ID: 998890993

View in Genome Browser
Species Human (GRCh38)
Location 5:146745664-146745686
Sequence GATAAATTGTCGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1022
Summary {0: 1, 1: 0, 2: 8, 3: 124, 4: 889}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998890989_998890993 25 Left 998890989 5:146745616-146745638 CCTTCTGGCATGAAGAGAAAATG 0: 1
1: 0
2: 2
3: 40
4: 330
Right 998890993 5:146745664-146745686 GATAAATTGTCGGCCAGGTGTGG 0: 1
1: 0
2: 8
3: 124
4: 889

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998890993 Original CRISPR GATAAATTGTCGGCCAGGTG TGG Intronic
900847405 1:5114926-5114948 GGTAAATTGCTGGGCAGGTGGGG - Intergenic
901151075 1:7102217-7102239 AATAAATTCCCTGCCAGGTGAGG - Intronic
901525183 1:9817074-9817096 GATGATTCTTCGGCCAGGTGCGG + Intronic
902118803 1:14144006-14144028 GAAAACTAGTTGGCCAGGTGCGG - Intergenic
902426344 1:16325914-16325936 ATGAAATTTTCGGCCAGGTGTGG - Intronic
902648864 1:17823450-17823472 GATAAATTGCCAACCAGGTGTGG + Intronic
903043184 1:20547491-20547513 AACAAAATGTTGGCCAGGTGCGG + Intergenic
903147273 1:21382592-21382614 GATTAATGGCTGGCCAGGTGTGG + Intergenic
903490713 1:23726109-23726131 AAAAAATTTTAGGCCAGGTGCGG - Intergenic
903612383 1:24625177-24625199 GGTAAATTGGGGGCCAGGCGCGG - Intergenic
904100909 1:28026323-28026345 GAGAAATACTAGGCCAGGTGTGG + Intronic
904156540 1:28488026-28488048 AACAATTTGTTGGCCAGGTGTGG - Intronic
904162073 1:28529472-28529494 GAAAAACAGACGGCCAGGTGTGG - Intronic
904228719 1:29048076-29048098 TATAAATTGTCAGCCAGGCTCGG - Intronic
904258748 1:29274758-29274780 AATAAATTATTGGCCGGGTGCGG + Intronic
904561700 1:31402559-31402581 AATGAATTTTAGGCCAGGTGCGG - Intergenic
905190968 1:36234224-36234246 AATAAAATGTTGGCCGGGTGTGG - Intronic
905413642 1:37789915-37789937 GGTCAATTATTGGCCAGGTGTGG - Intergenic
905499721 1:38426888-38426910 GGTAAATTGCTGGGCAGGTGGGG - Intergenic
905583653 1:39101064-39101086 AAGAAATAGTTGGCCAGGTGCGG + Intronic
905735287 1:40320810-40320832 GATAAATTTTAGGCCAGGCAAGG + Intergenic
905978563 1:42200771-42200793 GAAATATTGAAGGCCAGGTGCGG - Intronic
906272027 1:44487042-44487064 TAAAAATTGTCATCCAGGTGCGG + Intronic
907164570 1:52398873-52398895 GATTAAGGATCGGCCAGGTGTGG - Intronic
907390557 1:54155360-54155382 GAAAGACTGTCGGCCGGGTGCGG + Intronic
908212684 1:61917761-61917783 AAGAAATTATTGGCCAGGTGTGG + Intronic
908466177 1:64398096-64398118 GATCTATTGCTGGCCAGGTGTGG + Intergenic
908750388 1:67416969-67416991 AATAAAAAGTAGGCCAGGTGTGG + Intronic
908891547 1:68854446-68854468 CAAAAATTCTGGGCCAGGTGTGG - Intergenic
908912808 1:69092379-69092401 GATAATTTCTAGGCCGGGTGTGG + Intergenic
909222715 1:72983734-72983756 AATAAATTGCTGGGCAGGTGCGG + Intergenic
909635428 1:77812021-77812043 AAGAAATTTTAGGCCAGGTGTGG + Intronic
909646359 1:77921617-77921639 TAAAAATTTTTGGCCAGGTGTGG + Intronic
909930052 1:81487352-81487374 GATATATTGAAGGCCAGGTGTGG + Intronic
910243526 1:85114301-85114323 GATAAATTGTAGGCCAGGCGTGG - Intronic
910631770 1:89362840-89362862 GTAAAATTCTGGGCCAGGTGCGG - Intergenic
910881737 1:91927850-91927872 GATAAATTGGGTGCCAGATGTGG - Intergenic
912047337 1:105475825-105475847 TTTATATTATCGGCCAGGTGTGG + Intergenic
912058483 1:105634681-105634703 TATATATTGTTGGCCAGGCGTGG + Intergenic
912176074 1:107158917-107158939 TATAAATTGTCTGCCAGATATGG + Intronic
912426313 1:109594925-109594947 TATAAATTGCCAGCCAGGTGCGG - Exonic
913180820 1:116319634-116319656 TAAAAATTTTCGGCCAGGCGCGG + Intergenic
914744895 1:150494447-150494469 TACAGACTGTCGGCCAGGTGCGG + Intronic
914836536 1:151211504-151211526 GATATTTTGTTGGCCAGGCGTGG + Intronic
914841609 1:151253659-151253681 GACACGTTGCCGGCCAGGTGTGG + Intergenic
914854164 1:151338212-151338234 GATACAATTTGGGCCAGGTGCGG + Intergenic
915371650 1:155356342-155356364 TTTAAATTATTGGCCAGGTGTGG + Intronic
915413797 1:155724343-155724365 AATAAATTTTAGGCCAGGTGCGG + Intronic
916133114 1:161629135-161629157 TAAAAATTATTGGCCAGGTGTGG + Intronic
916358407 1:163939115-163939137 GTGAAATTTTAGGCCAGGTGTGG + Intergenic
916789940 1:168116317-168116339 AATAAATTATCCTCCAGGTGAGG + Intronic
916902467 1:169244340-169244362 ATTAAGTTGTTGGCCAGGTGCGG + Intronic
917670113 1:177265828-177265850 AATAAAGTGTAGGCCAGCTGCGG + Intronic
917766743 1:178228289-178228311 AAAAAATTGTGGGCCGGGTGCGG + Intronic
918223415 1:182456586-182456608 GATTACTTCTCGGCCAGGCGTGG - Intronic
918274012 1:182933192-182933214 AGTAAATTGCTGGCCAGGTGAGG - Intronic
918462468 1:184790451-184790473 GACAAGATGTAGGCCAGGTGAGG + Intergenic
918714467 1:187769400-187769422 AATAAATTGCTGGGCAGGTGGGG + Intergenic
919100429 1:193090092-193090114 GATGAAAAGTTGGCCAGGTGCGG - Intronic
919476342 1:198036600-198036622 AATAAATTGCTGGGCAGGTGGGG - Intergenic
919715422 1:200770702-200770724 TAGAAATAGTAGGCCAGGTGCGG - Intronic
919817372 1:201449983-201450005 AATAAATCCTCGGCCAGGCGTGG - Intergenic
920091930 1:203460564-203460586 TATGAATTGTCGGCCGGGCGCGG + Intergenic
920324223 1:205149189-205149211 AAAAAACTTTCGGCCAGGTGCGG - Intronic
920454675 1:206090495-206090517 GAGGAATTGTGGGCCAGGCGCGG - Intronic
920971181 1:210744910-210744932 TATAAATTGTTGGCCAGGCATGG + Intronic
921002580 1:211058988-211059010 GAGAAAAAGTCAGCCAGGTGCGG + Intronic
921224306 1:213002625-213002647 TAAAAATTGTTGGCCAGGTGCGG + Intronic
921653980 1:217712414-217712436 AACATATTGTAGGCCAGGTGCGG - Intronic
921850994 1:219931769-219931791 TATAAAATGCTGGCCAGGTGTGG - Intronic
921941622 1:220846301-220846323 AATAAAGTATTGGCCAGGTGTGG + Intergenic
922400342 1:225247734-225247756 GACAAATTTTTGACCAGGTGTGG + Intronic
922523297 1:226277052-226277074 AAAAAATTTACGGCCAGGTGTGG + Intronic
922906341 1:229176227-229176249 AATAAATTGCTGGGCAGGTGGGG - Intergenic
922954783 1:229589947-229589969 TATGAATTTTTGGCCAGGTGTGG + Intergenic
923625642 1:235611771-235611793 GATGAAGTATTGGCCAGGTGTGG + Intronic
1063096039 10:2909933-2909955 GATAATTTTTGGGCCAGGTGTGG - Intergenic
1063967302 10:11356498-11356520 GATACCTTTTAGGCCAGGTGCGG + Intergenic
1064036760 10:11919906-11919928 AATACATTCTCGGCCGGGTGCGG - Intergenic
1064401646 10:15026196-15026218 GACAAATTCTCGGCCGGGCGCGG - Intergenic
1064439286 10:15339112-15339134 AATAAAATATCTGCCAGGTGTGG - Intronic
1064440815 10:15351761-15351783 AATAAATTTAAGGCCAGGTGTGG + Intronic
1065142179 10:22728582-22728604 GATACCTTGCCGGCCAGGGGTGG - Intergenic
1065434579 10:25693822-25693844 GAAAAACTATTGGCCAGGTGTGG - Intergenic
1066333366 10:34449205-34449227 GATAATTTATCTGCCGGGTGCGG - Intronic
1066439299 10:35423182-35423204 TAAAAATTTTCGGCCAGGTGTGG + Intronic
1066637169 10:37515717-37515739 GAATAATTAGCGGCCAGGTGTGG + Intergenic
1067015060 10:42752489-42752511 TGTAAATTGTCGGCCGGGCGCGG - Intergenic
1067115445 10:43432330-43432352 AAAAAATTTTAGGCCAGGTGCGG - Intergenic
1067396532 10:45925009-45925031 GATCACTTGGAGGCCAGGTGTGG - Intergenic
1067410903 10:46063783-46063805 GAAACTTTCTCGGCCAGGTGCGG + Intergenic
1068365690 10:56046543-56046565 AATAAAATATTGGCCAGGTGAGG - Intergenic
1069033290 10:63620221-63620243 TATAAACTGCTGGCCAGGTGAGG - Intronic
1069041631 10:63701656-63701678 TAAAAATTGCCGGCGAGGTGCGG - Intergenic
1069436594 10:68389636-68389658 GATAAATTGTTGGCCAGGCATGG + Intronic
1069496554 10:68909114-68909136 AATACACTGTCGGCCAGGCGTGG - Intronic
1069746461 10:70717838-70717860 TATGTATTGTCAGCCAGGTGGGG - Intronic
1069779712 10:70947175-70947197 GTTAAACAGGCGGCCAGGTGTGG + Intergenic
1070026178 10:72634571-72634593 AACATATTGTAGGCCAGGTGTGG - Intergenic
1070238179 10:74652468-74652490 GATAGCCTGTAGGCCAGGTGTGG + Intronic
1070914892 10:80146946-80146968 AATAAAATGTGGGCCAGGTGTGG - Intergenic
1071389072 10:85152256-85152278 AGTAAAATGTCAGCCAGGTGTGG + Intergenic
1071613755 10:87055823-87055845 GATATATTGACGGCCGGGCGCGG + Intronic
1071916146 10:90296812-90296834 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1072066485 10:91876523-91876545 AAAAAATTGTTGGCCAGGAGTGG + Intergenic
1072235467 10:93449779-93449801 AATACATTCTGGGCCAGGTGTGG - Intronic
1072344987 10:94495811-94495833 TAGAGATTGTCGGCCAGATGCGG + Intronic
1073485485 10:103815598-103815620 GAAAAATACTGGGCCAGGTGCGG + Intronic
1073553115 10:104421893-104421915 CTTAAATTTTAGGCCAGGTGTGG + Intronic
1074067019 10:110025184-110025206 AATAAAATGACAGCCAGGTGCGG - Intronic
1074840110 10:117342778-117342800 GATTAATTGTGGGCTGGGTGTGG - Intronic
1074842524 10:117369447-117369469 AAGACATTGTTGGCCAGGTGCGG - Intronic
1075049265 10:119170602-119170624 AAAAAATGGTCTGCCAGGTGCGG + Intronic
1075248640 10:120846658-120846680 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1076213299 10:128670199-128670221 GAAAACTTCTCGGCCAGGCGCGG - Intergenic
1076410778 10:130248142-130248164 GAGAAGTTATAGGCCAGGTGTGG + Intergenic
1076504585 10:130963365-130963387 GATGAATTGTCGGCAGGGCGCGG + Intergenic
1077534441 11:3114890-3114912 AAGAAAATGTCGGCCAGGTGCGG - Intronic
1077883290 11:6367581-6367603 GAGAAATTGCTGGGCAGGTGGGG - Intergenic
1078123962 11:8540188-8540210 AAGAAACTGTTGGCCAGGTGTGG + Intronic
