ID: 998907825

View in Genome Browser
Species Human (GRCh38)
Location 5:146925595-146925617
Sequence GACAATGATGTGTTCAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998907825 Original CRISPR GACAATGATGTGTTCAAGTG TGG Intronic
902882224 1:19379965-19379987 CACAATGATGTGGTCAGGAGGGG - Intronic
905327570 1:37167820-37167842 GACAATGATGCATTTAAGTGTGG + Intergenic
906202041 1:43966620-43966642 GTCAAAGCTGTGTTCCAGTGTGG + Exonic
907378744 1:54067210-54067232 GACAAAGATGTGGGCAAGTGTGG + Intronic
907861715 1:58360103-58360125 GAAAAGGTTGTGTTCTAGTGGGG + Intronic
908480925 1:64538250-64538272 GAAAATGATGAGTTTAAATGTGG - Intronic
908644601 1:66263888-66263910 GAAAAAGAAGTGTTCAAGTTTGG + Intronic
908677452 1:66621362-66621384 GACAAGGATGGGAACAAGTGGGG - Intronic
909400160 1:75219122-75219144 GACAACTATGTGCTGAAGTGGGG - Intronic
910575158 1:88754044-88754066 TACCATGATGTGTCCAAGTGTGG + Intronic
912690834 1:111803513-111803535 GAAAGTGATGTGTCCATGTGGGG - Intronic
913065133 1:115244562-115244584 TACAATGATGTGTCTAGGTGTGG - Intergenic
915523852 1:156464422-156464444 GAGAATGGTGTGTTCCACTGAGG + Exonic
917409804 1:174747668-174747690 GATAATGATGTTTTGAAGTTTGG - Intronic
918238182 1:182599954-182599976 GAGAAGGAAGTGTTCTAGTGTGG - Exonic
919147398 1:193652850-193652872 GTCAATGATGTGTTCCCTTGAGG + Intergenic
919224888 1:194684048-194684070 GAAAATCGTGTGTTCAGGTGTGG + Intergenic
920796211 1:209139780-209139802 GGCAATGATGTATTCCAATGAGG - Intergenic
921690702 1:218146151-218146173 GACTATGATATGTGTAAGTGTGG - Intergenic
923676610 1:236086015-236086037 GTGAATGATGTGCACAAGTGTGG + Intergenic
924080491 1:240392017-240392039 GACCATGATCTGTTCACCTGTGG + Intronic
924388637 1:243525970-243525992 GACTATAATGTGTTTAGGTGAGG - Intronic
1065607463 10:27433192-27433214 GACTATGATGTGCCTAAGTGTGG - Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1067241079 10:44494284-44494306 GACTATGATATGTCCATGTGTGG - Intergenic
1068214284 10:53963579-53963601 GACAATTATGTGTACTAGTTTGG - Intronic
1068752441 10:60610614-60610636 GACAGTGATCTCTTCAAGTTTGG - Intronic
1068849676 10:61722296-61722318 GACAATGATGCATTAAAGTTAGG + Intronic
1069054917 10:63834875-63834897 GAAAATGATGAGTTCAATTTTGG - Intergenic
1070092915 10:73306381-73306403 GACTATGGTGTGTTTTAGTGTGG - Intronic
1071259165 10:83904267-83904289 GACAATGATATTTAAAAGTGGGG - Intergenic
1074331748 10:112519077-112519099 GACTATGCTGTGTTATAGTGAGG - Intronic
1074376602 10:112946128-112946150 GACAGTGATATGTACATGTGTGG - Intergenic
1074878499 10:117632855-117632877 GAGAATGATGTGATCAATTGTGG - Intergenic
1076863048 10:133151014-133151036 GGCAATGAGGTGGACAAGTGGGG - Intergenic
1076870803 10:133192982-133193004 GACTATGATGTGTCCTGGTGTGG - Intronic
1079755845 11:24260497-24260519 GACAAAGATGTACACAAGTGTGG + Intergenic
1081158446 11:39723975-39723997 GACAATGAGGTGACCAAGCGTGG + Intergenic
1083209489 11:61174247-61174269 GACGATGGTGTGTTCAGGTGTGG - Intergenic
1084816636 11:71651256-71651278 GACAGGGAAGTGTGCAAGTGTGG + Intergenic
1087384445 11:97452840-97452862 GAGAATTATGTGTTTAAGGGAGG + Intergenic
