ID: 998903965

View in Genome Browser
Species Human (GRCh38)
Location 5:146883730-146883752
Sequence ATGTTGTAGCATGCACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998903965_998903970 21 Left 998903965 5:146883730-146883752 CCTGTTTGTGCATGCTACAACAT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 998903970 5:146883774-146883796 TTTAACGTGGCATTTAATCTGGG 0: 1
1: 0
2: 0
3: 12
4: 120
998903965_998903967 8 Left 998903965 5:146883730-146883752 CCTGTTTGTGCATGCTACAACAT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 998903967 5:146883761-146883783 ACATAAGTGATCCTTTAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 46
998903965_998903969 20 Left 998903965 5:146883730-146883752 CCTGTTTGTGCATGCTACAACAT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 998903969 5:146883773-146883795 CTTTAACGTGGCATTTAATCTGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998903965 Original CRISPR ATGTTGTAGCATGCACAAAC AGG (reversed) Intronic
900019524 1:179265-179287 ATGTTGTAGCTGACACACACAGG - Intergenic
911388813 1:97212904-97212926 TTGTTATAGCATGTTCAAACAGG - Intronic
916376677 1:164162256-164162278 ATATTGTACCACGCACAAACTGG + Intergenic
916697557 1:167254888-167254910 ATGTTGTAGAATGAATAAATAGG - Intronic
917036897 1:170757925-170757947 ATGTTGTAGAAAGCATAAAATGG - Intergenic
1064491432 10:15861058-15861080 ATGCTGTAACATTTACAAACAGG - Intergenic
1068294422 10:55051276-55051298 ATGTTATAGCATACAGAAATAGG + Intronic
1075251834 10:120885202-120885224 ATTACGTAGCATGCAGAAACAGG + Intronic
1075511707 10:123077663-123077685 AAGCTGTACCATGCACAGACTGG - Intergenic
1076961585 10:133766482-133766504 ATGTTGTAGCTGACACACACAGG + Intergenic
1076976127 11:174460-174482 ATGTTGTAGCTGACACACACAGG - Intronic
1082731009 11:56797572-56797594 ATCTTGTAAGATGCACAAAGGGG - Intergenic
1084443795 11:69191616-69191638 ATGTTGTAGCATGGAAGAGCTGG + Intergenic
1085210286 11:74770767-74770789 ATGTGGTAACGTGCAAAAACAGG - Intronic
1087532796 11:99406147-99406169 ATATTGTAGTATTCACAATCTGG + Intronic
1089617857 11:119705190-119705212 ATGTGATTGCATGCAGAAACAGG + Intronic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1098149719 12:67534212-67534234 AACTTGTAGCATGCTCAGACAGG + Intergenic
1102661222 12:114530586-114530608 AAGAGGTAGCTTGCACAAACAGG + Intergenic
1103106577 12:118232033-118232055 ATGCTGTAGCTAGCACATACTGG + Intronic
1103732006 12:123033920-123033942 ATTTTGTTGCATGCACAGATTGG - Intronic
1118904771 14:70015854-70015876 CTGTTGTTTCATGCAAAAACAGG + Intronic
1119504462 14:75160147-75160169 ATGTTTTAGAATGCCCAAACAGG - Intronic
1121502250 14:94447520-94447542 ATGTTTTAGGAAGCTCAAACTGG - Intronic
1122435961 14:101698881-101698903 AAGTTGAAGGATGCAAAAACTGG - Intergenic
1125688324 15:41577090-41577112 ATGTGGAAACATGCACAAAGAGG - Intronic
1127708930 15:61575942-61575964 AAGGTTTGGCATGCACAAACTGG + Intergenic
1129139854 15:73587762-73587784 ATGTTTTAGGATGCACAGAGAGG - Intronic
1134366174 16:13581404-13581426 ATCTTGAAGCTTGGACAAACTGG + Intergenic
1135484599 16:22853062-22853084 ATATAGCAGCATGCACAAATTGG + Intronic
1142444132 16:90123208-90123230 ATGTTGTAGCTGACACACACAGG + Intergenic
1142463375 17:112270-112292 ATGTTGTAGCTGACACACACAGG - Intergenic
1142627343 17:1200727-1200749 ATCTTGCACCATGAACAAACCGG - Intronic
1152964716 18:104372-104394 ATGTTGTAGCTGACACACACAGG - Intergenic
1158039275 18:53072653-53072675 ATATTCTACCATGCACAAAATGG + Intronic
1158096741 18:53780764-53780786 ATTTAGTAGCATGTAGAAACAGG + Intergenic
1160653091 19:244709-244731 ATGTTGTAGCTGACACACACAGG - Intergenic
1167190702 19:47987236-47987258 GTGTTTTAGCCTCCACAAACTGG - Intronic
1168726760 19:58587508-58587530 ATGTTGTAGCTGACACACACCGG + Intergenic
928809433 2:35204674-35204696 AAGATGTAGCATACACAAAAAGG - Intergenic
935781848 2:106515346-106515368 ATGTTGTGGGGAGCACAAACAGG - Intergenic
936571795 2:113623698-113623720 ATGTTGTAGCTGACACACACCGG - Intergenic
