ID: 998894380

View in Genome Browser
Species Human (GRCh38)
Location 5:146783233-146783255
Sequence TCATCCCCAGGTTTAATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998894378_998894380 7 Left 998894378 5:146783203-146783225 CCTAATACAGAAGCATGCATGGT 0: 1
1: 0
2: 1
3: 13
4: 227
Right 998894380 5:146783233-146783255 TCATCCCCAGGTTTAATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998894380 Original CRISPR TCATCCCCAGGTTTAATTTA TGG Intronic
No off target data available for this crispr