1078150283 11:8752944-8752966 GATCAATTTTGGGCCAGGTGTGG + Intronic
1078213947 11:9295822-9295844 AATAATTTATAGGCCAGGTGCGG - Intronic
1078216028 11:9312613-9312635 GAATAATTGTAGGCCAGGCGTGG + Intronic
1078219171 11:9336991-9337013 AATAAAATCTCGGCCAGATGTGG + Intergenic
1078557833 11:12344816-12344838 AAGAAATTGTGGACCAGGTGCGG + Intronic
1078785036 11:14482080-14482102 GAGCAAATGTGGGCCAGGTGTGG - Intronic
1079431471 11:20393156-20393178 AACTAATAGTCGGCCAGGTGTGG + Intronic
1079447403 11:20569596-20569618 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1079495572 11:21039474-21039496 GAAAAATTCCTGGCCAGGTGTGG - Intronic
1079611012 11:22432665-22432687 GATAAAATGGCTGCCAGGAGGGG - Intergenic
1080172772 11:29325715-29325737 AATAAATTACCGGCCAGGCGTGG - Intergenic
1081626247 11:44657214-44657236 AATAAATTTTAGGCCAGGTGTGG + Intergenic
1081680979 11:45002580-45002602 TATAAATTCTAGGCTAGGTGCGG + Intergenic
1081865678 11:46358850-46358872 AATAACATGTGGGCCAGGTGTGG + Intronic
1081886579 11:46502768-46502790 ATTAAATTGTGGGCCAGATGTGG + Intronic
1082011298 11:47451252-47451274 CATTTATTGTGGGCCAGGTGCGG - Intergenic
1082635973 11:55594425-55594447 AAGAAATTGTTAGCCAGGTGTGG - Intergenic
1083200338 11:61117787-61117809 AATTAATTTTAGGCCAGGTGTGG - Intronic
1083549952 11:63580363-63580385 CAGAAATTATCGGCCAGGTGTGG + Intronic
1083564978 11:63706491-63706513 AACAAATTGTTGGCCAGGTGTGG - Intronic
1083884692 11:65566736-65566758 GATATATTGTCGGCAAGGGAAGG + Intergenic
1084065639 11:66702453-66702475 CATCAAATGTCGGCCAGGCGAGG - Intronic
1084115186 11:67039011-67039033 AATAAATAGTTGGCCAGGAGTGG + Intronic
1084137161 11:67193278-67193300 GTTTAAGTCTCGGCCAGGTGCGG - Intronic
1084293724 11:68195864-68195886 AATGAATTTTTGGCCAGGTGTGG + Intronic
1084307343 11:68295679-68295701 AATAAATTCCAGGCCAGGTGTGG + Intergenic
1084781630 11:71413548-71413570 AATAAATTCTGGGCCAGGTGCGG - Intergenic
1086182466 11:83969861-83969883 TATTCATTATCGGCCAGGTGTGG - Intronic
1086272105 11:85079918-85079940 GATACCTAGTGGGCCAGGTGTGG - Intronic
1086283382 11:85216982-85217004 GAGATATTGTAGGCCAGGCGCGG - Intronic
1086458924 11:86986261-86986283 GATAAGTGGCCGGCCAGGCGCGG + Intergenic
1087030903 11:93703252-93703274 GAAAAAATGTAGACCAGGTGCGG - Intronic
1087060721 11:93974473-93974495 AATAAATTCTGGGCCAGATGTGG + Intergenic
1087196855 11:95311338-95311360 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1087295481 11:96368108-96368130 AATAAATTCCAGGCCAGGTGTGG - Intronic
1087734759 11:101819509-101819531 TATATATTTTGGGCCAGGTGTGG + Intronic
1088295202 11:108286039-108286061 GTTAAATTCTTGGCCGGGTGCGG + Intronic
1088307108 11:108422216-108422238 GAATAAGTGTCGGCCAGGCGCGG - Intronic
1088333231 11:108674802-108674824 GATCTATTGTAGGCCAGGCGTGG - Intronic
1088609896 11:111566877-111566899 GATGAATTGTCTGCCAAATGTGG - Intergenic
1088611027 11:111577267-111577289 AAAAAGTTGTCGGCCAGGCGCGG + Intergenic
1088677415 11:112208250-112208272 AATCAATTGCCGGCCAGGTGCGG - Intronic
1088934926 11:114390119-114390141 CAAAGATTGTAGGCCAGGTGTGG - Intergenic
1089369884 11:117947897-117947919 AATAAAATGACGGCCGGGTGCGG + Intergenic
1089451015 11:118596917-118596939 AACAAATTCTCGGCCGGGTGCGG + Intronic
1089483172 11:118823820-118823842 GATGCTTTGTGGGCCAGGTGCGG + Intergenic
1089509991 11:118990921-118990943 CAAAAATTGTAGCCCAGGTGCGG - Intergenic
1089669986 11:120048665-120048687 GATAAATTGGGGGCTGGGTGTGG - Intergenic
1089793313 11:120960038-120960060 AAGAATTTATCGGCCAGGTGTGG + Intronic
1090127374 11:124101497-124101519 AAAAAAATGTAGGCCAGGTGTGG + Intergenic
1090317437 11:125806329-125806351 ATTATATTCTCGGCCAGGTGCGG + Intergenic
1090343934 11:126051937-126051959 GAGCTATTGTTGGCCAGGTGCGG - Intronic
1090872019 11:130757411-130757433 GGTAAATTGCTGGGCAGGTGGGG + Intergenic
1091131542 11:133150982-133151004 AATAATTCGTCGGCCAGGTGCGG + Intronic
1091403702 12:196256-196278 GACAAACTGTGGGCCAGGAGGGG + Exonic
1091492082 12:941606-941628 TAAAAATTTTGGGCCAGGTGTGG - Intronic
1092303673 12:7277575-7277597 GAAACAATGTAGGCCAGGTGCGG - Intergenic
1092520594 12:9268719-9268741 AATAAAATATCAGCCAGGTGTGG - Intergenic
1092693177 12:11138746-11138768 GAAAACTTTTGGGCCAGGTGTGG + Intronic
1092790436 12:12066079-12066101 GAAAAACTCTCGGCCAGGTGCGG - Intronic
1092825238 12:12392936-12392958 AAAAAAAGGTCGGCCAGGTGTGG + Intronic
1094119022 12:26949420-26949442 GAAAAACTGTAGGCCAGGTGTGG - Intronic
1094156788 12:27345792-27345814 AACAAATTATCAGCCAGGTGTGG - Intronic
1094213695 12:27919027-27919049 TAAAAATAGCCGGCCAGGTGCGG + Intergenic
1094637245 12:32238652-32238674 AAGAAATTGTCAGCCGGGTGTGG + Intronic
1094650298 12:32369599-32369621 GGTACATTATTGGCCAGGTGTGG + Intronic
1094681031 12:32667322-32667344 AATAAATACTGGGCCAGGTGTGG + Intergenic
1095248363 12:39947948-39947970 AAGAAATTCTCGGCCAGGCGCGG - Intronic
1095555712 12:43501348-43501370 GATGAATTACTGGCCAGGTGTGG - Intronic
1095668740 12:44834562-44834584 GCTAAATTGTTGTCCAGGAGGGG - Intronic
1095720036 12:45390829-45390851 AATAAAATGTTGGCCAGGGGCGG + Intronic
1095753286 12:45734076-45734098 TAAAAATTGGAGGCCAGGTGCGG + Intronic
1096154395 12:49333901-49333923 TAAAATTTGTCGGCCAGGCGCGG + Intronic
1096210976 12:49765625-49765647 GAAAAAAAGTCGGCCAGGCGTGG + Intergenic
1096305261 12:50469312-50469334 TAAAAAATGTAGGCCAGGTGCGG + Intronic
1096483913 12:51963526-51963548 TATGAAATGTCGGCCAGGCGTGG - Intronic
1096576657 12:52557040-52557062 TAAAAATTGTAGGCCGGGTGTGG + Intergenic
1096970493 12:55662233-55662255 AATAAAATGTTGGCCAGGCGCGG - Intergenic
1097056137 12:56250591-56250613 GAAAAATTGTGGGCTAGGTGTGG + Intronic
1097396473 12:59081127-59081149 GATAAATGCTTGGCCAGGTGCGG - Intergenic
1097885851 12:64728214-64728236 TTTAAAGTGTCGGCCAGGCGCGG - Intronic
1098222967 12:68289693-68289715 AATCAATTACCGGCCAGGTGCGG - Intronic
1098258667 12:68644987-68645009 GATAAATTTCAGGCCAGGCGTGG - Intronic
1098420013 12:70285504-70285526 GATAACTTTGCGGCCAGGTGCGG - Intronic
1099432061 12:82598988-82599010 GACAAAGTGTTGGCCAGGTGTGG + Intergenic
1099484142 12:83207504-83207526 AAAAAATAGTCGGCCAGGGGCGG - Intergenic
1099694712 12:86003089-86003111 AAGAAATTTTAGGCCAGGTGTGG - Intronic
1100314219 12:93428979-93429001 GAAAAAGTGTAGGCCAGGCGCGG + Intronic
1100417815 12:94396576-94396598 AATACAGTGTTGGCCAGGTGTGG - Intronic
1100471233 12:94895103-94895125 AATATATTTTGGGCCAGGTGTGG - Intergenic
1100681816 12:96932314-96932336 TATAATTTGGAGGCCAGGTGCGG + Intronic
1100920218 12:99476100-99476122 TAAAAATTGAAGGCCAGGTGCGG + Intronic
1100989765 12:100239364-100239386 AAAAAATTATTGGCCAGGTGTGG - Intronic
1100993043 12:100270275-100270297 TATAAAATCTCGGCCAGGCGCGG - Intronic
1101312169 12:103591192-103591214 TATATATTGTTGGCCAGGTGTGG + Intronic
1101890542 12:108710850-108710872 GAAAAATTTTAGGCCAGGCGCGG - Intronic
1101901692 12:108795577-108795599 TATAAAATTTGGGCCAGGTGTGG + Intronic
1102169852 12:110834132-110834154 GAAAAAGAGTCGGCCGGGTGCGG + Intergenic
1102192664 12:111000627-111000649 GTAAAGTTGTAGGCCAGGTGTGG - Intergenic
1102371990 12:112389487-112389509 GAGAAAATTTGGGCCAGGTGTGG - Intergenic
1102407263 12:112684556-112684578 TAGATATTCTCGGCCAGGTGTGG - Intronic
1102915926 12:116752057-116752079 GAGAAAATATCGGTCAGGTGTGG + Intronic
1103656161 12:122472495-122472517 AGTAAATTGTTGGCCAGGCGTGG - Intergenic
1103743363 12:123106230-123106252 AATACATTCTGGGCCAGGTGTGG + Intronic
1103754951 12:123197491-123197513 GGTAAAGTTTAGGCCAGGTGCGG + Intronic
1103788489 12:123451747-123451769 GATAAATATTAGGCCAGGCGCGG + Intergenic
1103818613 12:123679085-123679107 GCTGAATTATCGGCCAGGCGCGG - Intronic
1105379838 13:19876611-19876633 GAAAAATTTTAGGCCAGGCGAGG - Intergenic
1105536710 13:21272742-21272764 TAAAAATTATTGGCCAGGTGTGG + Intergenic
1105707664 13:22978290-22978312 TATAAAACGCCGGCCAGGTGAGG - Intergenic
1105714492 13:23048504-23048526 ATTAAATTTTTGGCCAGGTGTGG - Intergenic
1105718433 13:23090605-23090627 GTAAAATATTCGGCCAGGTGGGG - Intergenic
1105765503 13:23554739-23554761 AATAAAAAGTCAGCCAGGTGTGG + Intergenic
1105916501 13:24922213-24922235 GATAAATTCTCTGCACGGTGAGG + Intronic
1106048975 13:26172831-26172853 GATATATTCTAGGCCGGGTGCGG - Intronic
1106481673 13:30141643-30141665 GATAAATTACCGGACATGTGTGG + Intergenic
1106654694 13:31730675-31730697 AATAAACTGGGGGCCAGGTGCGG - Intergenic
1106943385 13:34800452-34800474 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1106994308 13:35463330-35463352 AATAAGTTGCAGGCCAGGTGCGG + Intronic
1106999279 13:35525259-35525281 AATAAATTTGAGGCCAGGTGCGG + Intronic
1107220355 13:37973106-37973128 AATAAATTGCTGGGCAGGTGGGG + Intergenic
1107321068 13:39189005-39189027 AAGAAAATGTTGGCCAGGTGTGG - Intergenic
1107993560 13:45839540-45839562 CATAATTTTTAGGCCAGGTGCGG + Intronic
1108232854 13:48368713-48368735 TATATATTGAAGGCCAGGTGTGG + Intronic
1108406700 13:50110760-50110782 AAAATATTGTTGGCCAGGTGCGG + Intronic
1108497876 13:51043022-51043044 AATAAATTATGGGCCAGGTGCGG - Intergenic
1109386972 13:61643256-61643278 AAAAAATTCTTGGCCAGGTGTGG + Intergenic
1109504702 13:63285169-63285191 GAAAAATTATTGGCCGGGTGCGG - Intergenic
