ID: 998893752

View in Genome Browser
Species Human (GRCh38)
Location 5:146774916-146774938
Sequence ACATTACCAAAACTGACTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 10, 3: 33, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998893750_998893752 11 Left 998893750 5:146774882-146774904 CCTAGATTAACTGGACAAATTCC 0: 1
1: 5
2: 77
3: 298
4: 1375
Right 998893752 5:146774916-146774938 ACATTACCAAAACTGACTTAAGG 0: 1
1: 0
2: 10
3: 33
4: 212
998893748_998893752 27 Left 998893748 5:146774866-146774888 CCAACAAATTGGGTAACCTAGAT 0: 4
1: 41
2: 247
3: 671
4: 1269
Right 998893752 5:146774916-146774938 ACATTACCAAAACTGACTTAAGG 0: 1
1: 0
2: 10
3: 33
4: 212
998893751_998893752 -10 Left 998893751 5:146774903-146774925 CCTAGAAACACAGACATTACCAA 0: 1
1: 3
2: 8
3: 122
4: 640
Right 998893752 5:146774916-146774938 ACATTACCAAAACTGACTTAAGG 0: 1
1: 0
2: 10
3: 33
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998893752 Original CRISPR ACATTACCAAAACTGACTTA AGG Intronic