ID: 998905039

View in Genome Browser
Species Human (GRCh38)
Location 5:146895827-146895849
Sequence GTCCATCTCCACCACAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998905031_998905039 30 Left 998905031 5:146895774-146895796 CCATCTGCCTAGCTCCTGGACTC 0: 1
1: 0
2: 0
3: 34
4: 299
Right 998905039 5:146895827-146895849 GTCCATCTCCACCACAGGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 163
998905035_998905039 8 Left 998905035 5:146895796-146895818 CCACCTCATTAGGAAAATAAAGA 0: 1
1: 1
2: 0
3: 37
4: 437
Right 998905039 5:146895827-146895849 GTCCATCTCCACCACAGGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 163
998905034_998905039 16 Left 998905034 5:146895788-146895810 CCTGGACTCCACCTCATTAGGAA 0: 1
1: 0
2: 0
3: 3
4: 113
Right 998905039 5:146895827-146895849 GTCCATCTCCACCACAGGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 163
998905036_998905039 5 Left 998905036 5:146895799-146895821 CCTCATTAGGAAAATAAAGAACC 0: 1
1: 0
2: 3
3: 46
4: 381
Right 998905039 5:146895827-146895849 GTCCATCTCCACCACAGGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 163
998905032_998905039 23 Left 998905032 5:146895781-146895803 CCTAGCTCCTGGACTCCACCTCA 0: 1
1: 0
2: 0
3: 39
4: 329
Right 998905039 5:146895827-146895849 GTCCATCTCCACCACAGGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998905039 Original CRISPR GTCCATCTCCACCACAGGAA AGG Intronic
902660194 1:17895645-17895667 GACCCTCCCCACCACAGGAGTGG - Intergenic
904950477 1:34234328-34234350 GTCTCTCTCCAATACAGGAATGG + Intergenic
906791982 1:48667142-48667164 GTACATCTCCACCTCTTGAAAGG - Intronic
915736996 1:158091341-158091363 TTCCCTCTCCACCACAGGCATGG + Exonic
915786019 1:158612956-158612978 ATCCATTTCTCCCACAGGAAGGG - Exonic
917223894 1:172761341-172761363 GACCACCTCCACCACAGACAAGG - Intergenic
917725139 1:177820961-177820983 GTCCCTCTCCACCTCTGGACAGG + Intergenic
918761356 1:188414365-188414387 CTGCATGCCCACCACAGGAATGG - Intergenic
920258145 1:204670543-204670565 GGCCATCTCAGCCACACGAACGG - Intronic
920308831 1:205036127-205036149 GGCCATCTGCACACCAGGAAGGG + Intergenic
923147826 1:231210189-231210211 GGCCATCTCCCCAGCAGGAAGGG + Intronic
924758484 1:246963479-246963501 CACCATCACCACCACTGGAAGGG - Intronic
1063019397 10:2112246-2112268 GGGCATCTCCACCACAGGAGAGG + Intergenic
1063564972 10:7164549-7164571 GTCACTCTCCACCCCAGGCAGGG + Intronic
1064016163 10:11774004-11774026 ATCCATCTTCACAACAGCAAAGG + Intergenic
1064314421 10:14241813-14241835 GTCCATCTGCCCTACAGGATGGG + Intronic
1065322155 10:24519981-24520003 CTCCACCACCACCACACGAAAGG + Intronic
1066319016 10:34281186-34281208 GCTCATTTCCACCACATGAAAGG - Intronic
1070676373 10:78414456-78414478 GTTCAACACCACCACAAGAAGGG - Intergenic
1073115137 10:101087621-101087643 ATCCATCTCCATCACAGTAATGG + Intergenic
