305752 8:78792256-78792278 TTATGTACGTGGTGTGAGGTAGG - Intronic
1046775325 8:118158409-118158431 CCATGGAGCTGGTGGGAGCTGGG + Intergenic
1050570099 9:6928849-6928871 CTATGGAAGTAGTGTGAGCAGGG + Intronic
1052546142 9:29882326-29882348 CTATTTAGGTGATGTGAGTTAGG - Intergenic
1056438561 9:86597309-86597331 CCATGCTGGTGCTCTGAGCTTGG - Intergenic
1056473488 9:86929046-86929068 CAGTGCAAGTGGTGTGATCTCGG - Intergenic
1057836422 9:98449129-98449151 CTGTGCATGTGGTGGGAGCAAGG - Intronic
1057943693 9:99306413-99306435 CTATGCAGGTGGGCTGAGCTCGG + Intergenic
1059098837 9:111449890-111449912 CTGTGCAGGTGTTCTGAGCTGGG - Intronic
1059800154 9:117742021-117742043 CTAGGCAGGTTGTGTGACCTTGG + Intergenic
1060284018 9:122233014-122233036 CTAGGAAGGTAATGTGAGCTGGG + Intergenic
1061386473 9:130293560-130293582 CAAAGGAGGAGGTGTGAGCTGGG + Intronic
1061851970 9:133421680-133421702 CGATGCAGGAGGAGAGAGCTGGG + Intronic
1061897807 9:133657602-133657624 AAATGCAGGTGGTGTGAGCAGGG + Intronic
1061949397 9:133927791-133927813 CCATGCCAGTGGTGTGAGGTAGG - Intronic
1062261957 9:135667292-135667314 CTGTGCTGGGGGTGTGCGCTGGG + Intergenic
1062480490 9:136748655-136748677 CTGTGCAGCTGGTCTGATCTGGG - Intergenic
1189856577 X:45229960-45229982 CCATGGAGCTGGTGGGAGCTAGG - Intergenic
1190770954 X:53513631-53513653 GTGTGCATGTGGTGTGAGCATGG + Intergenic
1190934804 X:54988809-54988831 ATTTGCATGTGGTGTGAGATGGG - Intronic
1191220798 X:57985935-57985957 CTATGCAGGTAGTCTGAGCTCGG + Intergenic
1194399948 X:93430670-93430692 GTGTGCGTGTGGTGTGAGCTCGG + Intergenic
1196423254 X:115544342-115544364 GTGTGCATGTGGTGTGAGCATGG - Intergenic
1197076790 X:122363254-122363276 CACTGCAGGTGGTGTTGGCTTGG + Intergenic
1197617814 X:128714610-128714632 CTATGCAGGTGCTGGGGCCTCGG + Intergenic
1198619169 X:138487831-138487853 CTACTCAGGTGGGCTGAGCTTGG - Intergenic
1199927304 X:152480826-152480848 TTTTGCAGGTGGTCTGAGCTCGG + Intergenic
1200420458 Y:2960113-2960135 CTGTGCAAGTTGTGTGATCTTGG + Intronic
1200947771 Y:8863739-8863761 GTATGCGTGTGGTGTGAGTTTGG + Intergenic
1201260307 Y:12152839-12152861 GTGTGCATGTGGTGTGAGCACGG - Intergenic
1201358186 Y:13117800-13117822 CCATTCAGGTGGGGTGATCTGGG - Intergenic
1201951649 Y:19571788-19571810 ATTTGCAGGTGGTGTGGGATGGG + Intergenic