ID: 998906128

View in Genome Browser
Species Human (GRCh38)
Location 5:146907261-146907283
Sequence ATTTTTGCACAAGCGAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998906125_998906128 19 Left 998906125 5:146907219-146907241 CCATCAGCAGATGTAGAAGTTAA 0: 1
1: 0
2: 2
3: 25
4: 273
Right 998906128 5:146907261-146907283 ATTTTTGCACAAGCGAGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998906128 Original CRISPR ATTTTTGCACAAGCGAGCTG GGG Intronic
902132458 1:14274594-14274616 ATTTTGGCACAGGTGATCTGTGG + Intergenic
903188673 1:21644034-21644056 AGTTGTGCACAAGTGAGATGGGG + Intronic
907431417 1:54414292-54414314 ATGTGTGAACAAGAGAGCTGTGG + Intergenic
911948236 1:104138198-104138220 ATTTTTGCCCTAGAGAGGTGTGG - Intergenic
915544246 1:156586908-156586930 ATTTTTGCACATGAGAAATGAGG + Intergenic
916578249 1:166086086-166086108 TTTTTTGCATAAAGGAGCTGAGG + Intronic
923095488 1:230772149-230772171 ATGTCTGCACAAGCCAGCTCTGG - Intronic
1063082466 10:2781815-2781837 CTTTGTTCACAAGAGAGCTGCGG + Intergenic
1063923742 10:10957082-10957104 ACTCTTGCACAAGGGAGCTCTGG + Intergenic
1065887318 10:30090249-30090271 ATATTTGCACAGGCCAGTTGCGG + Intronic
1068378697 10:56217920-56217942 AATATTGCACAAGAGAGGTGAGG - Intergenic
1069043486 10:63718735-63718757 ACTTCTGCACAAGCCAGATGTGG + Intergenic
1088005613 11:104935963-104935985 ATTTTTGCTCAAGATAGCTTTGG - Intergenic
1090706091 11:129338330-129338352 AATTATGCACGAGTGAGCTGGGG + Intergenic
1093023541 12:14224235-14224257 CTTTTTGTAGAAGCCAGCTGTGG - Intergenic
1093979656 12:25462051-25462073 ATTTTTGCAGGAGGGAGATGAGG + Intronic
1097132077 12:56819137-56819159 TTTTTTGAACAAGAGAACTGAGG - Intergenic
1098371792 12:69767916-69767938 ATTTCTGCACAAGAGGGGTGAGG + Intronic
1101549604 12:105749826-105749848 CTTTTTGCACAAGTGATCTTGGG - Intergenic
1102896141 12:116599882-116599904 ATTTTGGGACAAGGGAGGTGGGG - Intergenic
1103373667 12:120438373-120438395 AGTCTTCCACATGCGAGCTGCGG - Exonic
1107589939 13:41892687-41892709 AGTTTTGTACAAGGGACCTGAGG - Intronic
1111589847 13:90330937-90330959 TTTTTTGTACAAGTGAACTGTGG + Intergenic
1111628230 13:90815910-90815932 ATTTTAGAATAAGCGAGATGTGG - Intergenic
1115833447 14:37369710-37369732 ATTTCAGCAGAAGTGAGCTGTGG + Intronic
1115834270 14:37380209-37380231 ATTTTTGAACAAGGGAGATGGGG + Intronic
1120829265 14:88983635-88983657 ATTTTAGCCCAGGCCAGCTGTGG - Intergenic
1121022806 14:90591832-90591854 ACTTTTGCATAAGGGAGCTGTGG + Intronic
1125188816 15:36965723-36965745 ATAGTTGCACAAGAGAGTTGGGG + Intronic
1127632638 15:60841096-60841118 ATTTTTTCAGCAGAGAGCTGAGG + Intronic
