ID: 998895323

View in Genome Browser
Species Human (GRCh38)
Location 5:146792752-146792774
Sequence GCTGCTTGAACTCCCCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 8, 3: 5, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998895323_998895326 -6 Left 998895323 5:146792752-146792774 CCAGACTGGGGAGTTCAAGCAGC 0: 1
1: 0
2: 8
3: 5
4: 115
Right 998895326 5:146792769-146792791 AGCAGCAGCAAGAAGGCTACGGG 0: 1
1: 0
2: 0
3: 25
4: 283
998895323_998895325 -7 Left 998895323 5:146792752-146792774 CCAGACTGGGGAGTTCAAGCAGC 0: 1
1: 0
2: 8
3: 5
4: 115
Right 998895325 5:146792768-146792790 AAGCAGCAGCAAGAAGGCTACGG 0: 1
1: 1
2: 1
3: 38
4: 382
998895323_998895328 13 Left 998895323 5:146792752-146792774 CCAGACTGGGGAGTTCAAGCAGC 0: 1
1: 0
2: 8
3: 5
4: 115
Right 998895328 5:146792788-146792810 CGGGACAGGCAGAAAGCAGTAGG 0: 1
1: 0
2: 0
3: 25
4: 215
998895323_998895329 21 Left 998895323 5:146792752-146792774 CCAGACTGGGGAGTTCAAGCAGC 0: 1
1: 0
2: 8
3: 5
4: 115
Right 998895329 5:146792796-146792818 GCAGAAAGCAGTAGGAAGTGAGG No data
998895323_998895327 -1 Left 998895323 5:146792752-146792774 CCAGACTGGGGAGTTCAAGCAGC 0: 1
1: 0
2: 8
3: 5
4: 115
Right 998895327 5:146792774-146792796 CAGCAAGAAGGCTACGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998895323 Original CRISPR GCTGCTTGAACTCCCCAGTC TGG (reversed) Intronic
903604429 1:24565203-24565225 GATGCTGTAGCTCCCCAGTCTGG - Intronic
906096542 1:43228084-43228106 CCTGAGTGAACTCCCCAGTGGGG + Intronic
909434959 1:75630428-75630450 GTAGCTGGAACTGCCCAGTCTGG - Intergenic
913702362 1:121385328-121385350 GCTGCCTGATGTCACCAGTCAGG - Intronic
914042925 1:144065824-144065846 GCTGCCTGATGTCACCAGTCAGG - Intergenic
914135161 1:144894664-144894686 GCTGCCTGATGTCACCAGTCAGG + Intronic
917448862 1:175129807-175129829 GAGGTCTGAACTCCCCAGTCAGG - Intronic
920489789 1:206404070-206404092 GCTGCCTGATGTCACCAGTCAGG - Intronic
920725297 1:208429250-208429272 GAGGCTTGAAATCACCAGTCCGG + Intergenic
921005046 1:211085044-211085066 CCTGCTTTGACTCCCCAGCCTGG - Intronic
1063149065 10:3320528-3320550 GCTCCTTGGACCCCACAGTCTGG - Intergenic
1066754707 10:38699739-38699761 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1067093866 10:43285859-43285881 GCTGCCTGTCCTCCCCAGTGAGG - Intergenic
1069823852 10:71243394-71243416 TCTGCCTGCACTGCCCAGTCTGG + Intronic
1076265022 10:129103035-129103057 GCTCCTTGAACATCCCAGGCAGG - Intergenic
1077107219 11:847477-847499 GGTCCTTCAACACCCCAGTCGGG - Intronic
1077165335 11:1132374-1132396 GCCTCTGGAACTCTCCAGTCAGG - Intergenic
1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG + Intronic
1079435058 11:20439007-20439029 GCTGCTGAACCACCCCAGTCTGG - Intronic
1080587657 11:33696188-33696210 GCTGCTATAACTCCACAGACTGG - Intergenic
1080892780 11:36423903-36423925 GCTTCTCGAAGCCCCCAGTCTGG - Intronic
1085022350 11:73217733-73217755 GCTCCCTGAACTCCCCACTCTGG - Intergenic
1086699358 11:89882512-89882534 GCTGCCTGAACTACACAATCTGG - Intergenic
1086706813 11:89962002-89962024 GCTGCCTGAACTACACAATCTGG + Intergenic
1092209235 12:6635656-6635678 GATGCTTGAAGCCCCCACTCTGG - Intronic
1093866944 12:24238693-24238715 GCTGCTTGAACCCCACTGCCTGG + Intergenic
1096257057 12:50069643-50069665 GCTTCCTTAATTCCCCAGTCTGG + Intronic
1097019511 12:56009915-56009937 GCAGCTTGAACTTCCCAGCATGG + Intronic
1102163997 12:110791675-110791697 CCTTCTTGACCTCCCCAGGCTGG - Intergenic
1105401276 13:20098162-20098184 GCTGGTTTAACTCCCCAGAGAGG - Intergenic
