ID: 998904481

View in Genome Browser
Species Human (GRCh38)
Location 5:146889788-146889810
Sequence CAGAAGTTAGGGCAGTTTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998904477_998904481 -1 Left 998904477 5:146889766-146889788 CCTCTGAATTTGTAATTGTTGTC 0: 1
1: 0
2: 2
3: 32
4: 286
Right 998904481 5:146889788-146889810 CAGAAGTTAGGGCAGTTTTCGGG 0: 1
1: 0
2: 4
3: 36
4: 248
998904476_998904481 0 Left 998904476 5:146889765-146889787 CCCTCTGAATTTGTAATTGTTGT 0: 1
1: 0
2: 0
3: 35
4: 486
Right 998904481 5:146889788-146889810 CAGAAGTTAGGGCAGTTTTCGGG 0: 1
1: 0
2: 4
3: 36
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998904481 Original CRISPR CAGAAGTTAGGGCAGTTTTC GGG Intronic
903438639 1:23370770-23370792 CAGAGGTTAGGCCAGTTTGGTGG + Exonic
906601247 1:47131221-47131243 CAGAAGTTAGGAGAATTTTGGGG + Intergenic
907486091 1:54779305-54779327 CTGAATTTAAGGCAGTCTTCTGG - Intergenic
907508726 1:54942596-54942618 CAGAAGTTGGAACAGTTTGCAGG + Intergenic
908195815 1:61744773-61744795 CAGAAGTGAGGGCAGTCTTATGG - Intronic
908255006 1:62295841-62295863 CAGAAGTATGAGCAGTTCTCTGG - Intronic
908722125 1:67137124-67137146 CAGAAGTAAGGGCAGTTTTGGGG - Intronic
909701179 1:78525233-78525255 CTGAAGTTAGGGCAGTCTTCTGG - Intronic
910342482 1:86203472-86203494 CAGATGGTAGGGAAGTTTGCTGG - Intergenic
910409499 1:86925312-86925334 CAGAGGTTAGAACAGTTTTGAGG - Intronic
911333782 1:96556382-96556404 CAGAAGGTAGGGCAGTCATGAGG + Intergenic
911393254 1:97273027-97273049 CAGAAATAAGGGCATTTTACGGG + Intronic
911465003 1:98240376-98240398 CAGAATTCAGGGCAGTTCTGAGG - Intergenic
912256114 1:108059582-108059604 CTGAAGTAAGGGCAGTTTTGTGG + Intergenic
912665839 1:111578788-111578810 CTGAAGTGAGAGCAGTTTTGTGG - Intronic
914929585 1:151919201-151919223 CTGAAGTGAGGGCAGTCTTGTGG - Intergenic
915971452 1:160358086-160358108 CAGAACTCAGTGCAGTTTTTTGG - Intronic
916268011 1:162910713-162910735 CTAAAGTGAGGGCAGTTTTGTGG + Intergenic
918073097 1:181148186-181148208 CTGAAGTGAGGGCAGTCTTGTGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918634134 1:186754869-186754891 CAAAAGTTAGTGCAATATTCTGG + Intergenic
921362767 1:214345263-214345285 CTGAAGTGAGGGCAGTCTTGTGG - Intergenic
922137270 1:222841582-222841604 CACTAGTAAGGGCAGTCTTCTGG - Intergenic
922381311 1:225030641-225030663 CAGATGTTAGGGTAATTGTCTGG - Intronic
923424798 1:233858411-233858433 CCAAAGTGAGGGCAGTTTTGTGG - Intergenic
924374597 1:243391879-243391901 CAGTGGTTTGGGCAGTGTTCCGG + Intronic
1065864170 10:29899171-29899193 CAGAAGTTGGGGGAGATTTCTGG + Intergenic
1067805928 10:49393941-49393963 CAGAAGTTTGGGCATTTGGCAGG - Intronic