1110958347 13:81586234-81586256 AAGAAATTATTGGCCAGGTGCGG + Intergenic
1111293940 13:86256160-86256182 AATAAAATATAGGCCAGGTGTGG + Intergenic
1111416399 13:87950961-87950983 AATAGATTATAGGCCAGGTGTGG - Intergenic
1111507697 13:89215806-89215828 GTGAAATTGTTGGCCAGGTGAGG + Intergenic
1112312250 13:98329369-98329391 AATATATTCTTGGCCAGGTGTGG + Intronic
1112408509 13:99141925-99141947 TATCATTTATCGGCCAGGTGTGG + Intergenic
1112733073 13:102388562-102388584 GAGAAATTGTGGGCCAGGAAGGG - Intronic
1112851451 13:103711423-103711445 GATAAACTGTCGGCCAGGCATGG + Intergenic
1113449508 13:110397147-110397169 GATAAACAGTCGGCCAGAGGAGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114203770 14:20548726-20548748 AAAAAAATTTCGGCCAGGTGCGG + Intergenic
1114438835 14:22729990-22730012 AAGAAGTTGTAGGCCAGGTGCGG - Intergenic
1114496332 14:23135410-23135432 GAAAAGTTTTAGGCCAGGTGCGG + Intronic
1114509536 14:23246848-23246870 AAAAAATTGTTGGCCGGGTGTGG + Intronic
1115203979 14:30881666-30881688 TATTAATTGCTGGCCAGGTGCGG + Intronic
1115258426 14:31427509-31427531 GATTATTTGTCGGCCGGGCGTGG + Intronic
1115277741 14:31626428-31626450 GCTAAACAGTGGGCCAGGTGCGG - Intronic
1115397314 14:32922997-32923019 GAATACTTGGCGGCCAGGTGCGG + Intergenic
1115566110 14:34627154-34627176 AAAAAATTGTTGGCCAGGCGCGG + Intronic
1115590367 14:34858603-34858625 TTTAAATTGTGGGCCAGGTGTGG - Intronic
1115605181 14:34993983-34994005 AATAAATTTTGGGCCAGGTGCGG - Intronic
1115618100 14:35115450-35115472 AAAAAAATGTTGGCCAGGTGTGG - Intronic
1115991938 14:39158809-39158831 AATAAATGTTCAGCCAGGTGTGG - Intronic
1116834532 14:49757462-49757484 AATCAATTAACGGCCAGGTGCGG - Intergenic
1116834749 14:49759226-49759248 TTAAAATTGTTGGCCAGGTGCGG + Intergenic
1117973627 14:61276644-61276666 AGTAAATTCCCGGCCAGGTGCGG - Intronic
1118292103 14:64536468-64536490 GAAAAAATATTGGCCAGGTGTGG + Intronic
1118537322 14:66782527-66782549 GAAAGATTCTGGGCCAGGTGCGG + Intronic
1118606247 14:67505988-67506010 AACAAATTATCAGCCAGGTGAGG - Intronic
1119053393 14:71392812-71392834 TAAAAAGTTTCGGCCAGGTGCGG - Intronic
1119461021 14:74803865-74803887 AAAAAATTCTCGGCCAGGCGCGG + Intronic
1120931683 14:89855185-89855207 AATAAATGTTAGGCCAGGTGTGG + Intronic
1121141620 14:91547568-91547590 AATAAAATTTGGGCCAGGTGTGG + Intergenic
1121165168 14:91789304-91789326 GTTAAACTATTGGCCAGGTGCGG + Intronic
1121198089 14:92093175-92093197 ACTAAAATGTGGGCCAGGTGTGG - Intronic
1121776689 14:96595629-96595651 TATAAAATGTGGGTCAGGTGCGG + Intergenic
1122474718 14:101999170-101999192 AAAAAATTTTTGGCCAGGTGCGG - Intronic
1122556222 14:102581842-102581864 AATAATTTGTTGGCCGGGTGTGG + Intergenic
1122641005 14:103159370-103159392 GAGTTATTATCGGCCAGGTGTGG - Intergenic
1122676669 14:103420519-103420541 AAAAAAGTGTTGGCCAGGTGTGG - Intronic
1124605351 15:31165866-31165888 TATATTTTGTCGGCCAGGCGTGG - Intergenic
1124856159 15:33391335-33391357 GTTAAAATTTGGGCCAGGTGCGG + Intronic
1124939227 15:34202698-34202720 AATAAAATCTCGGCCAGGCGCGG + Intronic
1125313418 15:38405024-38405046 GAAAATATATCGGCCAGGTGCGG - Intergenic
1125384437 15:39122315-39122337 GAGAAATTGTATTCCAGGTGGGG + Intergenic
1125517944 15:40333275-40333297 TACGAATTCTCGGCCAGGTGTGG + Intronic
1125586151 15:40821635-40821657 GATAAACTCTAGGCCAGGCGTGG + Intronic
1125637259 15:41199240-41199262 AAAAAATTTTTGGCCAGGTGTGG - Intronic
1125694605 15:41624620-41624642 CAAAAATTATCAGCCAGGTGCGG - Intronic
1125843931 15:42833580-42833602 TAAAAATTGTCGGCCAGGTGTGG + Intronic
1126003807 15:44237218-44237240 GATTGATTGATGGCCAGGTGCGG - Intergenic
1126077098 15:44922124-44922146 AATAAATTCTAGGCCAGGTGTGG + Intergenic
1126081620 15:44968755-44968777 AACAAATTCTAGGCCAGGTGTGG - Intronic
1126331303 15:47534471-47534493 TAGTAATTGTTGGCCAGGTGTGG - Intronic
1126396072 15:48219252-48219274 GAAAACTTGTCGGCCGGGTGTGG + Intronic
1126701496 15:51371973-51371995 GATAAATTCCTGGCCAGGCGCGG - Intronic
1126814421 15:52440556-52440578 GATGACTGGTGGGCCAGGTGCGG - Intronic
1126978212 15:54209702-54209724 TATAAAATGTAGGCCTGGTGTGG - Intronic
1127068208 15:55262249-55262271 TATAAAAAGTCGGCCAGGCGCGG + Intronic
1127371376 15:58345010-58345032 GACAAATTGGCAGCCAGCTGGGG + Intronic
1127501499 15:59558066-59558088 AATAAATTGAAGGCCGGGTGCGG + Intergenic
1127788113 15:62373999-62374021 AATACATTCTAGGCCAGGTGTGG + Intergenic
1128179538 15:65589446-65589468 GATAAATATTCAGCCAGGTGTGG - Intronic
1128302256 15:66573568-66573590 GGTAGAATCTCGGCCAGGTGCGG - Intergenic
1128341951 15:66828600-66828622 TATAAATTATAGGCCAGGCGCGG + Intergenic
1128492702 15:68165409-68165431 GTAAAATTTTTGGCCAGGTGCGG - Intronic
1128810793 15:70570711-70570733 GTTAAAATGCCGGCCGGGTGCGG - Intergenic
1128908394 15:71490133-71490155 TAAAAATTATAGGCCAGGTGTGG + Intronic
1128936908 15:71754378-71754400 AATACAATGTAGGCCAGGTGTGG - Intronic
1129286516 15:74529569-74529591 GAGAAATTAGCAGCCAGGTGTGG - Intergenic
1129306310 15:74666086-74666108 TATAATCTGTCGGCCGGGTGTGG - Intronic
1129337837 15:74864349-74864371 TAAAGATTCTCGGCCAGGTGCGG - Intronic
1130030922 15:80312929-80312951 GATGACTTGTGAGCCAGGTGTGG - Intergenic
1130232990 15:82110768-82110790 AATAAATTATCGGCTTGGTGAGG + Intergenic
1130604729 15:85306061-85306083 AATAATCTGTGGGCCAGGTGTGG - Intergenic
1130661757 15:85836492-85836514 AATAAGTTATTGGCCAGGTGCGG + Intergenic
1131492226 15:92873062-92873084 GAAACATTATGGGCCAGGTGCGG - Intergenic
1131886627 15:96922665-96922687 GATAAAGCCTCGGCTAGGTGTGG + Intergenic
1132522027 16:395888-395910 GCTCAATTGTTGGCCAGGCGTGG + Intergenic
1132821671 16:1875697-1875719 AATAGATTGTAGGCCAGGCGTGG + Intronic
1132948263 16:2544873-2544895 AAAAAATTTTGGGCCAGGTGTGG - Intronic
1133026187 16:2989898-2989920 GATAGGCTGTGGGCCAGGTGTGG + Intergenic
1133240910 16:4413893-4413915 TGTAAAATGTGGGCCAGGTGCGG + Intronic
1133797105 16:9055074-9055096 TATTTATTGTGGGCCAGGTGTGG + Intergenic
1133934081 16:10254909-10254931 AATAAAATGTTAGCCAGGTGTGG - Intergenic
1134129574 16:11640062-11640084 GACACATTGTTGGCCGGGTGCGG - Intergenic
1134334798 16:13288503-13288525 GATCTGTTTTCGGCCAGGTGGGG + Intergenic
1134532990 16:14999355-14999377 AAAAAATTTTTGGCCAGGTGCGG - Intronic
1134611676 16:15614190-15614212 GACAGAGTTTCGGCCAGGTGCGG + Intronic
1134711796 16:16330327-16330349 TAAAAACTGTCGGCCGGGTGCGG + Intergenic
1134741247 16:16548834-16548856 AATAAATTATCGGCCGGGCGCGG - Intergenic
1134955032 16:18378366-18378388 TAAAAACTGTCGGCCGGGTGCGG - Intergenic
1135124805 16:19799559-19799581 AATAAAATATAGGCCAGGTGTGG - Intronic
1135356620 16:21774262-21774284 AATAATTTCTCGGCCAGGTACGG + Intergenic
1135381807 16:22001997-22002019 AATAAATTCTAGGCCAGGTGTGG + Intergenic
1135401359 16:22168554-22168576 TAAAAATTTTTGGCCAGGTGTGG - Intronic
1135432628 16:22399181-22399203 AATAAATTGCTGGCCAGGTGTGG - Intronic
1135455120 16:22590405-22590427 AATAATTTCTCGGCCAGGTACGG + Intergenic
1135726140 16:24855118-24855140 AATAATTTGGAGGCCAGGTGTGG - Intronic
1135768376 16:25197501-25197523 AATAAAATTTTGGCCAGGTGTGG - Intergenic
1135898117 16:26429080-26429102 GGTAAATTATCGGCCAGATGCGG + Intergenic
1136252983 16:29018823-29018845 AATAAATCGTAGGCCAGGTGAGG - Intergenic
1136504049 16:30691272-30691294 CATAGATTGTCGGCCAGGCGTGG - Intergenic
1137620107 16:49870533-49870555 GAGAAAGAGTCGGCCAGATGTGG + Intergenic
1137976002 16:53032698-53032720 AATAAATTTTCGGCCAGGTGTGG - Intergenic
1138117033 16:54369068-54369090 AAAAAATTGGGGGCCAGGTGGGG - Intergenic
1138326742 16:56178498-56178520 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
1138464047 16:57174003-57174025 AAAAAATTCTCGGCCGGGTGCGG + Intronic
1138612094 16:58133391-58133413 AAGAAATTCTCGGCCAGGCGCGG - Intergenic
1138936826 16:61736305-61736327 GAGAAATTGGGGGCCATGTGAGG + Intronic
1139023514 16:62782662-62782684 GAAAAATAGTGGGCCAGGGGTGG + Intergenic
1139322261 16:66124641-66124663 TATGAAATTTCGGCCAGGTGCGG - Intergenic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1139798075 16:69499042-69499064 AAAAAAATGTTGGCCAGGTGTGG + Intergenic
1139863043 16:70041375-70041397 AAAAAATTTTTGGCCAGGTGCGG + Intergenic
1139943776 16:70624687-70624709 AATAAATTGCTGGACAGGTGGGG + Intronic
1140074530 16:71685035-71685057 AAGAAATTCTCGGCCAGGCGTGG + Intronic
1141000314 16:80301592-80301614 AACAAATTGTGAGCCAGGTGCGG - Intergenic
1141403892 16:83774662-83774684 AATAAATGGTAGGCCGGGTGTGG - Intronic
1142320961 16:89382625-89382647 GTTTATTTGTCGGCCAAGTGTGG - Intronic
1142564817 17:833179-833201 AATAACTTTTCGGCCGGGTGCGG - Intronic
1142872848 17:2832266-2832288 GATAAAGTCTCGGCCGGGCGCGG + Intronic
1142902966 17:3025084-3025106 AGTACATTGACGGCCAGGTGCGG + Intronic
1143567366 17:7732142-7732164 AATAAATTGTCAGCCGGGTATGG + Intronic
1143926738 17:10377772-10377794 AAAAAATAATCGGCCAGGTGCGG + Intergenic
1144159533 17:12544033-12544055 AATTATTTGTTGGCCAGGTGCGG + Intergenic
1144477448 17:15600757-15600779 AATATATTGTCGGCCGGGCGCGG + Intronic
1144507093 17:15841330-15841352 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1144538283 17:16113203-16113225 AATAAATTCTTGGCCAGGCGCGG - Intronic