1073265683 10:102227056-102227078 CTCCTTCTCCACAGCAGGAACGG - Intronic
1074180419 10:111058052-111058074 GTCCTTCTCCACCACAATAATGG + Intergenic
1074443266 10:113497212-113497234 GTCCGACTCCACCTCAGGGAAGG - Intergenic
1075512401 10:123083212-123083234 GAAGATCTCTACCACAGGAAAGG + Intergenic
1075551708 10:123397421-123397443 GGCCCCCTCCACAACAGGAAAGG + Intergenic
1076074937 10:127526024-127526046 GTCCGTCTCCCCAACTGGAATGG - Intergenic
1076495185 10:130892616-130892638 CTCCCTCTCCTCCACAGGGAGGG + Intergenic
1076826288 10:132971279-132971301 GTCAATGTCCACCACAGGTGTGG - Intergenic
1077083955 11:738300-738322 GGCCATCTCCAAGACAGGCAAGG + Intergenic
1078715520 11:13835814-13835836 GTCCACCTCCACCTCAGAACTGG + Intergenic
1079491807 11:20996906-20996928 CTCCATATCCTCCACTGGAATGG + Intronic
1081158740 11:39727879-39727901 GTTCAGCTCCTCTACAGGAAAGG + Intergenic
1083397841 11:62403517-62403539 CTCCATCACCACCTCAGAAAGGG + Intergenic
1084077917 11:66796423-66796445 GTCCATGTCCTACACAGTAAAGG - Intronic
1087474724 11:98621211-98621233 GTCCCTTCCCACAACAGGAAGGG - Intergenic
1089254969 11:117189364-117189386 CACCAGCTGCACCACAGGAAGGG - Exonic
1089455683 11:118624432-118624454 GCCCATCTCAAGCACAGGCAAGG + Intronic
1089806014 11:121090577-121090599 GTCCCTCTCCACCACTACAATGG - Exonic
1090121437 11:124032798-124032820 GTCCATAAATACCACAGGAAAGG - Intergenic
1093766285 12:22966972-22966994 GAGCATCTCCACCAGAGGAATGG - Intergenic
1097842388 12:64334201-64334223 GACCATCTTCCCCACAGGAATGG - Intronic
1098299915 12:69043499-69043521 GCCCATCTCTACCCCAGGAATGG + Intergenic
1099205997 12:79727362-79727384 ATCCTTCTCCACACCAGGAAAGG + Intergenic
1101791319 12:107930263-107930285 GTCCATCTCCCACACTGGGAAGG - Intergenic
1104156417 12:126137012-126137034 GAACCTCTCCAACACAGGAAAGG - Intergenic
1106093629 13:26622417-26622439 GTCATTCTCCACCGCAGTAAGGG - Intronic
1107057370 13:36121452-36121474 TTCCATCTCTATCACAAGAAGGG + Intronic
1108707455 13:53002569-53002591 CTACATCTCCACCCCAGGGAAGG - Intergenic
1113529242 13:111008385-111008407 GTCCTCCTCCACCACAACAAAGG - Intergenic
1116879457 14:50150109-50150131 GTCCACCTCCACCAATTGAATGG - Exonic
1119898031 14:78237462-78237484 ATCCATCTCCACCATTGGAGAGG - Intergenic
1120398677 14:84000890-84000912 TTACATCTCCCCAACAGGAATGG - Intergenic
1121786246 14:96663314-96663336 CCCCATCTCCACGACAGGAGAGG - Intergenic
1122780217 14:104140305-104140327 GTCCAGCCCCACCCCAGGACAGG - Intronic
1123098030 14:105775560-105775582 GTACCTCGCCACAACAGGAAGGG - Intergenic
1125916438 15:43492455-43492477 GTCCATCTGCTCCCCTGGAATGG + Exonic
1128707972 15:69851335-69851357 GTCCAGCTGTAACACAGGAAGGG + Intergenic
1128901810 15:71429582-71429604 CTCCATCTCTCCCAAAGGAAAGG - Intronic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1132215915 15:100061555-100061577 GTCCATTTGTGCCACAGGAATGG + Intronic