1067922699 10:50476426-50476448 CAGAGGTTAGAACAGTTTGCAGG + Intronic
1068804784 10:61183293-61183315 CAGAAGGGAGGGCAGTTTTGGGG - Intergenic
1069014261 10:63410570-63410592 TAGAAGTTAGGACTGATTTCTGG - Intronic
1070828620 10:79405428-79405450 CAGAAGTTAGGGCAGGGTGGAGG + Intronic
1071202542 10:83235831-83235853 CTGAAGTTGGGGCAGTCTTGAGG + Intergenic
1071516988 10:86304539-86304561 CAGAAGGCATGGCAGATTTCAGG + Intronic
1072300238 10:94053844-94053866 CAGAAGTTATTTCATTTTTCAGG + Intronic
1073922220 10:108471752-108471774 CAGAGGTTAGGACAGTTTGCAGG - Intergenic
1075161546 10:120028875-120028897 CAGAAGTCAGGGCTGTTGTGAGG + Intergenic
1075402178 10:122168876-122168898 CCCAAGCTAGGGCAGTGTTCTGG + Intronic
1077831210 11:5872878-5872900 CAGAAGTGAGGGTAGTCTTCGGG + Intronic
1080126661 11:28742977-28742999 CAAAAGTTAGGGCTGATTTCGGG - Intergenic
1080678773 11:34453532-34453554 AACAAATTAGGCCAGTTTTCAGG + Intronic
1081417785 11:42836374-42836396 CAGAAATTAGGGAAATTTTTCGG + Intergenic
1081599984 11:44486267-44486289 CTGAAGTGAGGGCAGTTTTGTGG - Intergenic
1082918199 11:58462734-58462756 CTGAAGTGAGGGCAGTCTTGTGG - Intergenic
1083121969 11:60521718-60521740 CAGATGTTAGGACAGTTTGGAGG - Intronic
1083978666 11:66145715-66145737 CAAAAGTTCAAGCAGTTTTCAGG - Intronic
1084616425 11:70239475-70239497 CAGAAGGGAGGGCAGCATTCTGG - Intergenic
1087060924 11:93976912-93976934 CTGAAGTGAGGGCAGTCTTGTGG - Intergenic
1087343909 11:96944741-96944763 AAGAAGTTAAAGCAGGTTTCAGG + Intergenic
1089699277 11:120234733-120234755 CCGAAGTCAGGGCAGATTCCAGG + Intergenic
1091099122 11:132854016-132854038 CTGATGTTAGGGCAGTCTTGTGG - Intronic
1091110448 11:132961646-132961668 CAGAAGTTAGGTCAGCTCTGTGG + Intronic
1092062903 12:5565403-5565425 CAGAAGTGAGGGCTCCTTTCCGG - Intronic
1092731114 12:11535367-11535389 CAGAAGTGAAGGCAGTCTTGTGG + Intergenic
1093137408 12:15468815-15468837 CAGAAGTTAAGGGAGATTTAGGG - Intronic
1093214228 12:16344759-16344781 CAGAAGTTAGCACAGCTTTCAGG + Intergenic
1094019320 12:25897369-25897391 CAGAAGTTAGGGGTGTTTATGGG - Intergenic
1094253547 12:28395372-28395394 CTGAAGTGAGGTCAGTCTTCTGG - Intronic
1094481387 12:30885168-30885190 GAGAATTTTGGGCAGTTTTATGG + Intergenic
1094743419 12:33315378-33315400 CAGAGGTTAGAGCAGTTTGGAGG - Intergenic
1095229588 12:39723341-39723363 CAGAAGTAAAGGCAGTTTTATGG + Intronic
1095632886 12:44398634-44398656 CAGCAGTTAGGCCTGTTCTCAGG - Intergenic
1096662801 12:53139091-53139113 CAGAAGTAAGGACAGTATTGTGG - Intergenic
1097247909 12:57616726-57616748 GAGAAGTGAGGGTAGATTTCTGG + Intronic
1097522932 12:60690575-60690597 CAGAAGTTGGGACAGTTTGGAGG + Intergenic
