ID: 998892247

View in Genome Browser
Species Human (GRCh38)
Location 5:146758624-146758646
Sequence GATGCTAAGGATTCAGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998892247_998892255 18 Left 998892247 5:146758624-146758646 CCCCATCCTGAATCCTTAGCATC 0: 1
1: 1
2: 1
3: 11
4: 189
Right 998892255 5:146758665-146758687 TAGTAGGAGCTTAATACCTACGG No data
998892247_998892252 2 Left 998892247 5:146758624-146758646 CCCCATCCTGAATCCTTAGCATC 0: 1
1: 1
2: 1
3: 11
4: 189
Right 998892252 5:146758649-146758671 AAGAAGTACCAGTACCTAGTAGG No data
998892247_998892256 19 Left 998892247 5:146758624-146758646 CCCCATCCTGAATCCTTAGCATC 0: 1
1: 1
2: 1
3: 11
4: 189
Right 998892256 5:146758666-146758688 AGTAGGAGCTTAATACCTACGGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998892247 Original CRISPR GATGCTAAGGATTCAGGATG GGG (reversed) Intronic
900931444 1:5740409-5740431 GATGCTAAGATTTCTGGATGGGG + Intergenic
902999687 1:20256269-20256291 GATGCAAAGCATTCAGAGTGGGG + Intergenic
904359852 1:29964189-29964211 GAGGCTGAGGAGACAGGATGTGG + Intergenic
905121713 1:35687554-35687576 CAAGCAAAGGAATCAGGATGGGG + Intergenic
905772285 1:40646030-40646052 GAGGATTAGGAATCAGGATGTGG + Intronic
908126674 1:61038685-61038707 GTGGCTAAGGATTAAGGTTGGGG - Intronic
908819135 1:68065326-68065348 GTTGCCAAGGGTTAAGGATGAGG + Intergenic
909799956 1:79794792-79794814 GATGCCAAGAATACATGATGGGG - Intergenic
911020537 1:93382768-93382790 GATGCTGAGGCTTCAGGGAGAGG + Intergenic
913163893 1:116168188-116168210 GAAGCTAAGGAGGGAGGATGGGG + Intergenic
915903175 1:159860841-159860863 GATGGTAAGCATTCAGGGAGAGG + Intronic
918207878 1:182325451-182325473 GATGCTAAAGAGGCAGAATGAGG + Intergenic
918485931 1:185028013-185028035 GAAGCAAAGCATTCAAGATGTGG - Intergenic
920777938 1:208958689-208958711 GAAGCAAAGCATTCAAGATGTGG + Intergenic
920891092 1:209986280-209986302 GTGGCAAAGCATTCAGGATGTGG - Intronic
923584837 1:235259274-235259296 GCAGCTAAGGATGCAAGATGGGG + Intronic
924428964 1:243979763-243979785 GATGCTAGGCATTCCGGATAAGG + Intergenic
1065813962 10:29468130-29468152 GATTCTGAGGACTAAGGATGGGG - Intronic
1067291917 10:44949913-44949935 GATGCTAAGTGTTCGGGGTGGGG + Intergenic
1068545211 10:58336651-58336673 GATGCTAAGGCTTCAAAATTAGG - Intronic
1068645860 10:59466648-59466670 GATGCTAAGGAGTGAGTAAGGGG - Intergenic
1071546014 10:86530249-86530271 GTTGCTAGGGGTTCAGGAGGAGG + Intergenic
1071682120 10:87716771-87716793 GAAGTGAAGGATTCAGGTTGTGG - Intronic
1072260447 10:93665359-93665381 GCTGCTGAAGATTCAGGAGGTGG + Exonic
1073024460 10:100477046-100477068 GTTGCCAAGGATTTGGGATGGGG - Intronic
1073283736 10:102374373-102374395 ATTGCTAAGGATTAGGGATGGGG + Intronic
1073638532 10:105224248-105224270 GTTGCCAAGGATTAAGGAGGAGG - Intronic
1076474470 10:130742831-130742853 GAGGCTGGGGATGCAGGATGGGG - Intergenic
1077840348 11:5967792-5967814 TGTGCTAAGGATTAAGGGTGAGG - Exonic
1078947663 11:16088467-16088489 GGTGCCAGGGATTTAGGATGAGG - Intronic
1079872225 11:25813746-25813768 GATGCAAAGGATTGAGGATGTGG - Intergenic