1129905919 15:79186958-79186980 CTTTTTGCACATGGGACCTGAGG + Intergenic
1140554754 16:75909071-75909093 GTTTTTGCAAAAGTGGGCTGTGG + Intergenic
1142001059 16:87664770-87664792 ATGTTTCCACATGTGAGCTGTGG - Intronic
1146292473 17:31619695-31619717 ATTTTTGCACAAGAGGGGAGAGG - Intergenic
1148022449 17:44562403-44562425 TTTTCTGAACAAGGGAGCTGAGG - Intergenic
1151548172 17:74806100-74806122 GTTTTTTCCCAAGGGAGCTGAGG + Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1156493289 18:37509114-37509136 ATTTTTGTACAAGTGATTTGGGG - Intronic
1157952100 18:52050746-52050768 AATTTTCCACAAGCCAGATGAGG + Intergenic
1161988883 19:7672763-7672785 ATTTGTGCCCCAGGGAGCTGAGG - Intergenic
1164695938 19:30244344-30244366 ATTTTTGCACAAGTGAGAGATGG - Intronic
1167272586 19:48514192-48514214 ATACATGAACAAGCGAGCTGGGG - Intergenic
1167454441 19:49591189-49591211 ATCTTTGCACAAGGCGGCTGGGG - Intergenic
937146503 2:119649901-119649923 ATTTTTGAACAATGGAGCTAAGG - Intronic
938905074 2:135829334-135829356 ATTTCTACACAAGCAAGCAGAGG + Intronic
941274206 2:163470209-163470231 ATTCTTGCACTAGAGAGATGGGG + Intergenic
943613196 2:190059377-190059399 ATTTTTGCACAAGAATGCTAAGG + Intronic
945663299 2:212712348-212712370 AATTTTGCCCAAGCAAGCTCTGG + Intergenic
946567921 2:220987960-220987982 TTTTTTGCAGAAGGCAGCTGAGG + Intergenic
948546252 2:238730793-238730815 CTTTTTGCAGAGGGGAGCTGAGG - Intergenic
1169748341 20:8965482-8965504 TTTTTTTCTAAAGCGAGCTGAGG - Intronic
950013264 3:9738762-9738784 ACTTTCTCACAAGTGAGCTGGGG + Intronic
954485932 3:50851260-50851282 ATTTATGCACAAGAGGGGTGGGG + Intronic
956014665 3:64869102-64869124 ATTTTTGCACAACAGAGCTTGGG - Intergenic
956465669 3:69518636-69518658 ATCTTTGCTCCAGCCAGCTGTGG - Intronic
956605670 3:71070713-71070735 ATTTCTGCAGCAGCGTGCTGGGG + Intronic
959020213 3:101180715-101180737 ATTTTTTCAACAGTGAGCTGTGG + Intergenic
963020230 3:140866212-140866234 CTTTTTGCTCAAGCTAGCTTTGG + Intergenic
965997056 3:174896714-174896736 ATTTTTGCTTAAGAGAGCTTTGG - Intronic
967252938 3:187561811-187561833 ATTTTCTCAAAAGCAAGCTGGGG - Intergenic
971226704 4:24760700-24760722 GTTATTGGACAAGCTAGCTGTGG - Intergenic
976231884 4:82852842-82852864 ATTTTTCCACAGGCCAGCAGGGG + Intronic
979139418 4:117153201-117153223 ATTTCTGCACAGGAAAGCTGGGG + Intergenic
980711394 4:136573157-136573179 ATTTTTCCACACGAGAGCGGTGG - Intergenic
991050542 5:62268226-62268248 AAGTTTTCAGAAGCGAGCTGAGG + Intergenic
992280386 5:75169321-75169343 ATTTTTGCACAGCAGAGTTGAGG - Intronic
995373672 5:111450026-111450048 ATTTTTACACAGGCCAGGTGTGG + Intronic
995572099 5:113491300-113491322 CTTTTTGGACATGCCAGCTGTGG + Intergenic