1097842678 12:64337348-64337370 CTGAAGTTAGGGCAGTCTTGTGG - Intronic
1100289104 12:93197099-93197121 AAGAGTTTAGGGCAGTTGTCTGG + Intergenic
1100577211 12:95904335-95904357 CAGAAGTGAGAGCAGTCTTGGGG - Intronic
1102407827 12:112689323-112689345 CTGAAGATATGGCAGTTCTCTGG - Intronic
1104185210 12:126423897-126423919 CAGAAGTTGGGGTAGTTCTGGGG + Intergenic
1106249926 13:27975679-27975701 AAGTGGTTAGGGCAGATTTCAGG - Intergenic
1106492195 13:30236308-30236330 CTGAAGTGAGGGCAGTCTTGTGG + Intronic
1109576479 13:64265259-64265281 CAAAAGTTATGTCAGTTTTTTGG + Intergenic
1109684466 13:65797792-65797814 CAGAAGTTGGGACTGTTTCCTGG - Intergenic
1110060308 13:71031796-71031818 CAGAAGTTTGTGCAAATTTCAGG + Intergenic
1111441243 13:88284919-88284941 CAGAAGTTGGAGCAGTTTGGAGG + Intergenic
1114024429 14:18512059-18512081 CAGAAGTCTGCACAGTTTTCTGG - Intergenic
1115520564 14:34229222-34229244 CAGAAGCCAGGGCAGTTTCAAGG - Intronic
1116399822 14:44492632-44492654 CAGAAGTAAGGACAGTCTTGGGG + Intergenic
1117622256 14:57599469-57599491 TAGAGGGTAGGGCAGTATTCAGG + Intronic
1118547994 14:66916154-66916176 CAGATGTGAGGGCAGTCTTGTGG - Intronic
1119646160 14:76350084-76350106 CAGAAGTTGGGGCAGGTTGGTGG - Intronic
1119836913 14:77758947-77758969 CTGAAGTAAGGGCAGTCTTGTGG - Intronic
1120981009 14:90289033-90289055 CAAAAGTTGTTGCAGTTTTCTGG + Exonic
1121101907 14:91255067-91255089 CAGAAGGTTGGGCGGTTGTCAGG + Intergenic
1122337266 14:101001974-101001996 CAGAGGCAAGGGCAGCTTTCGGG - Intergenic
1122733099 14:103816384-103816406 CAGAACTCAGGCCAGGTTTCCGG + Intronic
1123723439 15:23080153-23080175 CAGAAGTTATGGAAGCTTTGGGG + Intergenic
1124360511 15:29033460-29033482 CAGAAGTGAGGGCAGTCTTGTGG - Intronic
1125250703 15:37699329-37699351 TAGAAGTGAGGGCAGTATTGTGG + Intergenic
1125756040 15:42065649-42065671 CTGAAGTTGGGGCAGTCTTGTGG - Intergenic
1126165835 15:45653222-45653244 CTGAAGTGAGGGCAGTCTTGTGG - Intronic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1127979346 15:64023234-64023256 CAGTAGTCAGGGCAGGCTTCTGG + Intronic
1131029381 15:89173764-89173786 CAGAGGCTGGGGCAGTTTGCAGG - Intronic
1131135558 15:89932334-89932356 CAGAAGGTAGGGTAGTGCTCTGG - Intergenic
1132257361 15:100387414-100387436 CTGAAGTGAGGGCAGTCTTGTGG + Intergenic
1132327652 15:100985168-100985190 CAGAAATCAGGGCAATTTTAGGG + Intronic
1135336464 16:21605886-21605908 CTGAAGTGAGGGCAGTCTTGTGG - Intronic
1137803690 16:51284295-51284317 CAGAAGTGATGGCATTTTTCAGG + Intergenic
1140484182 16:75280976-75280998 CAGAAGTGTGGGCAGTCTTGTGG - Intergenic
1146501057 17:33364797-33364819 CAGAAGTCACGTCAGTTTCCAGG + Intronic