1107549197 13:41458685-41458707 GCTGCTTAAACTCGCCTGCCTGG - Intronic
1108472939 13:50785701-50785723 GCAACTTCAACTCCCAAGTCAGG - Intronic
1109179861 13:59200822-59200844 GCTGCAAGAACTCCCGATTCAGG + Intergenic
1121527596 14:94630085-94630107 GCTCCTTGATGTCCCCAGCCTGG - Intergenic
1129666620 15:77582865-77582887 GCTGCATAAACTCCCCTGTCTGG + Intergenic
1129918948 15:79302148-79302170 GGGACTGGAACTCCCCAGTCTGG + Intergenic
1129936133 15:79451581-79451603 GCTGCAGGCAATCCCCAGTCTGG + Intronic
1130118304 15:81024660-81024682 CCTGCTTAACTTCCCCAGTCAGG - Intronic
1130573924 15:85073878-85073900 CCTGCCTGCTCTCCCCAGTCAGG + Intronic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1135309696 16:21395842-21395864 ACTGCTGGAACTCCCCACCCTGG - Intergenic
1136306440 16:29374966-29374988 TCTGCTGGAACTCCCCACCCTGG - Intergenic
1136655896 16:31709066-31709088 GCTGCCAGATCTCCCCAGACAGG - Intergenic
1136727979 16:32377109-32377131 GCTTCTTGAACTTCCCAGTCTGG + Intergenic
1137833667 16:51569691-51569713 GCAGCTGGTACTCCCCAGACAGG + Intergenic
1139191867 16:64873470-64873492 ACTGCTAGAACAACCCAGTCAGG - Intergenic
1140594209 16:76390027-76390049 GCTCCTAGAATTCCCCAGTGGGG - Intronic
1141268391 16:82517688-82517710 CTTGCTTGAACTCCAAAGTCGGG - Intergenic
1202998459 16_KI270728v1_random:140645-140667 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1203130053 16_KI270728v1_random:1677049-1677071 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1143988682 17:10938085-10938107 GCTGCTTGGATTCCACAGTAGGG + Intergenic
1145981114 17:29012221-29012243 GCTGTTTCCCCTCCCCAGTCTGG - Intronic
1146438490 17:32873363-32873385 CCTGCTCTTACTCCCCAGTCTGG - Intronic
1147188970 17:38728081-38728103 GCCGCTTGCATTCCCCAGACTGG + Exonic
1148678356 17:49458242-49458264 GCAGCTTGCTCTCCCCAGGCAGG + Intronic
1150069683 17:62140198-62140220 GCGCCTTGAACTCCCCGCTCTGG + Intergenic
1151548816 17:74809487-74809509 GCTGCCTGGACTCCCCTGTGCGG - Intronic
1152672044 17:81614389-81614411 GCTGCCTCAATTCCCCAGTGAGG + Intronic
1155311985 18:24532930-24532952 GCTGCTTGTCCTCCCCACCCTGG - Intergenic
1158546828 18:58404341-58404363 GCTGCATGAACGGCCCAGCCTGG + Intergenic
1159884212 18:73888775-73888797 GCTGCCTGCAATGCCCAGTCTGG - Intergenic
1160728553 19:629896-629918 GCGCCTTGAACTCCCCGCTCTGG + Exonic
1161772236 19:6237076-6237098 GCTGCCTGGACTCCCCACCCCGG - Intronic
927204395 2:20597983-20598005 GCTGCCTGACCTACCCAGCCAGG - Intronic
928016642 2:27663959-27663981 GCTTCTTGAAGTCCCCACTGAGG - Exonic
931633863 2:64324875-64324897 GCTGCACGAAGTCCCCAGTCAGG + Intergenic
932417055 2:71579936-71579958 GCTGCTGGACATCCCCACTCAGG - Intronic
933151703 2:78922830-78922852 GCTGCATGGACTCCCCACCCAGG - Intergenic
934317990 2:91943973-91943995 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
935427900 2:102940349-102940371 GTTGTTTGAGCTCCCCAGTTAGG + Intergenic
939718295 2:145613890-145613912 GCTGGATGAACTTCACAGTCAGG + Intergenic
943351864 2:186805863-186805885 GCTGCCTGCAGTCCCCAGCCAGG + Intergenic
1169430404 20:5531289-5531311 GCTGCTTGCTTTCCCCAGCCAGG + Intergenic
1175571961 20:60030203-60030225 GCTGGGTGACTTCCCCAGTCTGG + Intronic
1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG + Intergenic
1179973129 21:44847358-44847380 GCTGCTTGCAGGCCGCAGTCAGG - Intergenic
1180306163 22:11127646-11127668 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1180544682 22:16489829-16489851 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1183212292 22:36458361-36458383 GCTGCATGGGGTCCCCAGTCGGG + Intergenic