1144557582 17:16295651-16295673 AATAAATTATCAGCCAGGTGTGG + Intronic
1144632892 17:16883018-16883040 GAAAAACTTTCGGCCAGGCGTGG + Intergenic
1144920792 17:18762610-18762632 AATATATTGTCGGCCGGGCGTGG - Intronic
1145021147 17:19432116-19432138 GTTAAGGTCTCGGCCAGGTGCGG + Intergenic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1145042360 17:19586306-19586328 GTTAAATTGTGGGCCAGGTGCGG - Intergenic
1145171219 17:20658927-20658949 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1145748086 17:27334934-27334956 AAGAAAATGTTGGCCAGGTGTGG - Intergenic
1145874021 17:28302131-28302153 TAAAAACTGTCGGCCGGGTGCGG + Intergenic
1146171040 17:30633570-30633592 GATGAACTGTAGGCCAGGGGTGG + Intergenic
1146252984 17:31366222-31366244 AAAAAATTTTAGGCCAGGTGCGG - Intronic
1146270527 17:31482300-31482322 AAAAAATTGGGGGCCAGGTGCGG + Intronic
1146303510 17:31710382-31710404 GAGAAAATATTGGCCAGGTGCGG + Intergenic
1147287351 17:39412823-39412845 GAAAAATTTGCGGCCGGGTGCGG - Intronic
1147299125 17:39510090-39510112 GAGAGATTGTTGCCCAGGTGCGG - Intronic
1147502069 17:40975060-40975082 AAAAAACTGTCGGCCAGGCGTGG - Intergenic
1147608635 17:41788254-41788276 GAGAACTTCTCGGCCAGGCGTGG + Intergenic
1148020651 17:44551169-44551191 TAAAAATTCTGGGCCAGGTGCGG + Intergenic
1148365281 17:47050895-47050917 GATGAACTGTAGGCCAGGGGTGG + Intergenic
1148395238 17:47302955-47302977 GATAAGTTAGGGGCCAGGTGTGG + Intronic
1148425887 17:47595690-47595712 AAGAAATTATGGGCCAGGTGCGG + Intronic
1148447777 17:47749702-47749724 TATAAAATGTTGGCCAGGTGTGG - Intergenic
1149061602 17:52429077-52429099 AATAAATATTCAGCCAGGTGTGG + Intergenic
1149672444 17:58426959-58426981 AAAAAAATGTTGGCCAGGTGCGG + Intronic
1149753632 17:59169386-59169408 AATAATATGTTGGCCAGGTGTGG - Intronic
1149917281 17:60621895-60621917 AAAAAATTATCGGCCAGGCGTGG + Intronic
1150515454 17:65805136-65805158 GATTACTTGTAGGCCAGGTATGG - Intronic
1150900275 17:69267163-69267185 AATAAATTGTAGGCCAGGCGTGG - Intronic
1151054867 17:71019520-71019542 ATTAAAATGTTGGCCAGGTGCGG + Intergenic
1151377498 17:73700249-73700271 AAGAAATTGCCGGCCAGGTGCGG - Intergenic
1151537636 17:74747985-74748007 GTTAAAACGTTGGCCAGGTGCGG + Intergenic
1151594716 17:75070588-75070610 AATAAAATATCGGCCAGATGTGG + Intergenic
1152882486 17:82826929-82826951 TAAAAATAGTCAGCCAGGTGTGG - Intronic
1153126887 18:1803856-1803878 TATAAACTGCAGGCCAGGTGTGG - Intergenic
1153156497 18:2155665-2155687 GTAAAATTCTCGGCCAGGCGCGG + Intergenic
1153655060 18:7274824-7274846 GAAAAAATGCAGGCCAGGTGTGG - Intergenic
1153689916 18:7581948-7581970 AATAAATTTTATGCCAGGTGGGG - Intronic
1153847084 18:9059885-9059907 AATAAATTTGGGGCCAGGTGTGG + Intergenic
1153869603 18:9305252-9305274 GATACAGTCTTGGCCAGGTGTGG + Intergenic
1154130827 18:11735594-11735616 TATAAAAAGTTGGCCAGGTGTGG + Intronic
1154251008 18:12745033-12745055 AAAAAATTGTCGGCTGGGTGCGG - Intergenic
1155033946 18:22008339-22008361 AATAAATTTTAGGCCAGGCGTGG - Intergenic
1155143893 18:23067929-23067951 GAAAAATTTTTAGCCAGGTGTGG - Intergenic
1156218127 18:35023220-35023242 TATAAATTGTTGGCCGGGCGTGG + Intronic
1156291381 18:35751322-35751344 AAGAAATTATTGGCCAGGTGTGG + Intergenic
1156821707 18:41380714-41380736 GATAAACTGTCGGCCATCTGGGG - Intergenic
1157263668 18:46198009-46198031 TGAAAATTGTGGGCCAGGTGTGG + Intronic
1157363763 18:47044466-47044488 GTTAAAATGATGGCCAGGTGCGG + Intronic
1157690217 18:49675676-49675698 GAAAAAATGTGGGCCGGGTGCGG + Intergenic
1157798057 18:50593914-50593936 GACAAACTGTCTGCAAGGTGTGG + Intronic
1157837766 18:50923459-50923481 GAAAAATTCTCAGCCAGGAGTGG + Intronic
1158919430 18:62173923-62173945 GATCATTTCTCGGCCGGGTGCGG + Intronic
1159066492 18:63573775-63573797 TTTAAAATGTTGGCCAGGTGTGG + Intergenic
1159443647 18:68512794-68512816 GAAAAACTGTAGGCCAGGCGCGG - Intergenic
1159794081 18:72821134-72821156 TATAATTTGTCAGCCAGGGGAGG - Intronic
1159806380 18:72962657-72962679 GATTCAGTGTCGGCCAGGCGTGG - Intergenic
1160176207 18:76597148-76597170 GTGAAAGTGTCGGCCAGGTGCGG + Intergenic
1161059023 19:2205258-2205280 GTCAAAATGTGGGCCAGGTGCGG - Intronic
1161372238 19:3919301-3919323 TAAAAATTATCGGCCGGGTGTGG + Intronic
1161496476 19:4589064-4589086 GAAAAAATGTGGGCCAGGCGCGG - Intergenic
1161807095 19:6450787-6450809 CAAAAATTATTGGCCAGGTGTGG + Intronic
1161814449 19:6491073-6491095 TACAAATTTTTGGCCAGGTGCGG - Intergenic
1161828639 19:6586640-6586662 AATAAAAAGTCAGCCAGGTGTGG + Intronic
1161831478 19:6607927-6607949 TAAAAATTCTCGGCCAGGCGCGG - Intergenic
1161917914 19:7243534-7243556 GAAAAAATTTAGGCCAGGTGCGG - Intronic
1162056043 19:8064741-8064763 AATAAATGTTAGGCCAGGTGTGG + Intronic
1162207075 19:9064140-9064162 AAAAAATTCTTGGCCAGGTGTGG + Intergenic
1162511935 19:11124361-11124383 AATAAACTGTAGGCCAGGCGCGG - Intronic
1162518624 19:11165842-11165864 GAGAAATTACCGGCCAGGCGTGG - Intronic
1162546301 19:11332320-11332342 GAGAAATGTTCGGCCAGGCGTGG - Intronic
1162588381 19:11575431-11575453 AAGAAATTGGTGGCCAGGTGTGG + Intronic
1162636978 19:11976574-11976596 AAAAAATTGCTGGCCAGGTGTGG + Intronic
1162810132 19:13159165-13159187 CAAAAAATTTCGGCCAGGTGCGG - Intergenic
1163301737 19:16451817-16451839 TAGAAATTGTAGGCCAGGCGCGG - Intronic
1163342835 19:16720841-16720863 GAAAAAGTCTCGGCCAGGTGCGG - Intronic
1163346506 19:16746062-16746084 CATAAATTGTTGACCAGGTGTGG + Intronic
1163347887 19:16755826-16755848 GATAGATTATAGGCCAGGTACGG - Intronic
1163447411 19:17354930-17354952 AATAAAATCTTGGCCAGGTGTGG + Intronic
1163451538 19:17380205-17380227 GCTATGTTGTTGGCCAGGTGAGG - Intergenic
1163472104 19:17503639-17503661 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1163541386 19:17912962-17912984 AATAAATTGCTGGCCAGGTGTGG - Intergenic
1163543590 19:17927197-17927219 GATAATTAATTGGCCAGGTGCGG + Intergenic
1163610379 19:18297981-18298003 AATAAATTGAAGGCCAGGCGCGG - Intergenic
1163707986 19:18827666-18827688 GAAAAATAGGAGGCCAGGTGCGG - Intergenic
1163729864 19:18942578-18942600 ACTCAAGTGTCGGCCAGGTGTGG - Intergenic
1163735061 19:18974832-18974854 GAGAAATATTCGGCCAGGCGCGG - Intergenic
1163759602 19:19128518-19128540 AAAAAAATGTAGGCCAGGTGTGG - Intronic
1163864428 19:19760782-19760804 GTTAAAATGAGGGCCAGGTGCGG + Intergenic
1163930283 19:20383652-20383674 GAAAAATTTTTGGCCAGGTGCGG - Intergenic
1163988287 19:20972854-20972876 GAAACATTTTTGGCCAGGTGCGG + Intergenic
1164025299 19:21346334-21346356 TAGAAATTGTAGGCCAGGTGTGG + Intergenic
1164045952 19:21542036-21542058 AATAAACTTTCAGCCAGGTGTGG - Intronic
1164103128 19:22076976-22076998 GGTAAATTTTAGGACAGGTGCGG - Intronic
1164211084 19:23097846-23097868 GAGGTATTGTGGGCCAGGTGTGG + Intronic
1164230089 19:23279598-23279620 GAAAAAAAGTAGGCCAGGTGTGG - Intergenic
1164744383 19:30600382-30600404 AATAAACAGCCGGCCAGGTGCGG - Intronic
1165088694 19:33370572-33370594 GAAAAATTGTGGACCAGGGGAGG + Intergenic
1165445407 19:35854280-35854302 GATAAATCAAGGGCCAGGTGCGG - Intronic
1165450706 19:35880523-35880545 AAAAAATTTTAGGCCAGGTGCGG + Intergenic
1165458607 19:35930527-35930549 TATAAAATTTTGGCCAGGTGCGG + Intergenic
1165470903 19:36004004-36004026 AATAATGTGTCGGCCAGGTGTGG - Intronic
1165661491 19:37584670-37584692 GACAAATTCTCGGCCGGGCGCGG + Intronic
1165668252 19:37652825-37652847 AGAAAATTGTGGGCCAGGTGCGG + Intronic
1165689361 19:37851314-37851336 GAAATATTCTAGGCCAGGTGTGG + Intergenic
1165816497 19:38645631-38645653 AATAAATATCCGGCCAGGTGTGG - Intergenic
1167950877 19:53026719-53026741 AAAAAAGTGTAGGCCAGGTGTGG + Intergenic
1168167039 19:54555846-54555868 GCTAAATTATCTGCCAGGAGGGG - Intergenic
1168211385 19:54893252-54893274 AAAAAATTGTAGGCCAGGCGTGG - Intergenic
1202706445 1_KI270713v1_random:27704-27726 AAAAAATTGTTGGCCGGGTGCGG - Intergenic
926075384 2:9938538-9938560 GATTATTTCTTGGCCAGGTGTGG + Intergenic
926464150 2:13167890-13167912 AATAAATTGCTGGGCAGGTGGGG + Intergenic
926570787 2:14527678-14527700 AATGTATTGTGGGCCAGGTGTGG - Intergenic
926822435 2:16867211-16867233 CATAAAATGTTAGCCAGGTGTGG - Intergenic
928057815 2:28075971-28075993 GGGAAATTTTGGGCCAGGTGTGG + Intronic
928306101 2:30171650-30171672 AAAAAAAAGTCGGCCAGGTGCGG + Intergenic
928534000 2:32221446-32221468 AAGAAAATATCGGCCAGGTGCGG - Exonic
928603042 2:32920123-32920145 GAAAAAATTTGGGCCAGGTGTGG - Intergenic
928957602 2:36887136-36887158 AAGAACTTCTCGGCCAGGTGGGG + Intronic
928965865 2:36974583-36974605 TATAAAGTGTGGGCCAGGCGCGG - Intronic
929159093 2:38813660-38813682 TATACATTTTCGGCCGGGTGCGG - Intronic
929477684 2:42268726-42268748 TAAAAAATGTAGGCCAGGTGCGG - Intronic
929507323 2:42538415-42538437 GATAAATGTTAGGCCGGGTGCGG + Intronic
929609323 2:43258230-43258252 TATTATTTGTTGGCCAGGTGCGG + Intronic
929700670 2:44160185-44160207 GAATAATTCTTGGCCAGGTGCGG - Intergenic
929757999 2:44784195-44784217 TATAAATTACCAGCCAGGTGTGG + Intergenic
929826501 2:45312745-45312767 AGTACATTGTAGGCCAGGTGTGG + Intergenic
929939034 2:46316549-46316571 TAGACATTGTTGGCCAGGTGCGG - Intronic
930759014 2:55011315-55011337 GTAAAATTTTAGGCCAGGTGTGG - Intronic
