ID: 998887174

View in Genome Browser
Species Human (GRCh38)
Location 5:146706559-146706581
Sequence CAGCTCGGACAGCTTAGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 7, 2: 13, 3: 16, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998887169_998887174 5 Left 998887169 5:146706531-146706553 CCTACTTGGTCTGCTGAAGGGCG 0: 1
1: 0
2: 0
3: 8
4: 112
Right 998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG 0: 1
1: 7
2: 13
3: 16
4: 49
998887165_998887174 16 Left 998887165 5:146706520-146706542 CCGCGCCATGTCCTACTTGGTCT 0: 1
1: 0
2: 3
3: 15
4: 99
Right 998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG 0: 1
1: 7
2: 13
3: 16
4: 49
998887166_998887174 11 Left 998887166 5:146706525-146706547 CCATGTCCTACTTGGTCTGCTGA 0: 1
1: 0
2: 0
3: 14
4: 152
Right 998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG 0: 1
1: 7
2: 13
3: 16
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998887174 Original CRISPR CAGCTCGGACAGCTTAGCGT TGG Intronic
904878815 1:33678662-33678684 CAGCTCGGTCAGCTTAGAGGGGG - Intronic
904896178 1:33820097-33820119 CAGTTAGGGCAGCTAAGCGTGGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
916766789 1:167868602-167868624 CTGGTCAGGCAGCTTAGCGTAGG - Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1077421538 11:2452429-2452451 CAGCCCGGGCAGCTTAGAGGAGG + Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1084091691 11:66883028-66883050 GAGCCCGGACAGCTGAGCCTCGG - Intronic
1084263230 11:67991840-67991862 CAGCACCGCCAGCTTAGCCTGGG + Exonic
1084810172 11:71607287-71607309 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1092609111 12:10153562-10153584 CAGCCCGGACAGCCTAGCAAAGG - Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100244144 12:92739520-92739542 AAGCTTGGACAGCTTACAGTGGG - Intronic
1108911376 13:55556018-55556040 CATCTGGGACAGGTTAGGGTGGG - Intergenic
1110834466 13:80067559-80067581 AAGTTCGCACAGCTTAGAGTTGG + Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1119105317 14:71917843-71917865 CAGCTAGGACTTCTTAGCGGTGG + Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1143091740 17:4452964-4452986 CAGCTGGGTGAGCTTAGCATAGG - Intronic
1143335523 17:6169160-6169182 CAGCTGGGACAGTTTAGGGCAGG - Intergenic
1150120899 17:62601368-62601390 CAACTCTAACAGCTTAGCTTGGG + Intronic
1151465426 17:74281915-74281937 CTGCTCGGCCAGCTCAGGGTTGG - Exonic
1152841313 17:82570521-82570543 CAGCGCTGACAGCTCAGAGTGGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
933971192 2:87471169-87471191 CAGCTGGGACACCTGTGCGTGGG - Intergenic
936322537 2:111479020-111479042 CAGCTGGGACACCTGTGCGTGGG + Intergenic
942437922 2:176001732-176001754 CAAAGCGGACAGCTGAGCGTAGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
949069448 2:242015265-242015287 CAGCTCAGTCATCTTAGCATGGG + Intergenic
1170207780 20:13817924-13817946 AAGCTCAGACAGCTTAGGATAGG + Exonic
1170400811 20:15981147-15981169 CTGGTCAGGCAGCTTAGCGTAGG + Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962096410 3:132297322-132297344 CTGGTCAGGCAGCTTAGCGTAGG + Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
969732118 4:8963665-8963687 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
969791713 4:9497750-9497772 CAGCACCGCCAGCTTAGCCTGGG - Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991306742 5:65184976-65184998 GAGCTCAGACAGCTGAGAGTTGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1006570865 6:35003006-35003028 CTGGTCAGGCAGCTTAGCGTAGG - Intronic
1011372662 6:86654388-86654410 CATCTCTGCCATCTTAGCGTTGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1020309168 7:6855780-6855802 CAGCACCGCCAGCTTAGCCTGGG + Intergenic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1029715032 7:102321190-102321212 CAACTCGGAAACCTGAGCGTGGG + Intronic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1032979307 7:137263792-137263814 CTGGTCAGGCAGCTTAGCGTAGG + Intronic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1187063889 X:15814252-15814274 CAGCCTGGTCAGCTTAGCCTTGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1190537338 X:51442151-51442173 CAGCTCTCACAGGTTAGAGTAGG - Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1199406159 X:147463176-147463198 CAGCTCTGACAGCTGAGTGGAGG - Intergenic
1202148652 Y:21825230-21825252 CATCTCTGACAGCCTAGCGTGGG + Intergenic