ID: 998896888

View in Genome Browser
Species Human (GRCh38)
Location 5:146809575-146809597
Sequence ACGTATCAGCTAAAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998896886_998896888 -7 Left 998896886 5:146809559-146809581 CCTCTCTGAGGAAATGACGTATC 0: 1
1: 0
2: 1
3: 23
4: 151
Right 998896888 5:146809575-146809597 ACGTATCAGCTAAAACTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76
998896883_998896888 23 Left 998896883 5:146809529-146809551 CCTTATTTAGAGGGAGTGGTCAG 0: 1
1: 0
2: 2
3: 9
4: 103
Right 998896888 5:146809575-146809597 ACGTATCAGCTAAAACTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76
998896885_998896888 -6 Left 998896885 5:146809558-146809580 CCCTCTCTGAGGAAATGACGTAT 0: 1
1: 1
2: 1
3: 13
4: 166
Right 998896888 5:146809575-146809597 ACGTATCAGCTAAAACTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998896888 Original CRISPR ACGTATCAGCTAAAACTGGA AGG Intronic
900354206 1:2252232-2252254 ACGGAGCAGCTAAAAATGAATGG - Intronic
923370639 1:233308608-233308630 ACTTATCAGATAAAGCTGGGTGG + Intergenic
1065405515 10:25358960-25358982 AGGTATCTGCTAAATCTGGTTGG + Intronic
1070093615 10:73313924-73313946 ACCTATCAGTTATAATTGGAAGG + Intronic
1070204121 10:74238948-74238970 AAGTATCATTTGAAACTGGAAGG - Intronic
1071117571 10:82240475-82240497 AAGTATGAGCTAGAACTGAAGGG + Intronic
1072560845 10:96572436-96572458 AGGTACCCTCTAAAACTGGAGGG + Intronic
1073523523 10:104157153-104157175 AAGTATCAGCTAAACCAGAAAGG - Intronic
1075607748 10:123826484-123826506 ATGAATCAGCTAAAATTGGAAGG + Intronic
1077817628 11:5701849-5701871 ACGTAGCAGCACAAACTGTATGG - Intronic
1078323497 11:10358459-10358481 GAGCAGCAGCTAAAACTGGAGGG + Intronic
1080084872 11:28267376-28267398 ATGTCTCAGCAAATACTGGAAGG - Intronic
1092673820 12:10893488-10893510 ACATTTCAGTTAAAATTGGACGG - Intronic
1095519610 12:43047313-43047335 ACATATGAACTGAAACTGGAAGG + Intergenic
1100340082 12:93670433-93670455 ACTTATCAGCAAAAATGGGAGGG + Intergenic
1109614946 13:64820627-64820649 ATGTATCAGCTGAAAGTGAATGG + Intergenic
1118407337 14:65439017-65439039 CTGTATCAACTAAAATTGGAGGG - Intronic
1121473067 14:94171665-94171687 CAGTATCTTCTAAAACTGGAGGG - Intronic
1121725146 14:96141821-96141843 AGGAATTAGCTAAACCTGGAAGG + Intergenic
1127595693 15:60479581-60479603 AACTCACAGCTAAAACTGGATGG - Intergenic
1127934915 15:63627745-63627767 AGGTAACAGCTACATCTGGAAGG + Intronic
1133294099 16:4742152-4742174 AGGCAGGAGCTAAAACTGGAAGG - Intronic
1135580517 16:23622082-23622104 ATGTATCTTCTAAAAATGGAGGG - Intronic
1137340033 16:47592535-47592557 ATGTTTCAGCTAACGCTGGATGG - Intronic
1149572911 17:57686335-57686357 ACAAATCAGCAAAAACTAGAAGG + Intergenic
1159389316 18:67768269-67768291 AGTTATAAGCTAAAACTGGGAGG - Intergenic
1164425889 19:28141627-28141649 ACGGAGCAGCTATAAATGGAGGG + Intergenic
929703195 2:44183006-44183028 TAGTAACAGCTAAAACTGAAAGG - Intronic
930205341 2:48582159-48582181 ACGCATCAGCTCAAACCGGCAGG - Exonic
930209669 2:48621865-48621887 GCGTATCAATTTAAACTGGAAGG + Intronic
936000383 2:108822085-108822107 ACGTATCAGCTGAAAATGAAAGG + Intronic
939365588 2:141226275-141226297 ATGTATTAGGTAAAGCTGGATGG - Intronic
940164591 2:150755754-150755776 ACAATTCAGCTAAAACTAGAAGG - Intergenic
944812467 2:203341080-203341102 ATGTATCAGCAAAAGCTTGAAGG - Intronic
947608178 2:231503885-231503907 ATATTTAAGCTAAAACTGGATGG + Intergenic