931385862 2:61796789-61796811 ATTAAAATTTCGGCCAGGTGTGG + Intergenic
931982693 2:67711332-67711354 AAAAAATTTTAGGCCAGGTGCGG + Intergenic
932098582 2:68875138-68875160 AAGAGATTCTCGGCCAGGTGCGG + Intergenic
932131098 2:69187877-69187899 AATACATGGTAGGCCAGGTGCGG - Intronic
932752804 2:74382307-74382329 GGTACCTTGTAGGCCAGGTGTGG + Intronic
932787948 2:74623959-74623981 AGTATATTGTAGGCCAGGTGTGG - Intronic
932828601 2:74965387-74965409 GATAAAAAGTGGGCCAGGCGCGG - Intronic
933681496 2:85105724-85105746 AAAAAATTCTCGACCAGGTGCGG + Intergenic
933754802 2:85629785-85629807 GGAAAATGGTCGGCCAGGCGAGG - Intronic
933814662 2:86056159-86056181 GAAAAAGTTCCGGCCAGGTGTGG + Intronic
935080532 2:99789144-99789166 AATAAGTTGTTGGCCAGGTGCGG + Intronic
935263699 2:101376568-101376590 ATTAAATTCTGGGCCAGGTGAGG - Intronic
935714864 2:105930920-105930942 GAAAAAGTGTGGGTCAGGTGTGG + Intergenic
935782953 2:106524072-106524094 AATCAAGTGTCGGCCATGTGGGG + Intergenic
935953933 2:108355674-108355696 AAAACATTGTTGGCCAGGTGCGG - Intergenic
936121352 2:109748280-109748302 TATAAATGTTAGGCCAGGTGCGG - Intergenic
936140958 2:109939680-109939702 AAGAAATTGAAGGCCAGGTGTGG + Intergenic
936170855 2:110172488-110172510 TATAAATTTCTGGCCAGGTGTGG + Intronic
936177649 2:110237625-110237647 AAGAAATTGAAGGCCAGGTGTGG + Intergenic
936203735 2:110431806-110431828 AAGAAATTGAAGGCCAGGTGTGG - Intronic
936223345 2:110623192-110623214 TATAAATGTTAGGCCAGGTGCGG + Intergenic
936283685 2:111164197-111164219 GTTACATTGTCCGCCTGGTGTGG + Exonic
936410984 2:112257958-112257980 GATCAATGTTGGGCCAGGTGTGG + Intergenic
936420077 2:112355059-112355081 GACAAATACTGGGCCAGGTGCGG + Intergenic
936855206 2:116949596-116949618 AATATATTTTTGGCCAGGTGCGG + Intergenic
936883277 2:117280550-117280572 AATAAATTGCTGGGCAGGTGGGG - Intergenic
937108771 2:119345769-119345791 AATAAAATTTTGGCCAGGTGCGG + Intronic
937979177 2:127603841-127603863 GAAAATCTGTTGGCCAGGTGTGG + Intronic
938264827 2:129920901-129920923 AATAAAATGTGGGCCAGGTGTGG + Intergenic
938852698 2:135277632-135277654 TATAAAATATAGGCCAGGTGCGG + Intronic
939480026 2:142736218-142736240 GATAAATTTCTGGCCTGGTGTGG - Intergenic
939850849 2:147302633-147302655 AATAAATTGTCTGCCATGTTGGG - Intergenic
940081720 2:149810953-149810975 AATAAAATGTTGGCCAGGTGGGG + Intergenic
940148291 2:150571658-150571680 GATAGATGGTGGGCCAGGCGCGG + Intergenic
940207583 2:151221326-151221348 TATAACTTATAGGCCAGGTGAGG + Intergenic
940875024 2:158889992-158890014 GATTCATCGACGGCCAGGTGCGG + Intergenic
940923333 2:159335254-159335276 AGTAAATTCTGGGCCAGGTGCGG + Intronic
940959563 2:159769350-159769372 GAAAAAATGTAGGCCAAGTGTGG + Exonic
941096305 2:161242600-161242622 TTAAAGTTGTCGGCCAGGTGAGG + Intergenic
941433628 2:165441213-165441235 GATAATTTTTCTGTCAGGTGAGG + Intergenic
942133459 2:172903076-172903098 TACAAAGTCTCGGCCAGGTGCGG + Intronic
942522152 2:176815915-176815937 GATAATTTCTTGGCCAGGCGCGG - Intergenic
943799612 2:192041917-192041939 GATCACTGATCGGCCAGGTGCGG + Intronic
944624845 2:201560135-201560157 GTAAAATTGTGGGCCAGGTACGG + Intronic
944711785 2:202341222-202341244 AATAAATAATAGGCCAGGTGTGG + Intergenic
944809853 2:203317338-203317360 GAGTAATTTTCGGCCGGGTGTGG + Intergenic
945554631 2:211263267-211263289 AGGAAATTGTCGGGCAGGTGGGG - Intergenic
945892600 2:215445490-215445512 AATTTATTGTCTGCCAGGTGTGG - Intergenic
945924909 2:215793454-215793476 AATAAATTCTCGGCCAGGCGCGG - Intergenic
946277296 2:218641227-218641249 AAAAAATTATCGGCCAGGTGAGG - Intronic
946589306 2:221225791-221225813 GATAAGATGCAGGCCAGGTGCGG - Intergenic
947180075 2:227403810-227403832 CATAAAATCTAGGCCAGGTGCGG - Intergenic
947424466 2:229971061-229971083 GATAAAATCATGGCCAGGTGAGG + Intronic
947426957 2:229992446-229992468 GATTAAGTGAGGGCCAGGTGTGG - Intronic
948103757 2:235396258-235396280 GATAATTTGTGGGCCAGGCGTGG - Intergenic
948170912 2:235901588-235901610 TAAAAATTATGGGCCAGGTGTGG + Intronic
1169423762 20:5480454-5480476 CAAAAATTATAGGCCAGGTGTGG + Intergenic
1169570918 20:6904310-6904332 GTTAAAATGTGGGCCGGGTGCGG + Intergenic
1169949217 20:11024437-11024459 CATAAATTTTTAGCCAGGTGCGG - Intergenic
1170257932 20:14366653-14366675 CAAAAATTGTTGGCCGGGTGTGG - Intronic
1170442394 20:16391844-16391866 GATACATGGTCAGCCAGGTGGGG - Intronic
1170699751 20:18693364-18693386 GAAAAATTGAGGGCCAGGTGCGG + Intronic
1171072054 20:22080219-22080241 GACATTTTGTAGGCCAGGTGTGG + Intergenic
1172238246 20:33393166-33393188 GATAAATTGCTGGCCAGGCACGG - Intronic
1172353448 20:34261820-34261842 AATAAATAATCGGCCAGGCGCGG + Intronic
1172423257 20:34835767-34835789 AATAAAATGCTGGCCAGGTGTGG - Intergenic
1172540138 20:35706675-35706697 AATAATTTTTCGGCCAGGTGCGG - Intronic
1172940012 20:38647681-38647703 AATACATGGTGGGCCAGGTGCGG - Intronic
1173856196 20:46252016-46252038 GAGAGATTGTCAGCCAGGTCAGG - Intronic
1174217078 20:48924217-48924239 GAGAAATTTGGGGCCAGGTGCGG + Intronic
1174239218 20:49119447-49119469 GAAAAATTCACGGCCAGGTGTGG - Intronic
1174622171 20:51884020-51884042 AAGAAAATGTGGGCCAGGTGCGG + Intergenic
1174628510 20:51935851-51935873 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1174658110 20:52188605-52188627 GAAATAATGTCGGCCGGGTGCGG - Intronic
1174680031 20:52397861-52397883 AGTAAAATGTCAGCCAGGTGTGG + Intergenic
1175565277 20:59970518-59970540 GGGAGATTGTCGGCCAGGCGCGG + Intronic
1176231178 20:64033795-64033817 GATAAACTCACGGCCGGGTGCGG - Intronic
1176788495 21:13289492-13289514 GCTAAATATTTGGCCAGGTGTGG - Intergenic
1177329918 21:19645403-19645425 GCTAAATTGTCAGCCCAGTGAGG - Intergenic
1177537220 21:22443413-22443435 TATATATTCTGGGCCAGGTGTGG - Intergenic
1177987645 21:27997694-27997716 GCTAAATATTTGGCCAGGTGTGG - Intergenic
1178320482 21:31601406-31601428 GATGAAGTCTCAGCCAGGTGCGG - Intergenic
1178595002 21:33945413-33945435 AAGAAATTGTTGGCCAGGTGTGG + Intergenic
1178851476 21:36216020-36216042 AAGAAATTTGCGGCCAGGTGTGG + Intronic
1178851524 21:36216318-36216340 AAGAAATTTGCGGCCAGGTGTGG + Intronic
1178986958 21:37313665-37313687 CAAAAATGGTAGGCCAGGTGCGG + Intergenic
1179101564 21:38359296-38359318 GATACACTGGGGGCCAGGTGGGG + Intergenic
1179216793 21:39374412-39374434 GAAAGATTGTTGGCCAGGTGCGG + Intergenic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1179266655 21:39809684-39809706 GATAAAATCTAGGCCAGATGCGG + Intergenic
1179512444 21:41882590-41882612 TAAAAATTTTTGGCCAGGTGCGG + Intergenic
1179541636 21:42086673-42086695 CATAAATAATCGGCCAGGAGTGG + Intronic
1180781026 22:18519700-18519722 AATAAAATCTGGGCCAGGTGTGG - Intergenic
1181237914 22:21459050-21459072 AATAAAATCTGGGCCAGGTGTGG - Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181298349 22:21860382-21860404 TATAAATTGTGAGCAAGGTGAGG + Intronic
1181545713 22:23600960-23600982 TAGAAATTGCCGGCCAGGTGCGG - Intergenic
1181676597 22:24457978-24458000 AAAAAAGTGTTGGCCAGGTGTGG - Intergenic
1181814597 22:25428947-25428969 TAGAAATTGCCGGCCGGGTGTGG + Intergenic
1181972403 22:26701256-26701278 AATTAAATGTGGGCCAGGTGTGG - Intergenic
1182137090 22:27916519-27916541 AATAAATAGAGGGCCAGGTGCGG + Intronic
1182505691 22:30780786-30780808 GTTTAGTTGTAGGCCAGGTGGGG - Intronic
1182806842 22:33079515-33079537 GATAACTAGATGGCCAGGTGTGG - Intergenic
1182818915 22:33196046-33196068 AATTAATTTTAGGCCAGGTGTGG - Intronic
1183572019 22:38660483-38660505 GATGCATTTTCGGCCTGGTGTGG - Intronic
1183811056 22:40257730-40257752 AATGAATGGACGGCCAGGTGCGG + Intronic
1183908744 22:41062684-41062706 GATTAAATGACGGCCGGGTGTGG + Intergenic
1183973459 22:41496019-41496041 GATGAGTTGCAGGCCAGGTGTGG + Intronic
1184125666 22:42485035-42485057 GATAAATTTGGGGCCAGGTGCGG + Intergenic
1184160904 22:42696814-42696836 GAAAAACAGGCGGCCAGGTGTGG - Intronic
1184170169 22:42754187-42754209 AATACATTATTGGCCAGGTGAGG + Intergenic
1184181714 22:42832693-42832715 GCTAAATAGTAGGCCCGGTGTGG + Intronic
1184307150 22:43612599-43612621 ACTAAAAAGTCGGCCAGGTGTGG + Intronic
1184598890 22:45531052-45531074 GATCAATTATAGGCCAGGCGTGG - Intronic
1184936736 22:47729881-47729903 AATACAATGGCGGCCAGGTGTGG + Intergenic
1185290877 22:50026941-50026963 AAAAAAAAGTCGGCCAGGTGCGG + Intronic
1185401954 22:50623606-50623628 CAAATATTGTTGGCCAGGTGTGG + Intronic
949331829 3:2931936-2931958 GTTAAAATGTGGGCAAGGTGTGG - Intronic
949658258 3:6247132-6247154 GAATAAATGTGGGCCAGGTGCGG + Intergenic
950082514 3:10233340-10233362 CATGTATTGTAGGCCAGGTGCGG - Intronic
950246741 3:11427525-11427547 AATAAATTATCGGCCGGGCGAGG + Intronic
950867591 3:16201469-16201491 GACGAATTTTCGGCCAGGCGCGG - Intronic
950977411 3:17262769-17262791 AATACATTGTCGGCCGGGTGTGG - Intronic
951763704 3:26173141-26173163 TAAAAATTGAAGGCCAGGTGTGG - Intergenic
951856091 3:27198779-27198801 GACAAGTTGGGGGCCAGGTGCGG + Intronic
952388695 3:32861440-32861462 AATAAATTGTTGGCCAGGCGCGG + Intronic
952475080 3:33700553-33700575 AATCAATTGTGGGCCAGGTGCGG + Intronic
952762973 3:36931756-36931778 AAGAAATTCTGGGCCAGGTGTGG + Intronic
953747584 3:45586839-45586861 TTTAAAATGTGGGCCAGGTGCGG - Intronic