1148983780 17:51602501-51602523 CTGAAGTTGGGGCAGTCTTGTGG + Intergenic
1149804477 17:59602263-59602285 CTGAAGTTGGGGCAGTTGTTGGG + Intronic
1151915508 17:77115007-77115029 CAGCAGGACGGGCAGTTTTCTGG - Intronic
1154376164 18:13811778-13811800 CAGATGTTGGAGCAGATTTCTGG + Intergenic
1156422017 18:36964503-36964525 CATAAGCTAGGGCATTCTTCTGG - Intronic
1158410762 18:57203887-57203909 CAGAAGGCAGGGCAGTTTTGGGG + Intergenic
1158634086 18:59140638-59140660 CAGAAGTTAGAGAAGGCTTCTGG - Intronic
1159180368 18:64894220-64894242 CAGAGGTTGGGGCAGTTTCAAGG - Intergenic
1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG + Intronic
1163384528 19:16991384-16991406 CAGAATTTAGGGTAGTCTTGTGG + Intronic
1167348536 19:48961670-48961692 CATAAATTATGGCATTTTTCTGG + Exonic
1167830749 19:52020178-52020200 CTGAAGTGAGGGCAGTCTTGTGG - Intronic
927174779 2:20398199-20398221 CTGAAGTGAGGGCAGTCTTGTGG - Intergenic
927773658 2:25885219-25885241 CAGAAGTTCAGGCAGTGTACTGG + Intergenic
928429336 2:31204925-31204947 CTGAAGTAGGGGCAGTTTTGTGG + Intronic
929883286 2:45855893-45855915 CAGAAGGTAGGTCAGTGTTAGGG - Intronic
932009624 2:67962027-67962049 CAGAAGTGAGGACAGTCTTGTGG + Intergenic
932503929 2:72210626-72210648 CAGAAGGTTGTACAGTTTTCTGG + Intronic
933295749 2:80489046-80489068 CAGAAGTAAATGCAGTTCTCTGG - Intronic
934537209 2:95144789-95144811 CTGAAGTGAGGGCAGTCTTGTGG + Intronic
934658982 2:96133115-96133137 CAGAAGTTAGGGGACTTGCCAGG + Intronic
935565056 2:104597637-104597659 CTGAAGTTAGGGCAATCTTGCGG - Intergenic
935777877 2:106488122-106488144 GACAAGTTTGGGCAGTTTTCCGG - Intergenic
937296945 2:120815184-120815206 GATAAGTAACGGCAGTTTTCAGG + Intronic
937856327 2:126674367-126674389 CAGAAAGTAAGGAAGTTTTCTGG - Intronic
938071712 2:128311860-128311882 CATAAGATTGGGCTGTTTTCAGG - Intronic
938739013 2:134213546-134213568 CTGAAGTGGGGGCAGTTTTGTGG - Intronic
939463809 2:142531690-142531712 CAGAAGTAAGGACAGTCTTGTGG + Intergenic
940330049 2:152464870-152464892 CAGAGATTAGGGCAATTTTTTGG - Intronic
940505257 2:154546010-154546032 CAGAGGTTAGAACAGTTTGCAGG + Intergenic
940692344 2:156934587-156934609 CTGAAGTGAAGGCAGTTTTGTGG + Intergenic
940816963 2:158307639-158307661 CAGAAATTTGAGCCGTTTTCAGG - Intronic
941473663 2:165921625-165921647 CTGAAGTCAGGGCAGTTTTATGG + Intronic
941650889 2:168091465-168091487 CAGGACTTGGGGCAGCTTTCTGG - Intronic
944008063 2:194935778-194935800 CTGAAGTGAGGGCAGTCTTGTGG + Intergenic
945365968 2:208954003-208954025 CAGAAATTAGGATAGTGTTCAGG + Intergenic
946255095 2:218436354-218436376 CAGAAGATAGAGCATTTTGCTGG + Intronic
946382547 2:219358773-219358795 CAGAAGCTAGGGAAGTGTGCGGG - Intergenic
