ID: 998896449

View in Genome Browser
Species Human (GRCh38)
Location 5:146805222-146805244
Sequence CTTCATGCACAAATGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998896449 Original CRISPR CTTCATGCACAAATGGCTCA GGG (reversed) Intronic
901113581 1:6819709-6819731 ATTTATCCTCAAATGGCTCAGGG - Intronic
901327947 1:8380199-8380221 CTTCATGCCCACATGGCAAAAGG + Intronic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
909131072 1:71738201-71738223 CTTCGTTCACAAATGTCTCCAGG - Intronic
911665191 1:100543631-100543653 TTCCATGCCCAAATGGCTCGAGG - Intergenic
916278852 1:163025895-163025917 CCTCATCCACAACTGGCTAAGGG - Intergenic
918797826 1:188927055-188927077 CTTCAGGCATAAATGGGTTAAGG - Intergenic
920548297 1:206837060-206837082 CTTCATGTCTAAATGGCTCTGGG + Intronic
920740893 1:208580139-208580161 CTTCATGCGTAAATGCTTCATGG - Intergenic
920809294 1:209267345-209267367 CTTGATGCCCAAAAGACTCAAGG - Intergenic
1062897916 10:1118563-1118585 CTTCATGCAGAGCTGGCTGAGGG - Intronic
1068074985 10:52241589-52241611 CTTCATGTACAGAAGGCTTAGGG - Intronic
1068714365 10:60171901-60171923 TTTAATGCACAAATGGTACATGG - Intronic
1074564111 10:114561341-114561363 CTTAATACACACATGGCTGAAGG + Intronic
1076443543 10:130496581-130496603 ATTCATGCAGAAAAGGCACAGGG - Intergenic
1080029938 11:27649785-27649807 ATTCAGGCACAAAGGACTCAGGG + Intergenic
1081396233 11:42589583-42589605 CTTCCTGCAATAATGGCTCAAGG - Intergenic
1081741357 11:45443248-45443270 CTCCATGCACTGATGGCTCTGGG + Intergenic
1087591152 11:100189303-100189325 CTGCATGCCCAAGTGGATCAGGG + Intronic
1089134095 11:116235461-116235483 CTGCAGGCACAAGTGGCCCAGGG + Intergenic
1094580691 12:31731334-31731356 GCACATGGACAAATGGCTCAAGG - Intergenic
1095612744 12:44149256-44149278 CTTCTTGCTCACATGACTCAAGG - Intronic
1098986497 12:77018052-77018074 CTTCATGCACAAATTGCAGCAGG - Intergenic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1102894993 12:116591826-116591848 CTTCAGGCACAACTGGATCAAGG - Intergenic
1105352253 13:19626526-19626548 CTTAAGGCACAGATCGCTCATGG - Intergenic
1108065756 13:46576160-46576182 TTACATGAACAAAAGGCTCACGG - Intronic
1110565369 13:76952397-76952419 CTTTATGCAAAAGTGCCTCAAGG + Intronic
1114522897 14:23349879-23349901 CCTCATGCACAAGTGGCCAATGG - Intronic
1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG + Intronic
1117609861 14:57471485-57471507 CTTCATGAACAAGAGGCCCAGGG - Exonic
1118725181 14:68624001-68624023 CTTCCTGACCAAAAGGCTCAAGG - Intronic
1122453863 14:101834509-101834531 GTTCCAGCAGAAATGGCTCAAGG + Intronic
1123627393 15:22237230-22237252 CTTCAGGCACAACTGGATCCAGG - Intergenic
1134399622 16:13897492-13897514 CATCATGCACACAGGCCTCAGGG - Intergenic
1136107044 16:28037364-28037386 CTTCATCCACTAATGGCTTGTGG - Intronic