953943803 3:47127569-47127591 AATAATTTTTAGGCCAGGTGCGG + Intronic
954022087 3:47751186-47751208 GTTACTTTGTCGGCCAGGCGCGG - Intronic
954040200 3:47880396-47880418 AAGTAATTGTCAGCCAGGTGTGG - Intronic
954185810 3:48916352-48916374 GAAAAAGTTTTGGCCAGGTGTGG - Intergenic
954242780 3:49307155-49307177 GTTAGACTGTAGGCCAGGTGTGG + Intronic
954455633 3:50597862-50597884 AATAAAATATTGGCCAGGTGTGG - Intergenic
954501565 3:51021949-51021971 TGTAAATTCTCGGCCAGGTGTGG - Intronic
954601182 3:51871029-51871051 TATAAATTTTAGGACAGGTGTGG - Intergenic
954616607 3:51971952-51971974 GAAAAATTATCGGCCAGGCATGG + Intronic
954884891 3:53864111-53864133 GATACTTTGTTGGCCAGGTGTGG - Intronic
954946727 3:54431896-54431918 GCTATAAAGTCGGCCAGGTGTGG - Intronic
955079985 3:55649548-55649570 AAAAAATTATTGGCCAGGTGCGG - Intronic
955486213 3:59437513-59437535 AATAAATGTTTGGCCAGGTGTGG - Intergenic
956204341 3:66740173-66740195 GAGAAGTTGTTGGCCAGGTGCGG - Intergenic
956434194 3:69217328-69217350 GTTAAATTGGAGGCCAGGCGTGG + Intronic
956845167 3:73175862-73175884 GATGAATTGTCCCCCAGGAGGGG - Intergenic
956853320 3:73252546-73252568 TATAAACTCTGGGCCAGGTGTGG + Intergenic
956885289 3:73553281-73553303 GACCTATTATCGGCCAGGTGTGG + Intronic
957993712 3:87661196-87661218 TAAAAGTTTTCGGCCAGGTGTGG + Intergenic
958479617 3:94630297-94630319 TACAAATTGTTGGCCAGGTGCGG + Intergenic
959087468 3:101866800-101866822 GATAAATTTTTAGCCAGGTGTGG + Intergenic
959251810 3:103957726-103957748 AATAAAGTATGGGCCAGGTGCGG + Intergenic
959511668 3:107219892-107219914 AATAAATTATTGGCCAGGTGTGG + Intergenic
959700588 3:109295227-109295249 AACAAATTATTGGCCAGGTGTGG + Intronic
960041585 3:113155460-113155482 CAAACATTTTCGGCCAGGTGCGG + Intergenic
961475871 3:127145961-127145983 GAGAGATTGGAGGCCAGGTGTGG - Intergenic
961583308 3:127901298-127901320 GAAAAATTTTCGGCCAGGCACGG - Intergenic
962794372 3:138837763-138837785 TATAATGTGTTGGCCAGGTGTGG + Intergenic
963243125 3:143030753-143030775 GAACATTTGTGGGCCAGGTGTGG + Intronic
963933300 3:151026630-151026652 AATAATTTCTTGGCCAGGTGCGG + Intergenic
964324316 3:155530040-155530062 AAGAAATTGCTGGCCAGGTGTGG - Intronic
964422628 3:156520288-156520310 GAAAAATTATAGGCCAGGTGTGG + Intronic
964713187 3:159694193-159694215 TAGAGATTGTGGGCCAGGTGCGG + Intronic
964880863 3:161421236-161421258 GAAAAAATGACTGCCAGGTGGGG - Intergenic
965563822 3:170089624-170089646 GCTACACTGTCGGACAGGTGTGG + Exonic
965573068 3:170191035-170191057 TAAAAATTTTTGGCCAGGTGAGG + Intergenic
966160578 3:176963212-176963234 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
966170928 3:177079139-177079161 AAAAAAATGTCGGCCGGGTGCGG + Intronic
966603950 3:181803593-181803615 AACACATTGTGGGCCAGGTGTGG + Intergenic
967161969 3:186747117-186747139 GATAAATTCTTGGCCAGGCACGG + Intergenic
967788191 3:193519933-193519955 TAGAAATTGCAGGCCAGGTGCGG - Intronic
967871383 3:194232659-194232681 CAATAATTGTAGGCCAGGTGTGG + Intergenic
968312888 3:197698701-197698723 GAAAAATTCTGGGCCAGGTGTGG + Intronic
968843350 4:3024568-3024590 AAAAAATTGTAGGCCAGGTGTGG + Intronic
969137831 4:5044753-5044775 AATAAAAAGTCAGCCAGGTGTGG + Intergenic
969421406 4:7099170-7099192 AAAAAATTGTTGGCCAGGTGCGG + Intergenic
970115142 4:12686511-12686533 GAAAAGTTCTTGGCCAGGTGTGG + Intergenic
970954403 4:21793714-21793736 TATAAATTGTCTTCCAGGTCTGG + Intronic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
971352361 4:25864898-25864920 GGAAAATTGTCGGCCAGTTCAGG + Intronic
972465440 4:39351669-39351691 AATAATTTGTCGGCCAGGCGCGG + Intronic
972547464 4:40094033-40094055 CAAAATTTGTAGGCCAGGTGTGG - Intronic
972609588 4:40644348-40644370 AAAAAATTTTAGGCCAGGTGCGG + Intergenic
972697110 4:41458484-41458506 GATGGATTGTGGGCCAGGCGTGG + Intronic
973259097 4:48142970-48142992 AAAATATTATCGGCCAGGTGTGG - Intronic
973853703 4:54987817-54987839 AAGAAATTCTTGGCCAGGTGTGG + Intergenic
973980718 4:56306201-56306223 GATAAATATCAGGCCAGGTGTGG + Intronic
974066276 4:57080681-57080703 AAGAAAATGTCAGCCAGGTGTGG - Intronic
974071036 4:57123838-57123860 GATAAGATATAGGCCAGGTGTGG - Intergenic
974388069 4:61228980-61229002 GATAAATAAGAGGCCAGGTGTGG - Intronic
974505274 4:62761847-62761869 AATAAAATGTAGGCCAGGCGTGG + Intergenic
975338667 4:73211554-73211576 ATCTAATTGTCGGCCAGGTGTGG + Intronic
975557860 4:75682124-75682146 TATAAACTGTTGGCCAGGTGCGG + Intronic
975565958 4:75754371-75754393 AAGAAATTGAGGGCCAGGTGTGG - Intronic
975643734 4:76526075-76526097 AAATAAATGTCGGCCAGGTGCGG + Intronic
976392182 4:84517026-84517048 AATGATTTGTGGGCCAGGTGCGG - Intergenic
976708838 4:88047264-88047286 AAAAACTTGTCGGCCAGGTGTGG + Intronic
977198493 4:94088530-94088552 GGTAAATTGCTGGGCAGGTGGGG + Intergenic
977217216 4:94297119-94297141 AATAAATTGCTGGGCAGGTGGGG + Intergenic
977248771 4:94665191-94665213 AATAAATAGAGGGCCAGGTGTGG + Exonic
978587227 4:110287005-110287027 AATAAAATGTTAGCCAGGTGGGG - Intergenic
978884550 4:113751479-113751501 AATAAAATTTTGGCCAGGTGCGG + Intronic
979452442 4:120888080-120888102 GATAAAATGTCGGCCGGGCGCGG - Intronic
979630109 4:122891328-122891350 GATAAATGTTCGGCCGGGCGCGG - Intronic
980109461 4:128621372-128621394 TTTAAGTTCTCGGCCAGGTGTGG - Intergenic
980671852 4:136019676-136019698 AAGAAACTGTCTGCCAGGTGCGG + Intergenic
980943041 4:139293108-139293130 TTTAAATTTTTGGCCAGGTGCGG - Intronic
981196122 4:141922812-141922834 CAAAAATTGTAGGCCAGGTGCGG + Intergenic
981334591 4:143555969-143555991 AACAAAATGTAGGCCAGGTGTGG - Exonic
982037910 4:151364652-151364674 GATGAATTATAGGCCAGGCGCGG + Intergenic
982180538 4:152745257-152745279 AATAAATTGCTGGGCAGGTGGGG + Intronic
982530815 4:156541057-156541079 CATAAATTGTCGGCCGGGTGCGG + Intergenic
982896364 4:160932641-160932663 AAAAAATCTTCGGCCAGGTGCGG - Intergenic
983225718 4:165084487-165084509 AAGAAAGTGTGGGCCAGGTGGGG - Intronic
983621160 4:169761948-169761970 GATAAAGTGACAGCCAGGTGTGG - Intergenic
983764077 4:171454184-171454206 AATAAGTTGTCGGCCAGGCATGG - Intergenic
983881737 4:172940649-172940671 AATAAAATGTTGGCCGGGTGTGG - Intronic
984217248 4:176929036-176929058 GAAAGATTGCAGGCCAGGTGCGG - Intergenic
984730132 4:183060525-183060547 AATAAAATGTGGGCCGGGTGTGG - Intergenic
985089056 4:186344640-186344662 AACAAACTGGCGGCCAGGTGAGG - Intergenic
985144055 4:186874853-186874875 GATAATTTGTTGGCCGGGCGCGG - Intergenic
985389932 4:189483368-189483390 GGTAAATTGCTGGGCAGGTGCGG + Intergenic
985813108 5:2105088-2105110 AATAAATTGCAGGCCAGGTGTGG + Intergenic
986400554 5:7375106-7375128 GATAAACTGTGGGCCGGGTGCGG - Intergenic
986905169 5:12487001-12487023 AATAAATTTTAGGCCAGGCGTGG - Intergenic
987075540 5:14378848-14378870 TAGAAATTCTGGGCCAGGTGCGG - Intronic
987125718 5:14810447-14810469 AATCAATTTTTGGCCAGGTGCGG - Intronic
987131542 5:14864968-14864990 AATAAATCGGCGGCCAGGCGTGG + Intronic
987205447 5:15620538-15620560 AATAGTTTGTGGGCCAGGTGCGG - Intronic
987777675 5:22389936-22389958 AATCAATTGTCGGCCAGGCACGG - Intronic
988199026 5:28047408-28047430 AAGAAATTGTTGGGCAGGTGGGG - Intergenic
988560722 5:32278785-32278807 TAAAAATTCTTGGCCAGGTGTGG + Intronic
989222660 5:38985985-38986007 AATAAACTCTAGGCCAGGTGTGG - Intronic
990078280 5:51879094-51879116 AATAAATTTTTGGCCAGGCGCGG + Intergenic
990311053 5:54539177-54539199 GAGAAACTGTTAGCCAGGTGTGG - Intronic
991928572 5:71729366-71729388 AAAAAATTATAGGCCAGGTGTGG + Intergenic
992718978 5:79540702-79540724 AAAAAATTGTAGGCTAGGTGTGG + Intergenic
992798469 5:80274231-80274253 AATAATTTCTCGGCCAGGTGCGG - Intergenic
993332640 5:86618696-86618718 AAAAAACTGTGGGCCAGGTGCGG + Intronic
993677756 5:90837897-90837919 TATAAATTATCTGCAAGGTGGGG - Intronic
993713059 5:91247196-91247218 GATAAAAGATAGGCCAGGTGTGG + Intergenic
993719570 5:91309075-91309097 AAGATATTGTCGGCCAGGGGCGG - Intergenic
993891107 5:93474832-93474854 GATGATTTCCCGGCCAGGTGCGG + Intergenic
994110034 5:95991794-95991816 AATATATTGTTGGCCAGGTACGG - Intergenic
994147777 5:96413827-96413849 GAAAAAAAATCGGCCAGGTGCGG + Intronic
994375855 5:99015244-99015266 GGGAAATTGTTGGGCAGGTGGGG + Intergenic
994532603 5:100988159-100988181 AATAAATTGCTGGGCAGGTGGGG + Intergenic
994600760 5:101901619-101901641 TAAAAATTGTCGGCTAGGTGTGG + Intergenic
995680973 5:114718839-114718861 AAGAAATTGTCGGCCGGGCGTGG - Intergenic
996462824 5:123766721-123766743 TAAAGAGTGTCGGCCAGGTGTGG - Intergenic
997396059 5:133560794-133560816 GATAATTCTTCGGCCAGGAGTGG + Intronic
997441524 5:133911984-133912006 AATAAAATGTAGGCCAGGTGCGG + Intergenic
998023425 5:138791326-138791348 TAAAAAATGTCGGCCGGGTGCGG + Intronic
998509547 5:142700023-142700045 ATTAAACTGTGGGCCAGGTGCGG - Intergenic
998843159 5:146277821-146277843 GAAAAATTATTGGCCAGGCGCGG - Intronic
998890993 5:146745664-146745686 GATAAATTGTCGGCCAGGTGTGG + Intronic
998996461 5:147872878-147872900 GATAAATTGCTGGGCAGGTGGGG + Intronic
999464030 5:151784050-151784072 TAAAAAATGTTGGCCAGGTGTGG - Intronic
999579350 5:153018625-153018647 GTAAAATTGTCGGCCGGGCGCGG + Intergenic
1000140510 5:158398810-158398832 TTAAAATTGTCAGCCAGGTGTGG + Intergenic
1000159603 5:158584333-158584355 AATAAAAAGTCAGCCAGGTGCGG + Intergenic