1081358727 11:42145507-42145529 GCAGCAAAGCATTCAGGATGTGG - Intergenic
1081516508 11:43836335-43836357 GATGCTTAGGATGCAGGAGAAGG + Intronic
1081732252 11:45379877-45379899 GAGGATAAGGATGCAGGCTGGGG - Intergenic
1089076206 11:115740834-115740856 GATTCTGAGGCTCCAGGATGTGG + Intergenic
1089666006 11:120019699-120019721 GATGCAAATGGTTCAGGGTGTGG - Intergenic
1090465235 11:126927690-126927712 GCTGCTGAAGATTCAGGAGGTGG - Intronic
1092364885 12:7869231-7869253 GATGCAAAGCATTCAAGATGCGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096785213 12:54013351-54013373 GATGCTAAGAATGGAGGGTGAGG + Intronic
1096920279 12:55077139-55077161 GAAGCTAGTGTTTCAGGATGTGG + Intergenic
1097056258 12:56251544-56251566 GATACTAAGGATAAAAGATGAGG - Intronic
1097995124 12:65880256-65880278 GATGCCAGTGATACAGGATGAGG - Intronic
1098197011 12:68012795-68012817 GATGCATAGAGTTCAGGATGAGG + Intergenic
1098595598 12:72271428-72271450 GGGGCTAAGGAGTCAGGAAGAGG + Intronic
1100455770 12:94750289-94750311 GATGCTGAGGATACAGAGTGAGG - Intergenic
1101680160 12:106956325-106956347 GATGCTAAGAAGTCAGGCGGAGG - Intronic
1101769526 12:107736160-107736182 GATGCTAGGGCTATAGGATGTGG + Intronic
1103082322 12:118035081-118035103 GATCCTGAGGAGTCTGGATGGGG + Exonic
1103472192 12:121190875-121190897 GATCCTAAGGCTTCAGGAATCGG + Intergenic
1106481500 13:30140490-30140512 GAAGCGCAGGAGTCAGGATGAGG - Intergenic
1110906807 13:80899922-80899944 GTTCCTCAGGATTCAGGTTGTGG - Intergenic
1120813431 14:88828081-88828103 GGTGCTGAGAATTAAGGATGGGG - Intronic
1120924279 14:89782291-89782313 GATTCTCAGGAGGCAGGATGAGG - Intergenic
1121830068 14:97043939-97043961 CATGCTAAGTATTTAGGATAGGG - Intergenic
1125943998 15:43698771-43698793 GATCCTAAGGGATTAGGATGAGG + Intronic
1127104309 15:55596769-55596791 GTTGCTAGGAATTAAGGATGGGG - Intergenic
1129492681 15:75944434-75944456 CATGCTAAGACTTCAGGCTGTGG + Intronic
1129898681 15:79128884-79128906 GAATCTAAGGATTCAGGACAAGG - Intergenic
1130543245 15:84836970-84836992 GAAGCAAAGGTTTCAGGAAGTGG + Intronic
1134755931 16:16667333-16667355 GATGGTAGGGATTCTGGTTGGGG + Intergenic
1134990137 16:18691831-18691853 GATGGTAGGGATTCTGGTTGGGG - Intergenic
1136452813 16:30363625-30363647 GATGGTAAGCATTAAGGAGGAGG - Intronic
1137387735 16:48056815-48056837 GAGGCTAGGGAATCTGGATGTGG - Intergenic
1140277489 16:73523545-73523567 TATGCCAAGGATCCAGGGTGAGG - Intergenic
1141090696 16:81128444-81128466 GATGCTGAGGACACAGGATGAGG - Intergenic
1142340445 16:89518760-89518782 GTTGCTAGGGGTTAAGGATGGGG + Intronic
1143864897 17:9916738-9916760 GCTGCAAAGGATTCTGGGTGCGG + Exonic
1145973006 17:28967956-28967978 AATGCTGAGGATGCAGGAGGGGG + Intronic
1153007551 18:511760-511782 GATGATAAGGATCCATGATAAGG + Intergenic
1160994906 19:1878046-1878068 GGTGTGAAGCATTCAGGATGTGG - Intronic
1161542702 19:4861588-4861610 GATTCTAAAGCTTCGGGATGGGG + Intronic
1166102315 19:40578009-40578031 GATGCTAAGGAGTGATGATATGG - Intronic
925671796 2:6317924-6317946 GATGATAAGGAACCAGCATGAGG + Intergenic