1132694395 16:1195454-1195476 GACCATCTCCACCGCAAAAAAGG - Exonic
1133236628 16:4390309-4390331 GTCCTTCAGCACCATAGGAAAGG - Intronic
1133365708 16:5207422-5207444 GTTCATCTCAGCCACAGAAATGG + Intergenic
1134763963 16:16739527-16739549 CTCCACCTCCTCCACAGAAAGGG - Intergenic
1139326438 16:66156033-66156055 GTTCATCTCCACCAAAGCAGTGG + Intergenic
1141643349 16:85354535-85354557 AGCCATCTCCACCCCAGGAGGGG + Intergenic
1142759762 17:2035508-2035530 CTCCCTCCCCACCACAGGCAGGG - Intronic
1144033498 17:11342745-11342767 GTCCATGAACACCACAGGCAAGG + Intronic
1145787868 17:27605663-27605685 GTCCATCTCCAGCAGGCGAATGG - Exonic
1146796244 17:35783469-35783491 GTCCATCCTCCCCAAAGGAAAGG - Intronic
1150307598 17:64099789-64099811 GTGGGTCTCCACCACAGAAAAGG - Intronic
1152291106 17:79440762-79440784 GCCCCTCCCCACCAGAGGAAGGG + Intronic
1153663853 18:7350790-7350812 TTTGATCTCCACCACAGGAAGGG - Intergenic
1156464752 18:37341696-37341718 GCCCAACTCCACCCCAGGCAGGG - Intronic
1158375121 18:56854761-56854783 GACCAGCTCCAAGACAGGAAGGG + Intronic
1159862779 18:73669110-73669132 GACCACCTCCACCTCAGGGAAGG + Intergenic
1161219245 19:3110466-3110488 TTCCATGTCCATGACAGGAACGG - Intronic
1161311243 19:3595423-3595445 GTCCCTCCCAACCCCAGGAAGGG - Intronic
1161641558 19:5426877-5426899 GTACATCTCCCCCACTGGGAGGG - Intergenic
1163186158 19:15640978-15641000 GCCCATCTCCATCACAGGCTAGG - Intronic
1165606669 19:37111788-37111810 ATCCTGCTCCACCAGAGGAATGG + Intronic
926852689 2:17217414-17217436 GTCAATACCAACCACAGGAAAGG + Intergenic
928040592 2:27872581-27872603 ATTCATCAGCACCACAGGAAAGG + Intronic
930025861 2:47028814-47028836 GTGCAGCTTGACCACAGGAAGGG - Intronic
931592673 2:63902235-63902257 GTACATCTCCACTACAGAATAGG - Intronic
932565054 2:72900925-72900947 GCCCGTCCCCACCAAAGGAAAGG - Intergenic
934160566 2:89245381-89245403 GTGCATGTCCAATACAGGAAAGG + Intergenic
934206711 2:89937057-89937079 GTGCATGTCCAATACAGGAAAGG - Intergenic
935424965 2:102910312-102910334 GACCACCTCCATCACAGAAAGGG - Intergenic
937835590 2:126467537-126467559 GGGACTCTCCACCACAGGAAGGG + Intergenic
937839503 2:126511322-126511344 GTCCATCTCCACCAAAAACAGGG - Intergenic
938144551 2:128822598-128822620 GTCTATCTGCATCGCAGGAAGGG - Intergenic
938385641 2:130864927-130864949 GTGCGTCTCCATCAAAGGAAAGG - Intronic
939887145 2:147693550-147693572 TTCCCTGTCCACCAAAGGAAAGG + Intergenic
943722969 2:191224160-191224182 GTCAAGCACCACCACAGGCAAGG + Intergenic
947582514 2:231330460-231330482 CTCCAACACCACCCCAGGAAGGG + Intronic
948557645 2:238824662-238824684 GTACATCTGCACCACAGAGAAGG - Intergenic
948598593 2:239095900-239095922 CTCCAGCTCCAGCCCAGGAAGGG - Intronic
1170330869 20:15209080-15209102 CACCACCACCACCACAGGAAAGG - Intronic
1172599351 20:36173300-36173322 GTCCAGCTTCAGCACTGGAAAGG + Intronic