1000235497 5:159355722-159355744 GATTTATTTTAGGCCAGGTGCGG - Intergenic
1000326131 5:160173819-160173841 GTTAAATCCTAGGCCAGGTGCGG + Intergenic
1000520977 5:162294053-162294075 AAAAAATTTTCTGCCAGGTGTGG - Intergenic
1001079225 5:168654695-168654717 CATAAAGTGTGGGCCAGGTTGGG + Intergenic
1001376636 5:171265896-171265918 GATAAATTCGGGGCCAGGTATGG - Intronic
1001732760 5:173972612-173972634 AACAAATTGTGGGCCGGGTGCGG - Intergenic
1002029107 5:176415390-176415412 TTTAAATTCACGGCCAGGTGTGG + Intronic
1002511842 5:179725389-179725411 AAAAAATTGTTGGCCAGGTGCGG + Intronic
1002821577 6:730238-730260 GATAAATGGTCGGCCAGGTCAGG - Intergenic
1003126772 6:3362111-3362133 AAAAAATTAGCGGCCAGGTGTGG + Intronic
1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG + Intronic
1003134710 6:3425572-3425594 GATAATTATTCGGCCGGGTGCGG - Intronic
1003430229 6:6031687-6031709 AATAAATTGCTGGGCAGGTGTGG + Intergenic
1003495341 6:6658624-6658646 AAGAAAATGTGGGCCAGGTGTGG + Intergenic
1003577278 6:7309162-7309184 GATAAGCTCTAGGCCAGGTGTGG + Intronic
1003659570 6:8047434-8047456 AAAAAATTGTTGGCCAGGCGTGG - Intronic
1004598986 6:17129552-17129574 AAAAAATTGTTGGCCAGGCGCGG + Intronic
1004650610 6:17603874-17603896 GATAAAAAATGGGCCAGGTGTGG - Intronic
1004836035 6:19532754-19532776 AATAAATTTACGGCCAGGCGTGG + Intergenic
1005078626 6:21934042-21934064 AATGAACTGTTGGCCAGGTGCGG - Intergenic
1005683979 6:28234235-28234257 AATCAATTGTACGCCAGGTGTGG + Intergenic
1005934698 6:30511866-30511888 TAGAAATTGTCGGCCAGGCACGG + Intergenic
1006193958 6:32226174-32226196 TAAAAATTGAAGGCCAGGTGTGG - Intergenic
1006262876 6:32891531-32891553 AAGAAAATGTTGGCCAGGTGCGG + Intergenic
1006371392 6:33646124-33646146 AGTACATTTTCGGCCAGGTGTGG - Intronic
1006588253 6:35133499-35133521 TATAAAATCTGGGCCAGGTGTGG + Intronic
1007117639 6:39354886-39354908 TAAAAAATGTTGGCCAGGTGTGG + Intronic
1007549342 6:42717093-42717115 AAGAAATTCTTGGCCAGGTGCGG - Intronic
1007775198 6:44221172-44221194 GATAAATTTTAGGCCAGGAGTGG - Intronic
1008108187 6:47463108-47463130 GACTAATTGTTGGCCAGGCGCGG - Intergenic
1008505905 6:52229626-52229648 TAGAAAATGTAGGCCAGGTGTGG + Intergenic
1008668847 6:53745932-53745954 AAAAAATTGAAGGCCAGGTGCGG + Intergenic
1008942819 6:57065640-57065662 AATAAAATGTTAGCCAGGTGTGG - Intergenic
1010394317 6:75373593-75373615 TTTAAATTGTTGGCCAGGCGTGG - Intronic
1010423601 6:75701928-75701950 ATTAAACTGTCGGCCAGGTGCGG - Intronic
1010437988 6:75858313-75858335 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1010686590 6:78860353-78860375 CACAAACTGTGGGCCAGGTGTGG - Intergenic
1010740522 6:79497685-79497707 GATACAATGATGGCCAGGTGCGG + Intronic
1010764289 6:79760933-79760955 AAAAAATTGTGGGCCAAGTGTGG - Intergenic
1011578026 6:88826491-88826513 TAAAAATCATCGGCCAGGTGCGG + Intronic
1011585420 6:88919607-88919629 ATAAAATTGTGGGCCAGGTGTGG - Intronic
1011719078 6:90136535-90136557 GGTAAATAGTGGGCCAGGGGAGG - Intronic
1011977059 6:93315150-93315172 ATTATATTGTCGGCCAGGCGCGG - Intronic
1012901478 6:105011867-105011889 AATAAACTGCCGGCCAGGTGTGG + Intronic
1013125768 6:107182613-107182635 AATAAATTATAGGCCGGGTGTGG - Intronic
1013514078 6:110869797-110869819 TAGAAACTGTAGGCCAGGTGTGG - Intronic
1013883984 6:114939252-114939274 GAAAAATTGTTGGCCAGGAATGG - Intergenic
1014218077 6:118772309-118772331 AATTAACTGTAGGCCAGGTGCGG - Intergenic
1015097302 6:129431106-129431128 GGTAACATGTTGGCCAGGTGCGG + Intronic
1015102474 6:129497523-129497545 GCTAAATTCTGGGCCAGGCGTGG - Intronic
1015189364 6:130456512-130456534 GATACATTGCCGGCCAGGCACGG + Intergenic
1015278092 6:131404617-131404639 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1015424573 6:133050681-133050703 GAAAAATTGGCGGCCGGGCGCGG - Intergenic
1015657504 6:135535933-135535955 AATAAAGTGTTGGCCAGATGTGG - Intergenic
1015727481 6:136314398-136314420 GATAATTTATAGGCCAGGTATGG + Intergenic
1015798277 6:137034648-137034670 GAGAACATGTGGGCCAGGTGCGG + Intronic
1016081886 6:139866702-139866724 AAGAAATTGCCGGCCAGGCGCGG + Intergenic
1016133186 6:140503071-140503093 GATAAGATGTAGGTCAGGTGTGG + Intergenic
1016508546 6:144813476-144813498 GAAAAACTCTGGGCCAGGTGTGG - Intronic
1016810628 6:148257916-148257938 AGTAAAGTGACGGCCAGGTGTGG - Intergenic
1016974523 6:149794327-149794349 GATAAAATATTGGCCAGGAGCGG + Intronic
1017086456 6:150717328-150717350 GACAAAATTTAGGCCAGGTGTGG - Intronic
1017095911 6:150805223-150805245 GTTATAATGTCGGCCGGGTGTGG - Intronic
1017156519 6:151327103-151327125 AAAAAAATGTAGGCCAGGTGCGG - Intronic
1017179102 6:151533342-151533364 ATGAAATAGTCGGCCAGGTGCGG - Intronic
1017253329 6:152305552-152305574 AATAATTTTTCGGCCAGGTGTGG - Intronic
1017438242 6:154438084-154438106 TATAACATGTGGGCCAGGTGCGG - Intronic
1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG + Intergenic
1017689712 6:156951731-156951753 AATGAAGTGTTGGCCAGGTGCGG - Intronic
1017817146 6:158024132-158024154 GATTATTTGTCGGCCAGGCACGG + Intronic
1018337247 6:162806398-162806420 AATACATTTTAGGCCAGGTGTGG - Intronic
1018428618 6:163705396-163705418 AAAAAATTGCTGGCCAGGTGCGG - Intergenic
1018732246 6:166660045-166660067 AATTAATTATTGGCCAGGTGTGG - Intronic
1019101569 6:169635075-169635097 AATAAACTTTAGGCCAGGTGTGG + Intronic
1020065979 7:5189016-5189038 TATAAATAGAAGGCCAGGTGTGG - Intergenic
1020119269 7:5493841-5493863 CAGAAATTCTCAGCCAGGTGCGG + Intronic
1020135124 7:5583273-5583295 GAAAAAAAGTGGGCCAGGTGTGG + Intergenic
1020179590 7:5911583-5911605 TTTAAATTTTTGGCCAGGTGAGG - Intronic
1020239051 7:6378253-6378275 GAAAATATGTCTGCCAGGTGCGG + Intronic
1020303348 7:6813293-6813315 TTTAAATTTTTGGCCAGGTGAGG + Intronic
1020406550 7:7841592-7841614 GATAATTTGTGAGCCAGGTGTGG - Intronic
1020524192 7:9237867-9237889 AAGAAAGTCTCGGCCAGGTGAGG + Intergenic
1020836167 7:13154489-13154511 AATAAATTGCTGGCCGGGTGCGG + Intergenic
1020836182 7:13154586-13154608 TATAAATTCCCGGCCAGGTGCGG + Intergenic
1021448357 7:20757818-20757840 TTTAAATTGTCGGCCGGGTGTGG - Intronic
1021768624 7:23975469-23975491 CATAATTTCTTGGCCAGGTGTGG + Intergenic
1021802214 7:24318259-24318281 AAGAAATTGCTGGCCAGGTGCGG - Intergenic
1021977958 7:26028090-26028112 AATAAATTGCTGGGCAGGTGGGG + Intergenic
1021987347 7:26109776-26109798 GAAAAAATTTAGGCCAGGTGTGG + Intergenic
1022309564 7:29183665-29183687 AAAAAATTCTGGGCCAGGTGTGG - Intronic
1022372812 7:29786651-29786673 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1022541423 7:31138946-31138968 GATACATTTTGGGCCGGGTGCGG - Intergenic
1022651586 7:32282184-32282206 TATAGATGGTCGGCCGGGTGTGG + Intronic
1022854772 7:34303797-34303819 AATAAATTGCTGGGCAGGTGGGG + Intergenic
1023105029 7:36755660-36755682 AATTAATTGTGGGCCGGGTGTGG - Intergenic
1023158445 7:37274839-37274861 GATTATTTCTGGGCCAGGTGTGG - Intronic
1023190551 7:37576472-37576494 TAAATATTTTCGGCCAGGTGCGG + Intergenic
1023374010 7:39538320-39538342 GAAAAATTGTGGGCCAGGCATGG + Intergenic
1023448290 7:40254683-40254705 AATAAATTGTTGGCTGGGTGCGG - Intronic
1023719955 7:43082874-43082896 GATGTATTGTAGGCCAGGTGTGG + Intergenic
1023752018 7:43381812-43381834 AAAAAATTATCAGCCAGGTGTGG - Intronic
1024333614 7:48180744-48180766 AATAAATTCTAAGCCAGGTGTGG + Intronic
1025261336 7:57420309-57420331 GGAAAATTATAGGCCAGGTGCGG - Intergenic
1025835449 7:65089065-65089087 TACAAAATGTGGGCCAGGTGTGG - Intergenic
1025905225 7:65778544-65778566 TACAAAATGTGGGCCAGGTGTGG - Intergenic
1025935743 7:66035309-66035331 GATACAATGTAGGCCAGGTGCGG - Intergenic
1026020816 7:66704518-66704540 TTTAAATAGTCGGCCAGGTGCGG + Intronic
1026049231 7:66931010-66931032 GATGAATGGTGGGCCTGGTGTGG + Intronic
1026763052 7:73140909-73140931 AATAAATTTCTGGCCAGGTGAGG - Intergenic
1027039517 7:74950697-74950719 AATAAATTTCTGGCCAGGTGAGG - Intergenic
1027084123 7:75251682-75251704 AATAAATTTCTGGCCAGGTGAGG + Intergenic
1028005853 7:85566328-85566350 GAAAAATCCTCGGCCAGGCGCGG - Intergenic
1028575044 7:92339330-92339352 AAAAAATTTTTGGCCAGGTGCGG - Intronic
1029242335 7:99172422-99172444 AATAATATGTAGGCCAGGTGCGG + Intergenic
1029905801 7:104092398-104092420 AATAGCTTGTAGGCCAGGTGCGG - Intergenic
1029983406 7:104900023-104900045 AATAAATTGGCGGCCAGGCACGG - Intronic
1030698251 7:112609987-112610009 GAAAAATTCTTGGCCAGGCGTGG + Intergenic
1030842355 7:114371374-114371396 ATTAAGTTGTTGGCCAGGTGCGG - Intronic
1031004609 7:116457288-116457310 AATAAATTGCTGGGCAGGTGGGG - Intronic
1031337561 7:120554696-120554718 TGTAAATTCTCGGCCAGGCGCGG - Intronic
1032123988 7:129177949-129177971 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1032222560 7:130005770-130005792 GGAAAATTTTGGGCCAGGTGCGG - Intergenic
1032279216 7:130487329-130487351 GATAAAATGTCCTCTAGGTGTGG + Intronic
1032386249 7:131527027-131527049 TAGAAGTTGTGGGCCAGGTGTGG - Intronic
1032707704 7:134435595-134435617 GATCACATGTAGGCCAGGTGTGG + Intergenic
1032821301 7:135526747-135526769 GAAAACTTGCTGGCCAGGTGTGG + Intergenic
1033129258 7:138731600-138731622 AATAAAATATTGGCCAGGTGTGG + Intronic
1033835045 7:145300262-145300284 AATAATTTGTGGGCCAGGCGCGG + Intergenic