926846097 2:17140729-17140751 GTTGCCAGGGATTCAGGAGGAGG + Intergenic
927893322 2:26765789-26765811 ACAGCTAAGGATTCAGCATGAGG - Intronic
928418171 2:31114056-31114078 GTTTTTAAGGATTCAGGGTGGGG - Intronic
929876589 2:45801599-45801621 GATGCTGGGAATTTAGGATGAGG + Intronic
930507740 2:52305381-52305403 GATGCCAAGAATTGAGGATTGGG + Intergenic
930967703 2:57351383-57351405 GATGCTAAGAATACACAATGAGG + Intergenic
938718232 2:134040385-134040407 GCAGCAAAGCATTCAGGATGTGG - Intergenic
939403840 2:141730814-141730836 GAAGCTTAGTATTCAGGGTGGGG - Intronic
940451642 2:153844779-153844801 GCAGCAAAGCATTCAGGATGTGG - Intergenic
943114292 2:183647001-183647023 CATGCTATGGATTCTGGAGGTGG - Intergenic
946172898 2:217905869-217905891 GATGCTATTGGTTCAGGAGGAGG - Intronic
948266385 2:236638102-236638124 GAAGCTCAGGATGCAGGAAGAGG - Intergenic
1168925479 20:1575514-1575536 GGTGCTGAGGACTAAGGATGAGG - Intronic
1168929357 20:1608542-1608564 GGTGCTGAGGACTAAGGATGAGG - Intronic
1168933866 20:1646391-1646413 GGTGCTGAGGACTAAGGATGAGG - Intronic
1168937161 20:1675196-1675218 GGTGCTGAGGACTAAGGATGAGG - Intergenic
1168968947 20:1917726-1917748 GGTGCTGAGGACTAAGGATGAGG + Intronic
1169855393 20:10096295-10096317 GATTGAGAGGATTCAGGATGAGG - Intergenic
1175229809 20:57466606-57466628 GGTGCTTAGGATCCAGGGTGGGG - Intergenic
1176014182 20:62920393-62920415 GCTGCAAAGGATTCAGCAAGGGG + Intronic
1176182740 20:63758588-63758610 GATGCAAAGGATCTAGGATAGGG - Intronic
1177160902 21:17546916-17546938 GATGCGAGGGATACAGGACGGGG - Intronic
1177791313 21:25724979-25725001 GATTATAAGGATTCAAGATTGGG + Intronic
1179053671 21:37912802-37912824 CATGCTGAGCACTCAGGATGTGG - Intronic
1181330777 22:22089013-22089035 GATGATCAGTGTTCAGGATGTGG + Intergenic
1183209147 22:36439835-36439857 GAGGTTAAGGATTCAGGGAGTGG - Intergenic
1183403860 22:37620345-37620367 GATGCTAAAGAAGCAGGGTGAGG + Exonic
1184300465 22:43555793-43555815 GGTGCTAAGGACTCTGGAGGAGG + Intronic
1184486225 22:44781433-44781455 TATGGTAAGGAAACAGGATGAGG - Intronic
952405531 3:33001447-33001469 GATGAGAAGGCTTCAGGCTGAGG - Intronic
954743707 3:52774665-52774687 GTTGCTGAGGATTGAGAATGGGG - Intergenic
954933194 3:54302301-54302323 GCTGCTAAGGATTGAAGATGTGG + Intronic
955550231 3:60076304-60076326 TATTCTAAGTATTCAGAATGAGG + Intronic
955551860 3:60093714-60093736 CATGCGAAGGATTTAGAATGCGG + Intronic
956735348 3:72233640-72233662 GATCCTAATGATACAGGAGGGGG - Intergenic
957410253 3:79830799-79830821 GTTTCTATGGATACAGGATGGGG + Intergenic
957722339 3:84019741-84019763 AAAGCTAAGGATTCATGGTGAGG - Intergenic
959024971 3:101230743-101230765 GATGCTAAGGAGCCTTGATGAGG - Intronic
959245455 3:103862349-103862371 GCAGCAAAGGATTCAAGATGTGG + Intergenic
960404781 3:117246325-117246347 GATGCTAGGGATTCAGGATGAGG - Intergenic
963574953 3:147048432-147048454 CCTGGTAAGGAATCAGGATGTGG + Intergenic
963655249 3:148040117-148040139 GATCCTAAGCATTTAGGATGAGG - Intergenic
964313943 3:155423744-155423766 GCTGCTAAGGGTTCAGGGCGGGG - Intronic