1088384437 11:109237623-109237645 GACAGTGATGAGTGCAATTGTGG + Intergenic
1088851797 11:113709962-113709984 GATTATGATGTGTTTACGTGTGG - Intergenic
1088966230 11:114724270-114724292 CACAGTGACGTGTTCCAGTGAGG + Intergenic
1090846146 11:130531683-130531705 GAAAATGTTGTGTGTAAGTGGGG + Intergenic
1092692993 12:11135694-11135716 GGCAAAGATTTGTTCATGTGAGG + Intronic
1094278197 12:28703989-28704011 GACATTGATGTTTTCAACTGTGG + Intergenic
1095089478 12:38090402-38090424 GAAAATGAGGTATTCAAATGTGG + Intergenic
1095750184 12:45701888-45701910 CACTATGATGTGTCTAAGTGTGG + Intergenic
1095840815 12:46689749-46689771 GATAATGATATGTTTAGGTGTGG - Intergenic
1097982546 12:65749561-65749583 GACTATGATGTGCTAAAATGTGG - Intergenic
1098448032 12:70587688-70587710 GACACTGATGTGTTCATGGAAGG + Intronic
1099341681 12:81444161-81444183 GACAAGGATGTCTTCAAGAAAGG - Intronic
1101097580 12:101358957-101358979 GATCATGATGTGTCTAAGTGTGG + Intronic
1101650180 12:106670406-106670428 GACAATGAGGTGTTCACATATGG + Intronic
1107646001 13:42495114-42495136 GAGAATGAGGTTTTCAAGGGAGG - Intergenic
1108011306 13:46015158-46015180 AACATTAATGTTTTCAAGTGGGG - Intronic
1108280528 13:48856791-48856813 GACTATCATGTGTTCTAGAGAGG + Intergenic
1108650294 13:52471583-52471605 GAAAATTATGTGTTCAAGTTTGG - Intronic
1108769862 13:53686674-53686696 GGCAATAAGGTGGTCAAGTGTGG - Intergenic
1110804264 13:79736416-79736438 TCAACTGATGTGTTCAAGTGGGG + Intergenic
1112998284 13:105600741-105600763 GCCAAGGATGTGTCCAAATGGGG - Intergenic
1114522514 14:23348109-23348131 CACCATCATGTGTGCAAGTGAGG + Intronic
1115987859 14:39121185-39121207 GACAATGGTGTGTCCAAAAGAGG - Intronic
1117409447 14:55437982-55438004 GAGAATGATGTGTGCACCTGAGG + Intronic
1120093497 14:80361520-80361542 GTCAATAATGTGTTCACGTCAGG - Intronic
1121516805 14:94557697-94557719 GAAAATGATGAGTTTAAGAGAGG + Intergenic
1122358601 14:101142043-101142065 GACTATAATGTGTTTAGGTGTGG + Intergenic
1123191343 14:106575295-106575317 CACAATGATGTGTTCCAGAAAGG + Intergenic
1125113241 15:36058432-36058454 GAGAATACTGGGTTCAAGTGTGG + Intergenic
1126181943 15:45793933-45793955 GACAGTGATGTGTTTAGGAGTGG + Intergenic
1126194146 15:45912845-45912867 GAGAATGATGTGTTCTCATGAGG - Intergenic
1126881299 15:53101013-53101035 TACAATGTTGTGTTCAATTTGGG - Intergenic
1127396092 15:58544960-58544982 GAAAATGTTGTGTGCAAGTAGGG - Intronic
1128284189 15:66422678-66422700 GACTATGATGTGTCTAGGTGTGG + Intronic
1129309636 15:74697007-74697029 GATAATGATGTGTCAAAGTTGGG - Intergenic
1130065203 15:80597137-80597159 GACACTGATGTTTGCATGTGTGG - Exonic
1131269084 15:90935574-90935596 GGCAATGAGCTGTTCAAATGTGG + Exonic
1137299869 16:47138481-47138503 GAAAATGATGTGTGCAACTTAGG - Intronic
1137465555 16:48705679-48705701 GACAATGTAGTGATCAAGTCAGG + Intergenic
1137891355 16:52166110-52166132 GATAATGATGTGTTCCTTTGCGG + Intergenic
1139433084 16:66921561-66921583 GGCCATGATGTGTTAATGTGAGG - Intergenic
1140744132 16:77965956-77965978 GCCAATGAGGACTTCAAGTGTGG + Intronic
1140981520 16:80114105-80114127 GGCAATGCTGTGTTCAGGTTAGG + Intergenic