996024958 5:118635016-118635038 ATTTTTGCTCAAGATAGCTTTGG - Intergenic
996212460 5:120828172-120828194 ATTTTTGCACAAGGTAAATGTGG + Intergenic
998208727 5:140177544-140177566 ATTTACGCACAAACCAGCTGCGG - Intronic
998561423 5:143175689-143175711 ATTTTTGCAAAAGCAGGCTTGGG + Intronic
998906128 5:146907261-146907283 ATTTTTGCACAAGCGAGCTGGGG + Intronic
1004473571 6:15950427-15950449 ATCTCTGCACAAGCCAGCTCTGG + Intergenic
1007197196 6:40072822-40072844 ATTTTTGTAGAAGAGAGATGAGG + Intergenic
1011653042 6:89524655-89524677 ATTTTTGCAGTTGCGAGTTGTGG + Intronic
1012257563 6:97051225-97051247 ATTTTTACACAAGGGAGATATGG - Intronic
1017375363 6:153761867-153761889 ATTTTTCCACAAACCAGTTGGGG + Intergenic
1018034534 6:159870928-159870950 ATTTTTGCTCAAGAGTGCTTTGG + Intergenic
1026506308 7:70987336-70987358 ATTTTTTCACAGGCCAGGTGTGG + Intergenic
1027694549 7:81393302-81393324 ATTTTTTCACAATCCAACTGGGG + Intergenic
1029210010 7:98899751-98899773 GTGTCTGCACAAGCGAGGTGAGG + Exonic
1030300716 7:107971716-107971738 ATTTTTGCACAAGAGATTAGAGG + Intronic
1037964598 8:23124478-23124500 ATTTTTACCCCGGCGAGCTGGGG + Intergenic
1038826856 8:31012680-31012702 ATTTATGGATAAGCAAGCTGGGG + Intronic
1041423824 8:57697884-57697906 ATTTTAGAATAAGCGAGATGTGG - Intergenic
1042069998 8:64921993-64922015 ATTTTTGCTCAAGATAGCTTTGG + Intergenic
1042272554 8:66969999-66970021 ATTTTGCCACAAGCTAGCTGGGG - Intronic
1042343666 8:67705571-67705593 ATTTTTGCACCAAAGAGGTGTGG - Intronic
1044795041 8:95888008-95888030 AATGTTGAACAAGGGAGCTGTGG - Intergenic
1058773287 9:108259886-108259908 CTTTATGGACAAGGGAGCTGAGG - Intergenic
1060256419 9:122034937-122034959 CTTTTAGCAGAAGGGAGCTGGGG - Intronic
1185543815 X:925875-925897 TTTTGTGCATAAGCCAGCTGGGG + Intergenic
1188752513 X:33922170-33922192 ATTTTTGCACCAAAGAGGTGAGG + Intergenic
1189812769 X:44796276-44796298 ATTGTTGCACAACAGAGCTCCGG - Intergenic
1192248791 X:69394087-69394109 ATTATTGAACAAGAGAGATGAGG + Intergenic
1193387721 X:80891050-80891072 ATTTTGGAATAAGCGAGATGTGG + Intergenic
1194801835 X:98283325-98283347 CTTTTTTCAGAAGGGAGCTGTGG + Intergenic
1196937189 X:120741630-120741652 ATTATTACACAAGCTAGCTTGGG - Intergenic
1197079096 X:122390365-122390387 ATTTTTGCTCAAGATAGCTTTGG + Intergenic
1197484203 X:127027237-127027259 ATTTTTGCTCAAGAGAGCTCAGG - Intergenic
1200136041 X:153875339-153875361 GCCTTTGCACAAGCCAGCTGAGG + Intronic
1201693194 Y:16792484-16792506 ATTTTTCCACAAATGAGCTGGGG - Intergenic
1201711356 Y:16996372-16996394 ATTTTTCCACAGGCCAGCAGTGG + Intergenic
1201915302 Y:19175206-19175228 ATTTTTGAATAAGTGAGGTGTGG - Intergenic