965309684 3:167113652-167113674 GATTCTAAAGGGTCAGGATGAGG + Intergenic
966288171 3:178322065-178322087 GACGCTCAGGGTTGAGGATGAGG + Intergenic
967424746 3:189314094-189314116 GATGACAAGGTTTCAGGATTGGG + Intronic
968118518 3:196108207-196108229 GAGGCTCAGGTTTCAGGCTGAGG + Intergenic
968219486 3:196925609-196925631 GATGCTAGGGAGTCAGGTAGGGG + Intronic
971761178 4:30767412-30767434 GATGCTAACGATTCATCAAGTGG + Intronic
972047713 4:34689263-34689285 GGTGCTAAGGAGTTAGGAAGGGG + Intergenic
972816255 4:42649736-42649758 GGTGCTAAGGTTTCAGTAGGAGG + Intronic
973876797 4:55228262-55228284 GATGCTAAGAATGCACAATGGGG - Intergenic
976662868 4:87558461-87558483 GTTGCCAAGGATTAAGGATGAGG + Intergenic
976789630 4:88863390-88863412 GATGCTTAGGACACAGTATGGGG - Intronic
976803648 4:89021373-89021395 GATACTAAGAATACAGGATTAGG - Intronic
979724787 4:123947902-123947924 TCTGCTAATGATTAAGGATGGGG + Intergenic
979926783 4:126577459-126577481 ATTGCTAAGGATTCAGGAAGAGG - Intergenic
981640395 4:146935688-146935710 GATGTTAAGGCTCCAGGATGGGG + Intronic
981719902 4:147790928-147790950 AATGGTAAGGACACAGGATGAGG - Intronic
982757508 4:159240036-159240058 AATGGTAAGGATTTAGGATTGGG + Intronic
983830430 4:172320285-172320307 GAAGCTAAGCACTCAGGAAGAGG - Intronic
983905050 4:173173099-173173121 GATGCAAAGGCATCAGGATTTGG + Intronic
985422238 4:189795779-189795801 GATGCTGAGGATGCTGGATGTGG - Intergenic
986120497 5:4831452-4831474 GGTGCTAAGGTTTCAGTCTGGGG + Intergenic
987704434 5:21445320-21445342 GTTGCTAAGGTTCCAGGTTGAGG - Intergenic
988362479 5:30254309-30254331 TATGTTCAGGGTTCAGGATGAGG - Intergenic
992531033 5:77652082-77652104 TATGCTACCCATTCAGGATGGGG + Intergenic
995670487 5:114597470-114597492 GTTGTAAAGGATTCAGGAAGTGG - Intergenic
996612130 5:125394843-125394865 GAAGACAAGAATTCAGGATGTGG + Intergenic
998003286 5:138640920-138640942 GAAGATAAGTATTCAGGAGGGGG + Intronic
998892247 5:146758624-146758646 GATGCTAAGGATTCAGGATGGGG - Intronic
1001963506 5:175894694-175894716 GAAGCCAAGGCCTCAGGATGGGG + Intergenic
1003889623 6:10552417-10552439 GAATCCAAGGATTCAGGATCTGG - Intronic
1003904249 6:10684447-10684469 GATGCTAAATAACCAGGATGAGG + Intronic
1005242789 6:23851779-23851801 GATGCTGAGGATTGATGTTGAGG + Intergenic
1006233538 6:32606830-32606852 GGAGCTAAGGTTCCAGGATGAGG + Intergenic
1008643293 6:53486733-53486755 GTTGCTAGAGTTTCAGGATGGGG - Intergenic
1008965050 6:57306651-57306673 GAGGCTGAGGTTTCAGGACGCGG - Intergenic
1008980763 6:57481266-57481288 GTTGCCAGGGATTAAGGATGGGG - Intronic
1009168860 6:60374223-60374245 GTTGCCAGGGATTAAGGATGGGG - Intergenic
1014789855 6:125659875-125659897 GAAGCTTAGAATTCAGGATTAGG + Intergenic
1015173915 6:130285561-130285583 TATGCTAAGGGTGGAGGATGAGG + Intronic
1020379806 7:7531089-7531111 GATGCTGAGGATTTTGGAAGGGG - Intronic
1023624646 7:42103761-42103783 CAAGATAAGGAGTCAGGATGGGG + Intronic
1031619218 7:123915997-123916019 GATGCTAAAGAGTCAGTATCAGG + Intergenic
1032532936 7:132636897-132636919 CATGCAAAGGATGCAGGAGGTGG + Intronic