946930720 2:224667753-224667775 TAGAAGTTAAGGTAGTTTGCCGG - Intergenic
948009023 2:234635986-234636008 CAGAAGTTGGAACAGTTTTGAGG + Intergenic
1172354837 20:34272463-34272485 CTGAAGTGAGGGCAGTCTTGGGG - Intergenic
1173290341 20:41709341-41709363 CTGAAGTGAAGGCAGTCTTCTGG + Intergenic
1173696934 20:45025277-45025299 CTGATGTTTGGGCAGTTCTCTGG + Intronic
1174324835 20:49770937-49770959 CAGAAGTCAGGGCAGAGTTGGGG - Intergenic
1174534055 20:51237217-51237239 CAGAAGTTGGGGGAGTCTTTTGG + Intergenic
1177830556 21:26134304-26134326 CTGAAGTTGGGGGAGTTTTGTGG - Intronic
1180448595 22:15439586-15439608 CAGAAGTCTGCACAGTTTTCTGG - Intergenic
1181613792 22:24037778-24037800 CTGAAGTGAGGGCAGTTTTGTGG - Intronic
1181933583 22:26423374-26423396 CTGAAGTGAGGGCAGTCTTGTGG - Intergenic
1182705569 22:32277243-32277265 CAGAAGTTAGTACATATTTCTGG + Intergenic
1183071864 22:35401819-35401841 AAGGACTTAGGGAAGTTTTCCGG + Intronic
1184136063 22:42550527-42550549 CAGAAGTTAAGGGAGCTTCCCGG - Intergenic
1184639480 22:45861786-45861808 CAGATGTTTGGGCAGAATTCAGG - Intergenic
950924443 3:16726594-16726616 CAGAAGTGAGGGCCATTTTGTGG + Intergenic
951466279 3:23003776-23003798 CAGCCGTGAGGGGAGTTTTCTGG - Intergenic
952778969 3:37075208-37075230 CAGGAGTTTGGGCATGTTTCTGG - Intronic
953052632 3:39359693-39359715 AAGAATTTAGGGCAATCTTCTGG - Intergenic
953580639 3:44152345-44152367 CATAAGTTAGGCAAGTTTGCAGG - Intergenic
953583439 3:44177956-44177978 CTGAAGTGAGGGCACTTTTATGG - Intergenic
955532215 3:59886050-59886072 CAGAATCTAAGGCAGCTTTCTGG + Intronic
957624975 3:82644619-82644641 CAGAAGTTAGGGCAGCTCAAGGG + Intergenic
958582627 3:96045849-96045871 CAGAGGTTGGAGCAGTTTTGAGG - Intergenic
958644238 3:96849036-96849058 CAAAAGTTAGAGCTGTCTTCTGG + Intronic
958723737 3:97877854-97877876 TAGAAGTAAGGTCAGATTTCTGG - Exonic
961727462 3:128942066-128942088 CAGAAGTAAGGGCGGTCTTGGGG - Intronic
962328445 3:134455940-134455962 CAGAAGGTAAGGATGTTTTCTGG - Intergenic
962955487 3:140262673-140262695 ATGAAGGTAGTGCAGTTTTCAGG + Intronic
964123203 3:153207607-153207629 CTGAGGTTTGGGCAGTTTTAAGG + Intergenic
966645521 3:182242427-182242449 CAGAGGTGAGGTCAGTTCTCAGG - Intergenic
969840595 4:9878779-9878801 CTGAAGTGAGGGCAGTCTTGTGG + Intronic
970224457 4:13843051-13843073 CAGAGGTTAGAACAGTTTGCAGG + Intergenic
972782688 4:42299911-42299933 CTGAAGTGAGGGCAGTCTTGTGG - Intergenic
973190966 4:47385718-47385740 CAGAAGTGAATGCAGTCTTCTGG - Intronic
973259303 4:48145260-48145282 CCGAAGTTAGTGCAGCTTTATGG - Exonic
975521645 4:75307899-75307921 GAGAAGTTGGGTCATTTTTCAGG - Intergenic