1137374610 16:47941899-47941921 CTTCAGGCACAATTGGATCCAGG + Intergenic
1137588773 16:49680730-49680752 CTTCATGCTCACTTGCCTCACGG + Intronic
1137701552 16:50501491-50501513 CTGCCTGCACACAGGGCTCATGG - Intergenic
1138247846 16:55480312-55480334 CTTAATGGACAAATTGGTCAAGG + Intronic
1138638946 16:58367416-58367438 CCTCAGGCACAAAGGGCTAAAGG + Intronic
1140198574 16:72876268-72876290 CTTCAGCCACAGATGGCTCAGGG + Intronic
1141268462 16:82518186-82518208 CTAGATCCACAAATGGCTAAAGG - Intergenic
1141778358 16:86139505-86139527 ATTCATGCAGAAATGGCACATGG - Intergenic
1142069173 16:88080919-88080941 CTTCAGGCATAAATGGGTTAAGG + Intronic
1143285407 17:5785392-5785414 CTTCTTGCACAAATGGAACCTGG - Intronic
1143866063 17:9925118-9925140 CTTCATGCACTGAGAGCTCAGGG - Intronic
1144300979 17:13922977-13922999 CTGCAGGCACCCATGGCTCAAGG + Intergenic
1149654708 17:58304181-58304203 CTTCATGCAAATCTGGCTCATGG + Intronic
1150307410 17:64097856-64097878 CTTCATGTTAAAATGGCTCTAGG - Intronic
1151145393 17:72035718-72035740 CCTCAGGCATAAATGGGTCAAGG - Intergenic
1151530872 17:74703910-74703932 CCACACACACAAATGGCTCATGG + Intronic
1152500818 17:80707858-80707880 CTTCATCCACAGTTGGGTCAAGG - Exonic
1153225840 18:2899053-2899075 CTGCATGCATAAATGCCTCTGGG + Intronic
1154016106 18:10619365-10619387 CTTCAGGCCCAGATGGCTCTAGG + Intergenic
1154189407 18:12216276-12216298 CTTCAGGCCCAGATGGCTCTAGG - Intergenic
1157797024 18:50583985-50584007 CTTTAGGCACAAATGCTTCAGGG + Intronic
1157901917 18:51526208-51526230 AATCATGCACAAGTGGCTCATGG + Intergenic
1159437203 18:68433738-68433760 GTACATGCAAAAAAGGCTCATGG + Intergenic
1162270305 19:9609092-9609114 CTTAAGGCACAAATCACTCATGG - Exonic
1163183338 19:15619110-15619132 CTTCAGGCACAACTGGATCCAGG + Intronic
926854008 2:17232152-17232174 CTACATGAACCATTGGCTCATGG - Intergenic
930339484 2:50094619-50094641 CCTAATGCACAAGTGGCTCCTGG - Intronic
931041612 2:58306744-58306766 CTTCATGCAGAAATGTGGCATGG + Intergenic
931607445 2:64066434-64066456 TACCATGCACAAATGGGTCATGG - Intergenic
932549177 2:72749837-72749859 CTACATGCATAAGTGGATCATGG - Intronic
932568815 2:72925832-72925854 CTTAATCTACAAATCGCTCACGG + Intronic
933030069 2:77317578-77317600 CTTCATGAAGAAAAGGCACATGG - Intronic
933686765 2:85147648-85147670 CTTCATCCACAAGTGGCACAGGG - Intronic
933823983 2:86141826-86141848 CTACCTGCCCTAATGGCTCAGGG + Exonic
935631952 2:105219310-105219332 CATCATGCACAAAGGGCTGGAGG + Intergenic
935865504 2:107383534-107383556 CCTCATATAGAAATGGCTCAAGG - Intergenic
938084578 2:128390431-128390453 CTGAATGCACAAGTGACTCAGGG - Intergenic
941045563 2:160671575-160671597 CTGCCTACACAAATGGCTCCCGG - Intergenic
946067672 2:217003228-217003250 CTGCATGGGCAAATGGCCCAAGG + Intergenic
946821480 2:223634196-223634218 CTTCATGTAAAAGGGGCTCAAGG - Intergenic