1170260263 20:14397604-14397626 ATGTATCAACTAAAAATGAAAGG - Intronic
1174307222 20:49621790-49621812 ACGTGTCAGATGAAACTTGAAGG - Intergenic
1177061355 21:16378130-16378152 ACGTCAGAGCTAGAACTGGAAGG + Intergenic
1177580771 21:23019923-23019945 ACTTATCTGTTAAAACTGGAAGG - Intergenic
1181787421 22:25237273-25237295 TCCTATCGGCTGAAACTGGAAGG + Intergenic
959518645 3:107300691-107300713 AGGTATCAAATAAAGCTGGATGG - Intergenic
964787928 3:160420154-160420176 AGGTTTCAGCTAAGACTGGAGGG - Intronic
966421090 3:179735026-179735048 ACAGATCAGCTAAAATTAGAGGG - Intronic
972072098 4:35033954-35033976 ACTTATCAGCTTAAAATAGATGG + Intergenic
972772227 4:42208226-42208248 ACATTTAGGCTAAAACTGGAGGG - Intergenic
972942629 4:44215613-44215635 ACTTAACAGATAAAACTGCATGG + Intronic
973933920 4:55822585-55822607 AAGCATTAGCCAAAACTGGATGG + Intergenic
979397931 4:120211223-120211245 ACGTATAAACTGATACTGGAAGG + Intergenic
981415898 4:144492963-144492985 AAGTATCAGCCATAACTGGAGGG - Intergenic
984922031 4:184773567-184773589 ACTTATCAGCTAACAGTAGACGG - Intronic
986820030 5:11456383-11456405 AAATATCAGGTAAAACTAGAGGG - Intronic
988130222 5:27094699-27094721 AAGTATCAGCTAAAATTAGTTGG + Intronic
992643830 5:78793836-78793858 ATGTCTCAGATGAAACTGGAAGG + Intronic
993527732 5:88987301-88987323 AAGTATCACCTAAGACTGTAAGG - Intergenic
994207820 5:97055766-97055788 AAGTATCATCTTAAACTGCAAGG + Intergenic
995731119 5:115243488-115243510 ACATATCAACAAAGACTGGAAGG + Intronic
996352289 5:122557936-122557958 AGGTATTAGCTAATAATGGATGG + Intergenic
996352374 5:122559445-122559467 AAGTATTAGCTAATAATGGATGG + Intergenic
998896888 5:146809575-146809597 ACGTATCAGCTAAAACTGGAAGG + Intronic
1000432780 5:161169707-161169729 ACTTATCAACTAAAAATAGAAGG - Intergenic
1008446071 6:51593074-51593096 ACGCATAAGCTAAAAGTGAAGGG - Intergenic
1008468661 6:51858574-51858596 ATGTCTCAGTAAAAACTGGAAGG - Intronic
1014148529 6:118026205-118026227 GCGTATGAGCTAAACCTGAAAGG + Intronic
1017205011 6:151795548-151795570 AAGTGTCAGTTAAAACTGCATGG + Intronic
1028097283 7:86777017-86777039 AAGTACCTGCTAAATCTGGATGG + Intronic
1029930659 7:104367088-104367110 ACTTATCAGATAAAACTTAATGG - Intronic
1031369048 7:120941687-120941709 ACTTATAAGCTATACCTGGATGG + Intergenic
1036112689 8:5921610-5921632 ACCTAACATCTAAAATTGGAAGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1045845359 8:106628640-106628662 AGGTATCAGCTAACCTTGGAGGG - Intronic
1045930856 8:107624706-107624728 ATGTTTAAGCTGAAACTGGAAGG - Intergenic
1048608862 8:136000249-136000271 ATGTATCAGCTAAAATTGATTGG - Intergenic
1049627087 8:143629333-143629355 AAGTATAGGCTAAAACTGGAGGG - Intergenic
1050708465 9:8431389-8431411 AACTATCATCTAAAACTGAAGGG - Intronic
1050923216 9:11232153-11232175 ACATATTAGCTAAAATTGAAGGG - Intergenic
1054993986 9:71363671-71363693 GCGTATAAGCTAAGACTTGATGG - Intronic
1055382274 9:75721424-75721446 ATGAATCAGGTAAAAATGGAAGG + Intergenic
1055630421 9:78218179-78218201 ACTTTTCAGCCAAAAATGGATGG - Intergenic
1061979702 9:134094749-134094771 AAGTATCATCTTAAACTGCAAGG - Intergenic
1185959745 X:4536312-4536334 ACTTATCAGCTGATATTGGAGGG - Intergenic
1190616820 X:52242564-52242586 ACGTTTCATGTAAAACTGAAGGG + Intergenic
1195431867 X:104798195-104798217 ATGTATCAGCTAAGACTCTAAGG + Intronic
1200417274 Y:2925648-2925670 AGGTATCATCTGAACCTGGAAGG - Intronic