1143424626 17:6824823-6824845 GACAATGATGAGTTCATCTTGGG + Intronic
1143513316 17:7407412-7407434 GCGAATGGTGTGTTGAAGTGGGG + Intronic
1144957456 17:19026225-19026247 GATAAAGATGTGTTCAAGGCCGG + Intronic
1144977700 17:19148291-19148313 GATAAAGATGTGTTCAAGGCCGG - Intronic
1149370357 17:55987935-55987957 GGCAGTGATGTGCTCATGTGTGG - Intergenic
1149449199 17:56736680-56736702 AATAATGATGTGTTCAACAGTGG - Intergenic
1154097879 18:11436165-11436187 GAGAGTGAGGTGTTGAAGTGGGG - Intergenic
1154294990 18:13139959-13139981 GACAATGAGGTGTGCAAGGAGGG - Intergenic
1155437167 18:25825767-25825789 GACAATGATGTGTTCGGTTTTGG - Intergenic
1158134237 18:54188983-54189005 GGCAATGTTGTATTCAAGTCTGG + Exonic
1162218464 19:9156454-9156476 GAAACTGATGTGTGCAAGAGAGG + Intronic
1168555678 19:57337904-57337926 GATTATGATGTGTCCTAGTGTGG + Intergenic
926323236 2:11763376-11763398 GACAGTGATGTGGGCAGGTGTGG + Intronic
926973940 2:18494787-18494809 GAGAATGATGTTTTCAAATAAGG - Intergenic
927368417 2:22326436-22326458 GTAAAGGATGTGGTCAAGTGGGG - Intergenic
930103277 2:47619055-47619077 GACAATGCTATTTCCAAGTGAGG - Intergenic
930853734 2:55989537-55989559 GACAGTGATGTGGGCAAGAGGGG - Intergenic
931163903 2:59724705-59724727 CACAATGATGTGTGCATGTGTGG - Intergenic
935055335 2:99561494-99561516 GACAATGCTATTTTTAAGTGGGG - Intronic
935271909 2:101442200-101442222 GACAATGATATTTAAAAGTGGGG - Intronic
936294152 2:111252720-111252742 AATAATGATGTGTCCAGGTGTGG + Intergenic
936406091 2:112204498-112204520 GACCATGATGGGTCTAAGTGTGG - Intergenic
936633964 2:114234516-114234538 GCCAATGATGTGGGCAGGTGGGG - Intergenic
937748932 2:125450438-125450460 GATTATGATGTGTTTAAGTATGG + Intergenic
938982361 2:136538913-136538935 GACATTGATTTGTTGAAATGAGG + Intergenic
940154371 2:150638322-150638344 GACAATGAGGTGATAAGGTGAGG + Intergenic
941517074 2:166493237-166493259 GAAAATGATGGGTTCCAGTTTGG - Intronic
943638781 2:190336099-190336121 GACAATGAAGTGCTCATATGTGG + Intronic
943679598 2:190754389-190754411 GATTATGATGTGTTTGAGTGTGG + Intergenic
945741275 2:213665449-213665471 GACAAGGATATGTTGAATTGAGG + Intronic
946876161 2:224131853-224131875 GACCAAGAAGAGTTCAAGTGCGG + Intergenic
947198646 2:227595429-227595451 GACAATGCTCTCTGCAAGTGTGG + Intergenic
948719067 2:239884990-239885012 TACTATGATGTGTTCATTTGTGG - Intergenic
949038002 2:241827406-241827428 TACTATGATGTGCTCAGGTGTGG - Intergenic
1169561559 20:6806377-6806399 GACTATGATGTGTCTAGGTGTGG - Intergenic
1170671343 20:18436760-18436782 GATTATAATGTGTTTAAGTGTGG - Intronic
1172103205 20:32498107-32498129 GACAATGAGCTGTTCAGGTTCGG + Intronic
1172173235 20:32956719-32956741 GACTATGATGTGCGTAAGTGTGG + Intronic
1173114651 20:40229238-40229260 GTCAATGATGTGGACAACTGTGG - Intergenic
1174361629 20:50032370-50032392 GATAAGTATGTGTTCAAGGGTGG + Intergenic
1176212999 20:63934381-63934403 GACAATGCTGTGAGCAAGTGTGG + Exonic
1180895314 22:19327517-19327539 GACAATAATGTGTATTAGTGAGG - Intergenic
1183274211 22:36881981-36882003 GACTATGATGTGTTTAAGTGTGG - Intergenic
1183663098 22:39233038-39233060 GACCACGCTGGGTTCAAGTGAGG + Intronic