1175779075 20:61670890-61670912 GGCCTTCTCCACAAAAGGAAGGG + Intronic
1178225836 21:30717369-30717391 TTCCTTCGCCACCACAGGAATGG + Intergenic
1178496579 21:33091167-33091189 GTGCATTTCAAACACAGGAAAGG + Intergenic
1180916601 22:19493098-19493120 ATCCATATCCACCCCAGCAAAGG - Intronic
1182120454 22:27783060-27783082 GTCCACCTCCACAAGAGGAAGGG + Intronic
1184006766 22:41715877-41715899 GTCCAGCTCCCCCACTGGACTGG - Intronic
954641885 3:52105526-52105548 GTCCATCTTCTCAAGAGGAAAGG + Intronic
956863959 3:73351399-73351421 GTCCTTCTCCAGAAAAGGAAAGG + Intergenic
957952516 3:87144623-87144645 GTCCTACTCCAACAAAGGAAAGG - Intergenic
959668857 3:108951799-108951821 CTCAGTGTCCACCACAGGAATGG - Intronic
959862201 3:111229268-111229290 TTCCTTCTCCACCAAAGGACTGG - Intronic
961561595 3:127734062-127734084 ACCCGGCTCCACCACAGGAAAGG - Intronic
961745799 3:129062778-129062800 TTCCATCCCCACGACAGAAATGG + Intergenic
966842426 3:184100468-184100490 TTCGATGTCCACTACAGGAAGGG + Exonic
967253649 3:187568331-187568353 CACCCTCTCCACCACAGGCATGG - Intergenic
967501071 3:190198166-190198188 GCCTATCTCCACTAAAGGAAAGG + Intergenic
967989836 3:195122612-195122634 GTCCTTCGACTCCACAGGAAGGG + Intronic
968067486 3:195766741-195766763 AGCCATCTCCACTGCAGGAAAGG + Exonic
968889944 4:3363593-3363615 GTCCATCTCCACGGCAGGCAGGG - Intronic
970623632 4:17852705-17852727 GTCCATCTCCACCATCTGAATGG + Intronic
972680874 4:41305784-41305806 GTCAGTCTCACCCACAGGAAAGG - Intergenic
974005101 4:56548247-56548269 GTTCATCAGCACTACAGGAAAGG - Intronic
976992850 4:91390065-91390087 GTCCCTTTCCACCACTGGAAAGG - Intronic
978940868 4:114434770-114434792 GTGCATGTTCACCACAGCAATGG + Intergenic
979709064 4:123756059-123756081 GTGCATGTTCACCAAAGGAAAGG - Intergenic
981047953 4:140282507-140282529 CTCTATCACCTCCACAGGAAGGG - Intronic
985870274 5:2548824-2548846 GTCCTTCTCCACCTCAGGGCAGG + Intergenic
994829059 5:104754453-104754475 ATCCATCTCCACCACAAAAGTGG + Intergenic
996121621 5:119680179-119680201 AGCCATCTCCACCCCAAGAATGG - Intergenic
996565000 5:124870554-124870576 CTCCCTCTTCACCACAGGGAAGG - Intergenic
996872956 5:128212349-128212371 GTTTGTCTCCACCACAGGACCGG - Intergenic
997697079 5:135870079-135870101 GTCCATCTTTATCAGAGGAAAGG - Intronic
998905039 5:146895827-146895849 GTCCATCTCCACCACAGGAAAGG + Intronic
999429350 5:151512487-151512509 GTCCATCTCCTCCACCAGGATGG + Exonic
999931387 5:156436556-156436578 GGTCATCTCCATCACAGGAGTGG - Intronic
1000250159 5:159486691-159486713 GTCCATCTCTCAAACAGGAAAGG + Intergenic
1001029340 5:168250497-168250519 GTCCATCCCCAAGGCAGGAATGG + Intronic
1002020734 5:176362823-176362845 CTCTTTATCCACCACAGGAAGGG + Intergenic
1002530583 5:179842166-179842188 GTCCAGCTCCACTCTAGGAAAGG + Intronic
1002938613 6:1696784-1696806 CTTCATCTCCAACAGAGGAAGGG + Intronic