947240299 2:227987247-227987269 TTTCATGCCCACATGGCTCATGG + Intronic
947302925 2:228708395-228708417 CCTCAAACAAAAATGGCTCAAGG - Intergenic
947379475 2:229531309-229531331 CTTCATGCACAAACAGCATATGG + Intronic
1170857417 20:20070009-20070031 ATTTATGCACAAATGGTTCTTGG + Intronic
1171297491 20:24031266-24031288 TTTCATTCACAGATGGCTCGAGG + Intergenic
1172331413 20:34078425-34078447 TTTTCTGGACAAATGGCTCAGGG + Intronic
1174222178 20:48964641-48964663 CTTCATTCATAAGTGCCTCATGG + Intronic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1176968428 21:15237877-15237899 CTCCATGGTCCAATGGCTCATGG - Intergenic
1177079770 21:16624321-16624343 TTTCACACACAAATAGCTCATGG - Intergenic
1178190549 21:30274719-30274741 ATTCATGTACAAATTGCCCACGG - Intergenic
1182230859 22:28836592-28836614 CTTCAAGTACAAATGGATCCAGG + Intergenic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
950206338 3:11084141-11084163 CTTTTTGCAATAATGGCTCAAGG + Intergenic
952036207 3:29204969-29204991 ATTAATGCACAAAAGACTCAAGG + Intergenic
952701088 3:36328393-36328415 GTTCATGCTCAAAGAGCTCATGG - Intergenic
952823921 3:37509141-37509163 CTTGAAGCAGAAATAGCTCAGGG + Intronic
954854693 3:53634042-53634064 CTTCATGTTCAGATGTCTCAAGG + Intronic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955646384 3:61142065-61142087 CTTTTTACAGAAATGGCTCATGG + Intronic
958050829 3:88343142-88343164 CATCTTGCAGAAATGGCCCAAGG + Intergenic
960668147 3:120131102-120131124 CTGCATGCTCAAATGTGTCATGG - Intergenic
961575674 3:127834193-127834215 CTTCATGGAAAAATTGCTAAAGG - Intergenic
962879016 3:139558810-139558832 CATGATGCACACATGGATCAGGG + Intergenic
963486436 3:145939804-145939826 CTTTATGCAAAAATAGCTTAAGG + Intergenic
965953102 3:174334692-174334714 TATCATGCAAAAATGGCCCAGGG - Intergenic
966427366 3:179793774-179793796 CTTCATTTCCAGATGGCTCAGGG + Intergenic
968223276 3:196954770-196954792 CTTCCTCCACAAATGCCTTATGG + Intronic
970677365 4:18466448-18466470 ATTTATGGCCAAATGGCTCAGGG - Intergenic
970841917 4:20483171-20483193 ATACATTCACAAATGGCTCAAGG - Intronic
970916718 4:21344370-21344392 CTACATCCACAGATGGCTCCAGG - Intronic
974773819 4:66453134-66453156 ATTCATACACAAATGGGTAATGG + Intergenic
975525767 4:75348961-75348983 CTTCATACATAGATGGTTCATGG - Intergenic
976129485 4:81869814-81869836 CTTCATGCATAACTGTCCCATGG - Intronic
980277496 4:130673630-130673652 CTTCTTTCACAAATCACTCATGG + Intergenic
981205014 4:142030514-142030536 CTTCTTGCACAAAGAGCTAAAGG - Intronic
982587820 4:157264850-157264872 ATTTATGAACAAATGGCTAAAGG - Intronic
986365217 5:7022288-7022310 CTACAGGCACGCATGGCTCAGGG - Intergenic
991161342 5:63507372-63507394 CTTCATGCCCCAGTGGCTCCTGG + Intergenic
997251929 5:132395796-132395818 CTTCTTGCACAAATGTATCTTGG + Intergenic