1184284198 22:43458943-43458965 GATTATGATGTGTTTAGGTGTGG + Intronic
1184913172 22:47549539-47549561 GGCAATGATGTGTTTGAGGGTGG + Intergenic
952077853 3:29719968-29719990 GACATTGATGAATTTAAGTGGGG - Intronic
957884028 3:86259882-86259904 GGCAATGATGTGATGATGTGGGG - Intergenic
959275558 3:104273018-104273040 AAGAATGATGTGTCCATGTGTGG + Intergenic
960763673 3:121100326-121100348 GACCAGGATGTGGTCAAGTTTGG - Intronic
968526676 4:1061573-1061595 GCCAATGATCTGTGCATGTGGGG - Intronic
968543462 4:1181071-1181093 GATAATGATGTGTGTCAGTGCGG - Intronic
971697200 4:29921628-29921650 TACAATGATATGTGCATGTGTGG - Intergenic
972004987 4:34090304-34090326 GACTATGATATGTTCAGGTATGG + Intergenic
972808346 4:42554607-42554629 AACAATCATGAGTTCAAGTTGGG + Intronic
973272660 4:48277537-48277559 GACTATGATGTGTCTCAGTGTGG - Intergenic
974185969 4:58446646-58446668 GACAATGATGAGTTGAATGGGGG + Intergenic
979835973 4:125367874-125367896 GAAAATGGTGAGTTCATGTGTGG + Intronic
979959496 4:127000134-127000156 GACAATTAAGTGGTCAGGTGTGG + Intergenic
982349398 4:154398517-154398539 AACAATGATGTGTTGAGGTGTGG - Intronic
987858593 5:23454182-23454204 GACAATGTTGTGTGTATGTGTGG - Intergenic
990126402 5:52523867-52523889 AACAATGATGTCTTTAAATGTGG + Intergenic
990937960 5:61170639-61170661 GACCAGGATGTCTTTAAGTGAGG - Intergenic
992393178 5:76347905-76347927 GAAAATGATGTGTCAAAGTAGGG - Intronic
992818163 5:80465819-80465841 GACTATGATGTGTTTAGGGGTGG + Intronic
992987431 5:82247099-82247121 GACTATGATGTGTCTAGGTGTGG + Intronic
996526097 5:124481329-124481351 GTCAATGCTGTGTTCAGGAGGGG + Intergenic
997329635 5:133050847-133050869 GAAAAGGCTGTGTTCAAGTTTGG - Intergenic
998907825 5:146925595-146925617 GACAATGATGTGTTCAAGTGTGG + Intronic
999148369 5:149410614-149410636 GAAACTGATGGCTTCAAGTGTGG - Intergenic
1000211345 5:159108710-159108732 AGCAATGATGTTTTCAAGTAGGG - Intergenic
1000448388 5:161353533-161353555 GATAATGAGGTGTTTAGGTGAGG + Intronic
1001408474 5:171493860-171493882 GACAGCGCTGTGTGCAAGTGTGG - Intergenic
1001734104 5:173984665-173984687 GACAGTGATGTGTTTCTGTGAGG + Intronic
1003956076 6:11166042-11166064 GAGAATTATGTGTACAAGTCAGG - Intergenic
1004820066 6:19358390-19358412 GACAGACATGGGTTCAAGTGTGG - Intergenic
1008355723 6:50550598-50550620 GACTATTATGTGTTTATGTGGGG - Intergenic
1008862152 6:56161752-56161774 GACAATGATAAGTCTAAGTGTGG + Intronic
1010166055 6:72916814-72916836 GGCAATGATGTTTCCAAATGAGG + Intronic
1010408552 6:75534229-75534251 GACTATGATGTGTCTAAGTGTGG - Intergenic
1011661317 6:89596485-89596507 GAAAATGATCTATTCAAGTTGGG + Intronic
1011952838 6:92989027-92989049 GACAATGATATGTTGGAGTTAGG - Intergenic
1012160139 6:95873921-95873943 GACCAGGGTGTCTTCAAGTGTGG + Intergenic
1012381880 6:98629994-98630016 GAGAATAATTTGTTCAGGTGAGG - Intergenic
1014358966 6:120451529-120451551 AACTATGATGTGTCCAAATGTGG + Intergenic
1017092617 6:150774117-150774139 GACAATGATGTCTGAAAATGAGG + Intronic
1021423715 7:20474422-20474444 GACAATGGTGTATTCATGAGTGG + Intergenic
1021752086 7:23811902-23811924 GACAATGATATTTAAAAGTGGGG - Intronic