1004500836 6:16208458-16208480 GAGCATCTCCACGACAGGGAGGG + Intergenic
1007511891 6:42380283-42380305 CTCCATCTCCCCCAGAGAAAAGG - Intronic
1011207858 6:84920283-84920305 TTCCATTTCCACCACAGTAATGG + Intergenic
1011704380 6:89986124-89986146 GCCCATCCCCTCCACAGGCAGGG - Intronic
1012221738 6:96657533-96657555 GGCCAGCTTCACCACAGGACTGG + Intergenic
1017156386 6:151325869-151325891 GACCATCACCATCACAGGTAAGG + Intronic
1017650350 6:156575933-156575955 CTCCATCTCCTCTACTGGAAGGG - Intergenic
1020117476 7:5483919-5483941 GTCCAGCACCACCTCAGGCAGGG - Intronic
1020563054 7:9755664-9755686 GTTCATCTCCACCATAGAACGGG - Intergenic
1022312372 7:29209146-29209168 GACCATCTGCACTCCAGGAAGGG - Intronic
1024679071 7:51664777-51664799 ATCCATCTGCTCCACTGGAATGG - Intergenic
1028867870 7:95734768-95734790 TTCCCTCTCCACCACAAAAATGG + Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1031115163 7:117659321-117659343 GTCCATGTCCCCCACTGGAGTGG + Intronic
1034947856 7:155275324-155275346 GGCCAACTGGACCACAGGAATGG - Intergenic
1035770907 8:2146243-2146265 GTTCATCTGCACGACAGAAAAGG - Intronic
1038687064 8:29728483-29728505 GTGCAGCTCCAGCACAGAAAAGG + Intergenic
1038977176 8:32712769-32712791 ATCCATCACTACCACAGTAATGG - Intronic
1039350421 8:36758028-36758050 CTCCATCTCCACACCAGCAATGG + Intergenic
1045647712 8:104315760-104315782 GTCAATCTCATCCACAGCAACGG - Intergenic
1047774262 8:128056634-128056656 TGCCTTCTCCACCACACGAATGG + Intergenic
1051542615 9:18236532-18236554 TTCCATCATCATCACAGGAAAGG - Intergenic
1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG + Intronic
1058052847 9:100423887-100423909 ACTCATCTCCATCACAGGAATGG + Intergenic
1058053717 9:100429513-100429535 GTCCATCTCCCACACTGGACTGG - Exonic
1059530552 9:115031547-115031569 GACCATCTTCACCACAAGTAAGG - Exonic
1060748887 9:126155928-126155950 GTCCACCTCCATCACCTGAATGG - Intergenic
1061009794 9:127948185-127948207 GTCCATCTCCATCCCAGGCCAGG - Exonic
1061837565 9:133339591-133339613 GTCCATCACCACAACCAGAATGG - Exonic
1062142709 9:134968592-134968614 GCCCATCTCTACGCCAGGAAGGG + Intergenic
1062697169 9:137881326-137881348 GGCCAGCTCCACCACAGGACAGG + Intronic
1186707977 X:12162763-12162785 TGCCATGTTCACCACAGGAAAGG - Intronic
1187844791 X:23524336-23524358 CTCCATCCCCACAACAGCAATGG + Intergenic
1189762004 X:44331462-44331484 ATACATTTCCACCACAGTAAAGG - Intronic
1190388831 X:49911756-49911778 GTCCATGTGCAGCACCGGAAAGG + Intergenic
1197169562 X:123416049-123416071 CTCCATCTCCAACATGGGAATGG + Intronic
1199577747 X:149330057-149330079 GTTCATCACCACCACAGTCAAGG - Intergenic
1200161609 X:154012673-154012695 TGCCATCTCCACCCCAGGACTGG - Exonic
1200857856 Y:7958802-7958824 GTCCACCTCCACCACAGGATAGG - Intergenic
1201622829 Y:15979578-15979600 ATCCACCTGCACCACAGGAGAGG - Intergenic
1201639002 Y:16158814-16158836 GGCCATTTGCAACACAGGAAGGG - Intergenic