998225479 5:140323259-140323281 CTTCTCCCACACATGGCTCATGG - Intergenic
998896449 5:146805222-146805244 CTTCATGCACAAATGGCTCAGGG - Intronic
999324456 5:150634909-150634931 CTTGATGCTCAAATGACCCAGGG - Intronic
999970411 5:156855461-156855483 CAACATACACAAATGACTCAGGG + Intergenic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1005308473 6:24535954-24535976 CTTCTTGCATATTTGGCTCATGG + Intronic
1005526412 6:26655559-26655581 ATTTATTCTCAAATGGCTCAGGG + Intronic
1007217125 6:40249074-40249096 CTTCAGGAAGCAATGGCTCAGGG - Intergenic
1013870965 6:114759133-114759155 CTTCAGGCACACATGGCTCTTGG + Intergenic
1015593753 6:134846426-134846448 CAGCATGCACAAAAGCCTCATGG + Intergenic
1015819813 6:137248802-137248824 CTTCATTCACAAATTGTTCTTGG - Intergenic
1017119270 6:151008574-151008596 CTTCATACACAAAGAGCTCTAGG - Intronic
1017233479 6:152096566-152096588 ATGGATGAACAAATGGCTCATGG + Intronic
1018226693 6:161635968-161635990 CTTCATCCACACATGCCCCAGGG + Intronic
1018643901 6:165930189-165930211 CTTCATTCATCAGTGGCTCAGGG - Intronic
1021844791 7:24754106-24754128 CATCATGCTCAAATAGCTCATGG + Intronic
1022604534 7:31797140-31797162 TTTCATGGACAAATGGCTAAGGG + Intronic
1023392828 7:39726783-39726805 CTCTATCCTCAAATGGCTCATGG - Intergenic
1030155538 7:106450855-106450877 TTTCCTGCACAGTTGGCTCAGGG - Intergenic
1030752391 7:113244165-113244187 CTTGATGCACAAATGCTTTAAGG + Intergenic
1033957742 7:146872744-146872766 CTGTATGCACAAATTGTTCAAGG + Intronic
1036641645 8:10588260-10588282 TTTCATGAACAAATGGCTGTGGG - Intergenic
1040894913 8:52355842-52355864 CTCCCTGCACAAATGGAACAGGG + Intronic
1042296760 8:67227530-67227552 CTTCATTGACAACTGCCTCAAGG + Exonic
1042567656 8:70128868-70128890 TCTCAGGCACAAATGGCCCAGGG - Exonic
1043637354 8:82402968-82402990 TGTCGTGAACAAATGGCTCATGG + Intergenic
1044404658 8:91814305-91814327 CTTCATGCACTTATGGGTCCAGG + Intergenic
1047420533 8:124704504-124704526 TTTCATGAACAAGTGGTTCAGGG - Intronic
1048058309 8:130890797-130890819 CTCCTTCCACAACTGGCTCATGG - Intronic
1052606363 9:30707704-30707726 CTTAAGGCACAGATTGCTCATGG + Intergenic
1056807074 9:89737090-89737112 CCTAAAGCACAAAAGGCTCAAGG + Intergenic
1058339931 9:103882339-103882361 CTTGATGCACAATTAGCTCCTGG + Intergenic
1058654667 9:107208860-107208882 CATCATGGACAAGTGGCCCATGG + Intergenic
1060516319 9:124268038-124268060 CTGGATGCTCAAATGGCTTATGG + Intronic
1188063671 X:25631149-25631171 CTTCATGTAGTAGTGGCTCAGGG + Intergenic
1189612649 X:42753621-42753643 CATCTTGAAGAAATGGCTCATGG + Intergenic
1191672856 X:63765119-63765141 CTTAATACACAAATGACTCATGG - Intronic
1194847232 X:98825474-98825496 ATTCAGGCAAAAATGGTTCAGGG - Intergenic
1195997237 X:110743511-110743533 CCTCATGGGCAAATAGCTCAGGG - Intronic
1196602235 X:117615607-117615629 CATCATGCACAAAATGTTCAAGG - Intergenic