1034110869 7:148536567-148536589 AGTATATTGTAGGCCAGGTGTGG + Intergenic
1034605555 7:152309809-152309831 GAGAAATTCTAGGCCAGGTATGG - Intronic
1035871690 8:3142085-3142107 GATAATTTGGCGGCCGGGCGCGG - Intronic
1035899148 8:3438823-3438845 AAGAAATTGCTGGCCAGGTGTGG + Intronic
1036003081 8:4631070-4631092 AATAAAATGAAGGCCAGGTGCGG + Intronic
1036666151 8:10741542-10741564 GATTATCTGTTGGCCAGGTGTGG - Intronic
1036715086 8:11114649-11114671 AATAAATGTTTGGCCAGGTGCGG - Intronic
1037091624 8:14926927-14926949 ATCAAAGTGTCGGCCAGGTGTGG - Intronic
1037144326 8:15554893-15554915 AATAAAATGTTGGCCGGGTGCGG - Intronic
1037476205 8:19260305-19260327 GAGAAACTATCAGCCAGGTGTGG + Intergenic
1037778470 8:21851115-21851137 AAAAAAATGTCGGCCACGTGCGG + Intergenic
1037781430 8:21871893-21871915 GATAACTTCTCGGCCAGGCGCGG + Intergenic
1038592618 8:28854009-28854031 AAGAAATTGTGGGCCAGGCGCGG - Intronic
1038632261 8:29257043-29257065 AAGGAATTGTAGGCCAGGTGTGG - Intronic
1038805086 8:30783015-30783037 AACAAAGTGTGGGCCAGGTGCGG - Intronic
1038852662 8:31295303-31295325 AATATATTGTTGGCCAGGTGCGG - Intergenic
1040039940 8:42905793-42905815 AAGAAATTTTCAGCCAGGTGCGG + Intronic
1040573732 8:48632428-48632450 TATGATTTGTGGGCCAGGTGAGG + Intergenic
1040752082 8:50722464-50722486 TATACAATGTGGGCCAGGTGTGG - Intronic
1041777416 8:61538949-61538971 AATATATTTTAGGCCAGGTGTGG + Intronic
1041791205 8:61698090-61698112 TTTAATTTGTCAGCCAGGTGTGG - Intronic
1042238503 8:66639273-66639295 AGTAAGTTTTCGGCCAGGTGTGG - Intronic
1042500166 8:69500040-69500062 GATAATGTGTAGGCCAGGTGAGG - Intronic
1042680269 8:71375917-71375939 TAAAAATTGTTGTCCAGGTGTGG - Intergenic
1042745896 8:72105173-72105195 TAAAAATTGTAGGCCAGGTGTGG - Intronic
1042967874 8:74375035-74375057 GAAAAATATTGGGCCAGGTGTGG + Intronic
1043215707 8:77584690-77584712 AATTAATTCTCGGTCAGGTGCGG + Intergenic
1043816229 8:84805396-84805418 AATATATTGTTGGCCAGGCGCGG + Intronic
1044395414 8:91704841-91704863 GATATATGGTTGGCCAGGTACGG + Intergenic
1044685280 8:94820596-94820618 CACAAATCATCGGCCAGGTGCGG - Intronic
1044921925 8:97176885-97176907 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1045630649 8:104117630-104117652 GATAAATTTTTGGCTAGGTGTGG - Intronic
1045746717 8:105431196-105431218 AATAAGTTGTGGGCCAGGTGTGG - Intronic
1046008031 8:108509686-108509708 AATAAATTCTAGGCCAGGTGTGG + Intergenic
1046035240 8:108832689-108832711 GGTAAAGTGATGGCCAGGTGCGG - Intergenic
1046512024 8:115214030-115214052 AGTAAATTGCCGGGCAGGTGGGG - Intergenic
1046746125 8:117877980-117878002 AATAAATATTCGGCTAGGTGCGG + Intronic
1049068181 8:140335996-140336018 AAAATATTGTTGGCCAGGTGCGG - Intronic
1049160568 8:141095253-141095275 GGGAAATTTTGGGCCAGGTGCGG - Intergenic
1049935090 9:493835-493857 CATAAATTGCCGGCCAGGCGCGG - Intronic
1050140408 9:2511193-2511215 AAGAAATTGTTGGGCAGGTGGGG - Intergenic
1050342209 9:4652128-4652150 AATCAATTGTGGGCCAGGCGCGG + Intronic
1050382770 9:5047889-5047911 GAAAAATTTCAGGCCAGGTGTGG - Intronic
1050624863 9:7492629-7492651 TATAAAGTGTGGGCCGGGTGTGG + Intergenic
1050928799 9:11299426-11299448 AATAAATTTTAGGCCAGGCGTGG + Intergenic
1051234886 9:14989544-14989566 GATAAAGTGACGGCCGGGTGTGG + Intergenic
1051270400 9:15349723-15349745 AATGGATTCTCGGCCAGGTGTGG - Intergenic
1051902352 9:22057516-22057538 GATATAGTATTGGCCAGGTGTGG + Intergenic
1051910544 9:22150561-22150583 GATAATTTGTTGGCCAGGAGCGG + Intergenic
1051911742 9:22160685-22160707 TAGAAATTGACAGCCAGGTGTGG + Intergenic
1052096948 9:24394863-24394885 GATAATTTGTAGGCCAGGAATGG - Intergenic
1052314265 9:27099838-27099860 TAGAAATTATTGGCCAGGTGCGG + Intergenic
1052419540 9:28224352-28224374 AAAAAATTCTGGGCCAGGTGCGG - Intronic
1053189195 9:36047316-36047338 AAGAAAGCGTCGGCCAGGTGTGG + Intronic
1053391040 9:37736373-37736395 GGTAAATAGTGGGCCCGGTGTGG + Intronic
1055480233 9:76702346-76702368 GAAAAGATATCGGCCAGGTGCGG - Intronic
1055804433 9:80076848-80076870 GAGAAACAGTTGGCCAGGTGGGG - Intergenic
1056176432 9:84041186-84041208 GAAAAAATGTTGGCCAGGTGTGG - Intergenic
1056214597 9:84395291-84395313 GAAAAAGTTTGGGCCAGGTGTGG - Intergenic
1056216183 9:84408265-84408287 GATTATTTGCCGGCCAGGTGTGG + Intergenic
1056412833 9:86348986-86349008 GAAAAATTCTTGGCCAGGCGTGG + Intronic
1056437302 9:86587216-86587238 AATAAATTGCTGGGCAGGTGGGG + Intergenic
1057236959 9:93368724-93368746 AATAAATTGGTAGCCAGGTGTGG - Intergenic
1057415137 9:94855396-94855418 TAGAAATTGTGGGCCAGGTGCGG + Intronic
1057435770 9:95039274-95039296 CTGAAATTGTTGGCCAGGTGCGG + Intronic
1057789494 9:98114610-98114632 TAAAAATTGTCGGCTGGGTGCGG - Intronic
1058368986 9:104242501-104242523 GATAAAATATCGGCCGGGCGCGG - Intergenic
1059075668 9:111191305-111191327 GATGAATAGGAGGCCAGGTGAGG + Intergenic
1059264831 9:113017269-113017291 AAAAAATTGTTGGCCAGGCGCGG - Intergenic
1059304713 9:113344753-113344775 AATAACTTCTGGGCCAGGTGTGG - Intergenic
1059857306 9:118414130-118414152 AATAACTTGTCGGCCAGGCGCGG - Intergenic
1061230819 9:129314882-129314904 GGGAGATTGTCGGCCGGGTGTGG - Intergenic
1061361886 9:130148745-130148767 GGCAAATTGTAGGCCAGGCGCGG + Intergenic
1062487926 9:136790169-136790191 GATGAAATCTTGGCCAGGTGCGG - Intergenic
1185594814 X:1299594-1299616 CAGAAATTGTTGGCCAGGTGTGG - Intronic
1185783719 X:2871396-2871418 AAAAAATTCTAGGCCAGGTGTGG + Intronic
1185789202 X:2915839-2915861 AATAAATGGTGGGCCAGGCGTGG + Intronic
1185791779 X:2932690-2932712 AAGAAATAGTAGGCCAGGTGCGG - Intergenic
1186202145 X:7165488-7165510 AATAAAATATCAGCCAGGTGTGG + Intergenic
1186451017 X:9673771-9673793 AATAAATTGGGGGCTAGGTGCGG + Intronic
1186837463 X:13452022-13452044 TAAAGATTGACGGCCAGGTGTGG + Intergenic
1187085973 X:16044304-16044326 GAAAGATTTTAGGCCAGGTGCGG + Intergenic
1187086955 X:16050868-16050890 GAAAGATTTTAGGCCAGGTGCGG + Intergenic
1187777504 X:22778769-22778791 GAGAAAATAGCGGCCAGGTGCGG - Intergenic
1188352918 X:29154247-29154269 AATATTTTGTGGGCCAGGTGCGG + Intronic
1188467284 X:30496255-30496277 AATAAATAGTGGGCTAGGTGCGG - Intergenic
1188472178 X:30553382-30553404 AATAAATAGTAGGCCGGGTGCGG + Intergenic
1188503074 X:30850420-30850442 GATAGATCGGGGGCCAGGTGCGG + Intronic
1188591684 X:31844147-31844169 AATAAAATCTCAGCCAGGTGCGG - Intronic
1188660061 X:32748050-32748072 GAAAAAGTGTAGGCCAGGTGTGG + Intronic
1188735028 X:33702635-33702657 AAGACAATGTCGGCCAGGTGTGG + Intergenic
1189490944 X:41471400-41471422 TATAAACTCTGGGCCAGGTGCGG - Intronic
1190419478 X:50214847-50214869 CAAAATTTGTGGGCCAGGTGTGG - Intronic
1190561354 X:51688626-51688648 TATAAATTATAGGCCAGGCGCGG - Intergenic
1190562937 X:51704691-51704713 TATAAATTATAGGCCAGGCGCGG + Intergenic
1190699488 X:52976153-52976175 TAAAAATTATTGGCCAGGTGCGG + Intronic
1190715550 X:53100188-53100210 GAAAATCTGTTGGCCAGGTGCGG + Intergenic
1190903594 X:54702838-54702860 GATATAATTTCGGCCAGGCGCGG - Intergenic
1191805880 X:65133574-65133596 AAGAAATTGTTGGGCAGGTGGGG + Intergenic
1192082629 X:68063228-68063250 AATACATTCTTGGCCAGGTGTGG + Intronic
1192292202 X:69809969-69809991 GATTTCTTGTTGGCCAGGTGCGG + Intronic
1192545725 X:72011379-72011401 AAAAAACTGACGGCCAGGTGCGG + Intergenic
1194050909 X:89067893-89067915 TATAAATTTTAGGCCAGGTGCGG + Intergenic
1194293686 X:92104140-92104162 AATAAATTGCTGGGCAGGTGGGG + Intronic
1194384196 X:93234053-93234075 TATTATTTGTCGGCCAGGTGGGG + Intergenic
1194550992 X:95298951-95298973 TATAAATTGTGTGCCACGTGCGG - Intergenic
1194588933 X:95772639-95772661 AAGAAATTGTCAGCCGGGTGCGG + Intergenic
1194702852 X:97135500-97135522 AATAAATTCTAGGCCAAGTGTGG - Intronic
1194711655 X:97243074-97243096 AATAACTTTTTGGCCAGGTGCGG - Intronic
1195771948 X:108360824-108360846 GTTAAAGTGTTGGCCGGGTGCGG - Intronic
1195819112 X:108923598-108923620 TATTCATTGTCAGCCAGGTGTGG - Intergenic
1195854861 X:109320141-109320163 GAAAAATTGTGGGCCAGGCGTGG + Intergenic
1196213244 X:113019975-113019997 ATTGAATTGTCAGCCAGGTGTGG - Intergenic
1196287726 X:113901490-113901512 GATTAATTATAGGCCAGGTGTGG - Intergenic
1196572440 X:117280967-117280989 AATAAATTGCTGGGCAGGTGGGG - Intergenic
1196665795 X:118314781-118314803 TATAATTTGTCGGCCAGGTGCGG - Intergenic
1197240960 X:124122892-124122914 AAGCAATTCTCGGCCAGGTGTGG + Intronic
1198115767 X:133543407-133543429 GGCAGATTGTGGGCCAGGTGTGG - Intronic
1198992951 X:142537410-142537432 CATAAAATATAGGCCAGGTGCGG + Intergenic
1199467321 X:148153556-148153578 GATAAAATGTCTACCAGTTGAGG + Intergenic
1199763272 X:150922071-150922093 GTTCATTTGTCGGCCAAGTGTGG + Intergenic
1199780500 X:151054231-151054253 AAAAAATTATAGGCCAGGTGTGG + Intergenic
1200861907 Y:8001947-8001969 AATATGTTGTTGGCCAGGTGTGG - Intergenic
1200988747 Y:9328629-9328651 CATAATTTGAAGGCCAGGTGGGG + Intergenic
1201272432 Y:12268026-12268048 GAAAAATTGTAGGCCGGGTGCGG - Intergenic
1201820900 Y:18188296-18188318 AGTAAACTGTAGGCCAGGTGCGG + Intergenic
1202186311 Y:22187859-22187881 TATAATTTGAAGGCCAGGTGGGG + Intergenic
1202196514 Y:22303925-22303947 TATAATTTGAAGGCCAGGTGGGG - Intergenic
1202205048 Y:22398537-22398559 TATAATTTGAAGGCCAGGTGGGG - Intronic