949627349 3:5881732-5881754 GCTGCTTTAGCTCCTCAATCAGG - Intergenic
950093747 3:10315884-10315906 ACTGCCTGGAGTCCCCAGTCAGG + Intronic
951999765 3:28772145-28772167 GCAGCTTGCACTCTCCAGTGTGG - Intergenic
952917723 3:38261819-38261841 GTTGCTTTAAATTCCCAGTCTGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954326719 3:49868078-49868100 GCTGCTGCAGCCCCCCAGTCAGG + Intronic
954933821 3:54308384-54308406 GCTTCTTGAACTCCTTAGCCTGG - Intronic
955482291 3:59402007-59402029 GGTGCCTGGACTCCCCATTCTGG + Intergenic
957969379 3:87363571-87363593 GCTGCTTGAACTACCCAGCAGGG - Intergenic
961579825 3:127871532-127871554 GCTGTTCCATCTCCCCAGTCAGG + Intergenic
964958688 3:162395002-162395024 GCTGCAGAAACTCCCCAGTTTGG + Intergenic
966831809 3:184016892-184016914 GCAGCTTGCACACACCAGTCTGG - Intronic
968867063 4:3219923-3219945 GCTGCTGGCACACCCCACTCAGG - Intronic
969694398 4:8726405-8726427 GCTGGTTGACCTCCCCAGGTGGG + Intergenic
973995421 4:56453713-56453735 ACATCCTGAACTCCCCAGTCTGG - Exonic
977043987 4:92046260-92046282 GGTGCATGCAGTCCCCAGTCAGG - Intergenic
977950470 4:102965255-102965277 GCTTCTTGAACTTCCCGGTCTGG - Intronic
983568165 4:169176166-169176188 GTTGTTTATACTCCCCAGTCAGG + Intronic
986041824 5:4001178-4001200 GCTGCATGACCTGCCCATTCCGG + Intergenic
988528210 5:32004684-32004706 GCAGCTTGAACTCTGAAGTCTGG - Intronic
989782446 5:45284653-45284675 GCTGCTTTAATTTCCCAGCCGGG + Intronic
990546430 5:56826630-56826652 GCTGCTGGACCTCCACAGACAGG + Intronic
992386731 5:76291787-76291809 GATGTTTCAACTACCCAGTCAGG + Exonic
992508101 5:77407471-77407493 GCTGCCTGCACTCTGCAGTCAGG + Intronic
993806376 5:92415794-92415816 ACTGCATGAACTCGCCAGTGCGG + Intergenic
998895323 5:146792752-146792774 GCTGCTTGAACTCCCCAGTCTGG - Intronic
1006625081 6:35392159-35392181 GCAGCCTGTACTTCCCAGTCTGG + Intronic
1006625130 6:35392429-35392451 GCAGCCTGTACTTCCCAGTCTGG - Intronic
1007549794 6:42720495-42720517 ACTGCTGCAAATCCCCAGTCAGG - Intronic
1013427029 6:110021571-110021593 GCAGATTGACCTCCCCAGTGTGG + Intergenic
1015048998 6:128816124-128816146 GTGGCTTAAACTCCCCATTCTGG + Intergenic
1018669767 6:166168442-166168464 GATGCCTCAACTCTCCAGTCTGG + Exonic
1019595351 7:1855881-1855903 GCTGCTGGAACCCCACAGACAGG + Intronic
1022520948 7:31006569-31006591 GCTACCTGAGGTCCCCAGTCTGG - Intergenic
1024715446 7:52074742-52074764 GCTGGTTGCACTCCTCAGCCAGG - Intergenic
1026365087 7:69640295-69640317 ACTTCTTGATCTCCCCAGCCGGG + Intronic
1032784033 7:135186675-135186697 GCAGCTTGCATTCCCCAGTATGG - Intronic
1033670242 7:143485618-143485640 GTAGTTTGAACTCCCGAGTCAGG + Intergenic
1041220641 8:55648111-55648133 TCTGCTTGAACTCTGCAGGCAGG - Intergenic
1043361267 8:79475227-79475249 GCTACCTGAACTCCCAACTCAGG - Intergenic
1047587739 8:126292927-126292949 GCTGCTTGAACCCCGAAGGCTGG + Intergenic
1056221245 9:84452506-84452528 GCTGCTTCAAGTCACCATTCAGG - Intergenic
1056803570 9:89711125-89711147 GCTGCCTGGACTCCCCCGACCGG - Intergenic
1056956999 9:91090583-91090605 GCTTCTTGAAGGCCCCAGTGGGG - Intergenic
1057862145 9:98649175-98649197 ACTGATTTAACTCACCAGTCAGG + Intronic
1058317196 9:103582721-103582743 GCTGCCTGAAGCACCCAGTCAGG - Intergenic
1060197503 9:121633012-121633034 GCAGCTGGAACCCCTCAGTCTGG - Intronic
1061042505 9:128148305-128148327 GCTGCTTGGGATCCCCAATCTGG - Intergenic
1193925589 X:87479701-87479723 GCTGGTTGGGCTCCACAGTCAGG + Intergenic
1201185552 Y:11399011-11399033 GCTTCTTGAACTTCCCAGTCTGG - Intergenic