1032702496 7:134394910-134394932 GTTGCAAAGGATTGAGGAGGAGG + Intergenic
1032924325 7:136585650-136585672 GAAGATAATGATTCAGAATGTGG + Intergenic
1033204578 7:139406931-139406953 GGCGCTAAGGATAGAGGATGGGG + Intronic
1035646063 8:1222024-1222046 GAAGCTCAAGATTCAGAATGAGG - Intergenic
1037328871 8:17723758-17723780 GATGCTTTGGATTTAGGAAGTGG + Exonic
1037583535 8:20261152-20261174 GATGTTGGGGATTCAGGAAGGGG + Intronic
1038685857 8:29717896-29717918 GTTGCCAAGGATTAAGGAAGGGG + Intergenic
1039727289 8:40232466-40232488 CCTGCTAAGAATTCAGGAAGAGG + Intergenic
1041486685 8:58385155-58385177 GTTGCCAAGGATTGGGGATGGGG - Intergenic
1041966286 8:63681854-63681876 GATGTTAAGAAGTCAGGAGGTGG - Intergenic
1046800088 8:118416764-118416786 GATGCTAAGGATTGAAGGGGTGG - Intronic
1048609949 8:136011226-136011248 GTTGAAAAGGATTCAGGATCAGG + Intergenic
1048762477 8:137810721-137810743 GATGCTATGGTTGCAGAATGTGG - Intergenic
1051128430 9:13832468-13832490 GAGTTCAAGGATTCAGGATGAGG - Intergenic
1051846309 9:21455171-21455193 GATGCGAAGGATCTAGGTTGTGG + Intergenic
1052518719 9:29515013-29515035 GATTTTATGGATACAGGATGGGG + Intergenic
1055493293 9:76827989-76828011 TATGCTAACGATTCAAGATTAGG + Intronic
1055679273 9:78698202-78698224 GATGCTACTGATTCAGGAGCAGG + Intergenic
1056472224 9:86917192-86917214 GATGCCATGGATTAAGCATGAGG + Intergenic
1057526512 9:95807905-95807927 TTTCCTAAGGATTCAGGATGAGG - Intergenic
1057928098 9:99170712-99170734 GATGCCAGGCACTCAGGATGTGG + Intergenic
1058053901 9:100430928-100430950 GATGCTAAGGAGAGAGGTTGAGG + Intronic
1059886783 9:118753417-118753439 GATGCTAAGAATACACAATGGGG + Intergenic
1060874142 9:127067963-127067985 TATGCTAAGGACTCAGGCTGTGG - Intronic
1061818011 9:133207766-133207788 GAAGCTGAGGGTTAAGGATGGGG - Intronic
1061818017 9:133207788-133207810 GAAGCTGAGGGTTAAGGATGGGG - Intronic
1062315547 9:135965392-135965414 GAGGCTCAGGATGCAGGGTGAGG - Intergenic
1185758336 X:2670166-2670188 GATGCTTGGGACTCAGGCTGGGG - Intergenic
1187040993 X:15595596-15595618 GATGTTCAAGATTCAGGAGGGGG - Intronic
1187643646 X:21322136-21322158 GTTGCCAAGGATTTAGGAAGAGG - Intergenic
1189931626 X:46018134-46018156 GATCCTAAGGAGACATGATGTGG - Intergenic
1191899925 X:66030498-66030520 GATGTTAAGAGTTCAGGAGGAGG + Intronic
1191960533 X:66696507-66696529 GATGCTGAGGATATTGGATGTGG + Intergenic
1193489758 X:82134539-82134561 GCAGCAAAGCATTCAGGATGTGG - Intergenic
1193511122 X:82400545-82400567 GATACTACTGATACAGGATGGGG - Intergenic
1195888622 X:109668607-109668629 GATGCTGAGGAGTGGGGATGGGG - Intronic
1196645730 X:118116304-118116326 GATGCGAAGGTGTAAGGATGAGG + Intronic
1201790945 Y:17839949-17839971 TAGGTTTAGGATTCAGGATGAGG + Intergenic
1201810609 Y:18066040-18066062 TAGGTTTAGGATTCAGGATGAGG - Intergenic
1202335970 Y:23811447-23811469 AAGGTTTAGGATTCAGGATGAGG + Intergenic
1202352559 Y:24009598-24009620 TAGGTTTAGGATTCAGGATGAGG + Intergenic
1202518220 Y:25660517-25660539 TAGGTTTAGGATTCAGGATGAGG - Intergenic
1202534796 Y:25858620-25858642 AAGGTTTAGGATTCAGGATGAGG - Intergenic