936807420 2:116352766-116352788 ATTTTCTAGCATGAATAAACAGG - Intergenic
937346066 2:121126180-121126202 ATGTGGCAGCCTGCACCAACAGG - Intergenic
941793579 2:169576607-169576629 ATGTTGAGGCATGCTCACACTGG + Intergenic
1168743955 20:219832-219854 ATATTGTAGCCTTCACAATCTGG - Intergenic
1185428401 22:50787191-50787213 ATGTTGTAGCTGACACACACCGG + Intergenic
954260746 3:49436938-49436960 ATTGTGTAGCATGCTTAAACGGG + Intergenic
956381315 3:68667330-68667352 AATTTGTAGTATGCACAAAATGG - Intergenic
965063323 3:163809496-163809518 CAGTTGTAGCATGCACAAAAGGG - Intergenic
968364752 3:198175325-198175347 ATGTTGTAGCTGACACACACAGG + Intergenic
972720939 4:41697447-41697469 AGGTTTTAGCATGGTCAAACAGG + Exonic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982766519 4:159355447-159355469 AACTTGTACCAAGCACAAACAGG + Intronic
983581594 4:169314987-169315009 ATTTTGGAGCATGCACATACAGG - Intergenic
983603570 4:169558578-169558600 ATGGTGTTGCATGTATAAACAGG + Intronic
983979422 4:173976020-173976042 CTGTTGTAGTATGCATAAGCTGG - Intergenic
985464815 4:190183964-190183986 ATGTTGTAGCTGACACACACAGG + Intronic
989067417 5:37478385-37478407 ATGCTGTATCAACCACAAACTGG - Intronic
990430308 5:55728349-55728371 TTGTTATAACAAGCACAAACGGG + Intronic
998903965 5:146883730-146883752 ATGTTGTAGCATGCACAAACAGG - Intronic
1000330732 5:160203228-160203250 ATGTTGAAGAAAGCAGAAACGGG + Intronic
1003309371 6:4956082-4956104 GTGTTGTAGAATTCACAAATAGG + Intergenic
1003391477 6:5716946-5716968 ATGTTGAAGCATGGACAACCAGG + Intronic
1011813093 6:91155511-91155533 ATGTTGCAGCAGGCTCAAGCAGG - Intergenic
1016555445 6:145331193-145331215 ATGTTTTAGCATGCAGAGGCAGG - Intergenic
1018338201 6:162818905-162818927 ATTTTGTTGCATGCATAAAAGGG - Intronic
1019251439 7:15564-15586 ATGTTGTAGCTGACACACACAGG - Intergenic
1020605973 7:10337427-10337449 TTTTTGTCACATGCACAAACTGG - Intergenic
1020766960 7:12334691-12334713 ATGCTGCAGGATGCAGAAACAGG + Intronic
1021380358 7:19958864-19958886 ATATTGTAGCATTAGCAAACTGG - Intergenic
1021932370 7:25594536-25594558 GTGTTGGAGCATCCACAGACTGG - Intergenic
1027147360 7:75705330-75705352 ATGTTGTAGCATGTAACAGCAGG + Intronic
1030260638 7:107560931-107560953 AAGTTTTAGAATGCACAAAAAGG + Intronic
1030355096 7:108532941-108532963 ATTTTGTAGAATGCACACAGAGG + Intronic
1035512611 8:204425-204447 ATGTTGTAGCTGACACACACAGG - Intergenic
1035981426 8:4376562-4376584 ATGTTGTAACAACAACAAACAGG - Intronic
1036410884 8:8499280-8499302 AAGATGTAGCATTTACAAACAGG + Intergenic
1037508183 8:19554010-19554032 ATGTTGAACAATGGACAAACTGG - Intronic
1038281503 8:26169413-26169435 ATTCTGTAGCTAGCACAAACAGG + Intergenic
1043146667 8:76665301-76665323 ATGTTGTAGGGTGTTCAAACAGG - Intergenic
1044884611 8:96763500-96763522 ATGTTTTAGAATTGACAAACTGG + Intronic
1046073640 8:109289273-109289295 ATGTTTTAGCATGAAAAGACTGG - Intronic
1046738880 8:117807641-117807663 ATGTTTTAGCTTGAACAGACTGG - Intronic
1048485032 8:134839587-134839609 ATGCTGTAGCATGCTCATAGTGG + Intergenic
1048562690 8:135558930-135558952 ATGTTGTAGCCATCAGAAACTGG - Intronic
1050681784 9:8119753-8119775 AGGTCCCAGCATGCACAAACAGG - Intergenic
1052847361 9:33349075-33349097 ATGTTTTAGAATGGATAAACTGG - Intronic
1056059656 9:82870848-82870870 ATGTTGTAGTAGCCCCAAACTGG - Intergenic
1056213798 9:84389874-84389896 CTGTTGTGGGATGCAAAAACTGG - Intergenic
1057056321 9:91964013-91964035 ATGTCCCAGCATGCACACACAGG - Intergenic
1062749120 9:138238208-138238230 ATGTTGTAGCTGACACACACAGG + Intergenic
1186060108 X:5695744-5695766 ATGTATTTGAATGCACAAACGGG + Intergenic
1190383647 X:49863442-49863464 CTGTTGTTGCCTGCAAAAACGGG + Intergenic
1192640258 X:72855637-72855659 ATGGTACAGTATGCACAAACAGG + Intergenic
1192641453 X:72865139-72865161 ATGGTACAGTATGCACAAACAGG - Intergenic
1193764410 X:85508733-85508755 ATGTTTTACCATGGACGAACCGG + Intergenic
1198812931 X:140554146-140554168 TTGGTCTGGCATGCACAAACAGG + Intergenic