976593969 4:86876715-86876737 CAGAATTTAGGAAAGTTCTCTGG + Intronic
976697949 4:87938075-87938097 CAGAATTTTGGGCAGTCTTTTGG - Intergenic
977014155 4:91671146-91671168 CATAGGTTAGGGCAGTTTGGAGG - Intergenic
978648175 4:110967164-110967186 CAGAAGTTATGGAAGGTTTTGGG + Intergenic
978713160 4:111809830-111809852 CAGAAGTGAGGGCAGTCTTGTGG + Intergenic
979207422 4:118056342-118056364 CAGAAGTTAAGCCAGTTTTCAGG + Intronic
979813451 4:125067607-125067629 CAGGAGTGAGGGCAGTTTTGTGG + Intergenic
980140414 4:128909408-128909430 CAGAAATTATGAAAGTTTTCTGG - Intronic
980532670 4:134074505-134074527 CAGAGGTTAGGACAGTTTTGGGG - Intergenic
982601133 4:157451132-157451154 CAGAAGATGTGTCAGTTTTCTGG - Intergenic
982917326 4:161228270-161228292 CAGAAGTTGGAGCAGTTTGGAGG - Intergenic
983443485 4:167818445-167818467 CAGAAGTGAGGGCAGTTTTGTGG - Intergenic
986755045 5:10827522-10827544 CAAAAGTAAGGGAAATTTTCAGG - Intergenic
987802668 5:22719117-22719139 CTGAAGTGAGGGCAGTCTTGTGG + Intronic
991399759 5:66240348-66240370 CAGCAGTTGGGGCAGGTTTTGGG + Intergenic
992774179 5:80075524-80075546 CATCATTTAGGGCAGTTGTCAGG - Intronic
993545254 5:89203729-89203751 CAGAAGTTGGGGCAATCTTGTGG + Intergenic
993890038 5:93462566-93462588 CAGAAGTTGGGACAGTTTGGAGG + Intergenic
994781606 5:104096289-104096311 CAGAAGTTAGAAAAGTTTGCAGG - Intergenic
995176803 5:109187507-109187529 CTGAACTTAGGGCGATTTTCAGG - Exonic
995989786 5:118223529-118223551 CAGAAGTTGGAACAGTTTACAGG - Intergenic
996015100 5:118525001-118525023 CACAAGCTAGGACAGTTTTCAGG - Intergenic
996144407 5:119955961-119955983 CTGAAGTGGGGGCAGTTTTCAGG + Intergenic
997181515 5:131833465-131833487 CAGAAGTTGGAACAGTTTTGAGG - Intronic
998904481 5:146889788-146889810 CAGAAGTTAGGGCAGTTTTCGGG + Intronic
1000368011 5:160508866-160508888 GAGAAGTTATAGCACTTTTCAGG - Intergenic
1001120995 5:168979759-168979781 CAAAAGTCAGGGCAGTCTCCAGG + Intronic
1001294865 5:170492123-170492145 CTGAAGTGGGGGCAGTTTTGTGG - Intronic
1002072742 5:176690033-176690055 CTGAAGTGAGGGCAGTCTTGCGG - Intergenic
1002257159 5:177966435-177966457 CTGAAGTAAGGGCAGTTTTGTGG - Intergenic
1003174130 6:3742649-3742671 CAGAAATTAGAACAGTTTCCGGG - Intronic
1003575590 6:7291491-7291513 AAGTAGTGAGAGCAGTTTTCTGG - Intronic
1004590946 6:17050978-17051000 CTGAAGTGGGGGCAGTCTTCTGG + Intergenic
1004801837 6:19157160-19157182 CTTAAGTTTGGGCAGTTTTTTGG - Intergenic
1005117374 6:22353721-22353743 CAGAAGTGAGTGCAGTTTTGTGG + Intergenic
1006130310 6:31865087-31865109 CAGAAGTTAGGGCAGGTTGAGGG + Intronic
1009242363 6:61198088-61198110 CAGAGGTTAGGACAGTTTGGAGG + Intergenic
1011238337 6:85242592-85242614 CAGAAGTTATGGCAGTTCTGGGG - Intergenic
1011631498 6:89330140-89330162 CATAAGTTAGGACAGCTTTTTGG + Intronic
1011821105 6:91255044-91255066 CAGAAGTTGGAGCAGTTTGGAGG + Intergenic
1012274013 6:97249450-97249472 CAGAAGTAAAGACAGTTTTAGGG + Intronic
1013338573 6:109190940-109190962 CAGAGGTTAGGACAGTTTGGAGG + Intergenic
1013829254 6:114253324-114253346 CTGAAGTTACGGCACATTTCAGG + Intronic
1014074614 6:117222096-117222118 CTGAAGTTGGGGCAGTCTTGTGG - Intergenic
1016917437 6:149257759-149257781 CAGATTTTAGGGGAGTTATCAGG - Intronic
1020178336 7:5900632-5900654 CAGAATTTAGGAAAGTTCTCTGG + Intronic
1020304590 7:6824367-6824389 CAGAATTTAGGAAAGTTCTCTGG - Intronic
1021505864 7:21384594-21384616 CTGAAGTTAGGGCAATCTTGTGG - Intergenic
1021733220 7:23617658-23617680 CTGAAGTGAGGGCAGTCTTGTGG - Intronic
1022680072 7:32536662-32536684 CTGAAGTGAGGGCAGTTTTGTGG - Intronic
1022747888 7:33191075-33191097 CAGAGGTCAGGGGAGCTTTCTGG + Intronic
1023550420 7:41364457-41364479 CATATTTTAGGGCAGCTTTCTGG - Intergenic
1023802865 7:43850010-43850032 CTGAAGTGGGGGCAGTTTTGTGG + Intergenic
1023988913 7:45116328-45116350 CTGAAGTGAGGGCAGTGTTGTGG + Intergenic
1024792685 7:52984747-52984769 CAGAGGTTAGGACAGTTTGGAGG + Intergenic
1024823713 7:53364707-53364729 CAAAATTTAGGTGAGTTTTCTGG + Intergenic
1024885845 7:54141238-54141260 CTGAAGTGAGGGCAGTTTTATGG - Intergenic
1025948003 7:66119502-66119524 CTGAAGTAGGGGCAGTCTTCTGG + Intronic
1026473533 7:70714674-70714696 CAGAATGTGGGGCAGTCTTCAGG - Intronic
1026931241 7:74224076-74224098 CAGAAGTGGGGCCAGTCTTCAGG - Exonic
1027332965 7:77119324-77119346 CAGAGGTTATAGCAGTTTTGAGG - Intergenic
1027712722 7:81626340-81626362 CAGAAGTTATCGAAGTTATCTGG + Intergenic
1027993642 7:85396039-85396061 CAGAAGTTAGAGCAGTTTGGAGG - Intergenic
1029311581 7:99672017-99672039 CAAAAGTTATTGCAGTTTGCCGG + Intronic
1029637153 7:101792635-101792657 CAGATGTTTGGGAAGTTTTCAGG + Intergenic
1029782820 7:102751972-102751994 CAGAGGTTATAGCAGTTTTGAGG + Intronic
1030292110 7:107883224-107883246 CAGGAGTTAGGGCAGTGGTTAGG + Intergenic
1030791486 7:113734381-113734403 CTGAAGTGAGGGGAGTTTTGTGG + Intergenic
1031368073 7:120927579-120927601 CTGAAGTAAGGGCAATTTTGTGG + Intergenic
1033954439 7:146827700-146827722 GAAAAGTTATGTCAGTTTTCTGG - Intronic
1034484139 7:151346926-151346948 CTGAAGTTAGGGCTTTTTTGTGG + Intronic
1036735863 8:11315734-11315756 CAGAGGTAAGGTCAGTTGTCAGG - Intronic
1038695405 8:29801964-29801986 CAGAAGGCAGGGCAGCATTCTGG - Intergenic
1039019329 8:33187669-33187691 CAGGAGGTAGGGCAGATTTGGGG + Intergenic
1040430894 8:47341087-47341109 CAGAAGTGAGGGCAGCCTTGTGG + Intronic
1040927092 8:52695971-52695993 CTGAAATGAGGGCAGTTTTGTGG + Intronic
1041494317 8:58469063-58469085 CAGAAGTTGGGACAGTTTGGAGG + Intergenic
1042440993 8:68826365-68826387 GAAATGTTAGGGCTGTTTTCTGG + Intergenic
1042674881 8:71308988-71309010 CAGAAGTTAGTGCAGCTCCCTGG + Intronic
1043028800 8:75105683-75105705 CTGAAGTGGGGGCAGTTTTATGG - Intergenic
1045987961 8:108271755-108271777 CACAAGTTTGGCCATTTTTCTGG - Intronic
1046237809 8:111449644-111449666 CTAAAGTGAGGGCAGTTTTGCGG - Intergenic
1046497628 8:115035595-115035617 CAGTAGACATGGCAGTTTTCTGG - Intergenic
1047911526 8:129535209-129535231 CAAAAGTTAGAAAAGTTTTCTGG - Intergenic
1048265227 8:132979868-132979890 CTGAAGTGGGGGCAGTCTTCTGG - Intronic
1048265366 8:132980658-132980680 CTGAAGTGGGGGCAGTCTTCTGG + Intronic
1049929664 9:444205-444227 CTGAAGTCAGGGCAGTCTTGAGG - Intronic
1050056689 9:1662665-1662687 CAGGAGATAGGCCAGTTCTCAGG + Intergenic
1055760438 9:79601303-79601325 CAGAATTTAAGCAAGTTTTCTGG + Intronic
1057256954 9:93557632-93557654 CAATACTTATGGCAGTTTTCTGG - Intronic
1059403366 9:114084695-114084717 CAGGAGTTGGGGCAGGTTCCTGG - Intergenic
1059674817 9:116528089-116528111 CAGAAGTTGGAACAGTTTTGAGG + Intronic
1059716244 9:116915973-116915995 CTGAAGTGAGGGCAGTCTTCTGG + Intronic
1060311849 9:122469624-122469646 CAGAAGTTAGAACAGTTTGGAGG + Intergenic
1062014698 9:134285194-134285216 CAGAGGTGAGGGGAGCTTTCCGG - Intergenic
1189920155 X:45895800-45895822 CTGAAGTGGGGGCAGTTTTGTGG - Intergenic
1190551209 X:51582976-51582998 CAGACATTAGGGCAATTTTCAGG + Intergenic
1191183237 X:57583757-57583779 CAGATGTTGGTGCAGTTTTGTGG + Intergenic
1191211551 X:57890215-57890237 CAGAAGTTGGAACAGTTTTTAGG - Intergenic
1191214137 X:57918646-57918668 CAGATGTCAGTGCAGTTTTGTGG - Intergenic
1192077813 X:68018123-68018145 CAGAAGTAAGGGCAGTCTTTTGG - Intergenic
1193734675 X:85142879-85142901 CAAAAGTTAGGAGAGTTTTCAGG - Intergenic
1196420566 X:115516529-115516551 CAGAAGTTAGGACAGTATGGTGG - Intergenic
1196546690 X:116971899-116971921 CACAAGTTAGTGCAGTTATCAGG + Intergenic
1196870202 X:120106139-120106161 CAGAAATTAAGGCAGGATTCAGG - Intergenic
1197255375 X:124257343-124257365 GAGAAGTAAGGACAGTTTTCAGG - Intronic
1197442408 X:126508613-126508635 CAGAAGTAAGGGCAATCCTCTGG - Intergenic
1198419190 X:136452056-136452078 CAGAGGTTAGGCCAGTCTTTGGG + Intergenic
1199330389 X:146551791-146551813 CAGAAGTTAGAACAGTTTGGAGG - Intergenic
1200814677 Y:7518994-7519016 CAGATGTCTGGGCAGTTTGCTGG + Intergenic
1201590105 Y:15605233-15605255 CAGAGGTTGGAACAGTTTTCAGG - Intergenic
1201685917 Y:16702348-16702370 CATAAGTTCTGGTAGTTTTCTGG + Intergenic