1021800516 7:24301363-24301385 GATGATGATGTGTTCAGATGTGG + Intergenic
1023432112 7:40104788-40104810 GAAAATTTTGAGTTCAAGTGTGG - Intergenic
1028767458 7:94575938-94575960 GATCATGATGTGTCTAAGTGTGG + Intergenic
1028807065 7:95039967-95039989 GAATATGATGTGCTCAGGTGTGG - Intronic
1028952359 7:96650883-96650905 GCCAATGGTGTTTTCAGGTGTGG + Intronic
1029012689 7:97278929-97278951 GAAAATGAAGTGTGAAAGTGAGG + Intergenic
1029073311 7:97917407-97917429 GACAGGGAAGTGTGCAAGTGTGG - Intergenic
1030591455 7:111487698-111487720 AACAATGATGTGTACTACTGTGG - Intronic
1032100521 7:128972859-128972881 GATAATGATGTGTTCATATAGGG + Intronic
1032464546 7:132135780-132135802 GAGGATGATGTGTTCAGGAGAGG - Intronic
1032867275 7:135939090-135939112 GAAAATGAGGTGTCCAAGAGCGG + Intronic
1035114437 7:156511434-156511456 GACTATAATGTGTCCAATTGTGG - Intergenic
1036042488 8:5101485-5101507 TACAATGATTTGTTCAAGAATGG + Intergenic
1036067906 8:5404691-5404713 GACTATGATGTGTTTCATTGTGG + Intergenic
1037959867 8:23088629-23088651 GACTATGATGTGTCCAGGTAGGG - Intronic
1037978328 8:23230563-23230585 GACTATGATGTGTCCAGGTAGGG + Intergenic
1042373850 8:68025462-68025484 TTCAATGATGTGTTTATGTGTGG + Intronic
1042395183 8:68283968-68283990 GACAATGATATTTAAAAGTGAGG - Intergenic
1044079103 8:87862212-87862234 CCCAATGATGAGTTAAAGTGAGG + Intergenic
1048127560 8:131653794-131653816 GATTATGATGTGTCTAAGTGTGG - Intergenic
1048490674 8:134890258-134890280 GATTATGATGTGTGTAAGTGTGG + Intergenic
1048978010 8:139683840-139683862 GCCAATGATGGGTCTAAGTGTGG + Intronic
1050236134 9:3582224-3582246 GACAATGCTGTTCTGAAGTGGGG + Intergenic
1050768250 9:9163348-9163370 GACAATTAAGTGTGGAAGTGTGG - Intronic
1051103683 9:13551679-13551701 GACTATGATGTGCCCAAGTGTGG - Intergenic
1051254377 9:15197677-15197699 GACTATGATGTGCCTAAGTGTGG - Intronic
1052677616 9:31647308-31647330 GAAAATGAGGTGTTCATTTGGGG + Intergenic
1053554458 9:39120926-39120948 GACAATGATATTTAGAAGTGGGG + Intronic
1053818553 9:41941066-41941088 GACAATGATATTTAGAAGTGGGG + Intronic
1054108818 9:61084724-61084746 GACAATGATATTTAGAAGTGGGG + Intergenic
1054612039 9:67246401-67246423 GACAATGATATTTAGAAGTGGGG - Intergenic
1055672813 9:78624259-78624281 GACAGTGAGGTTTTGAAGTGTGG + Intergenic
1056854954 9:90119085-90119107 GAGAATGATGTGAACCAGTGAGG - Intergenic
1057827814 9:98384194-98384216 GACTATGATCTGTCCAAATGGGG - Intronic
1058611432 9:106780423-106780445 AAGACTGATGTGTTCGAGTGAGG + Intergenic
1059690381 9:116679555-116679577 GTCAATTGTGTCTTCAAGTGTGG + Intronic
1060882358 9:127126331-127126353 GACCATGATGTGACTAAGTGTGG + Intronic
1187783278 X:22854207-22854229 GATAATGATGTGCCAAAGTGGGG + Intergenic
1191205303 X:57827537-57827559 GACAGTGGGGTGTTAAAGTGAGG + Intergenic
1191952816 X:66612378-66612400 GACAATGATATTTAAAAGTGGGG + Intronic
1194663289 X:96649574-96649596 GAGTATGCTGTGTTCATGTGGGG + Intergenic
1194774889 X:97950195-97950217 GACTATGATGTGTCTAAATGTGG - Intergenic
1195015539 X:100776247-100776269 GACTATGATGTGTCCTGGTGTGG + Intergenic
1195555815 X:106221606-106221628 GACAATGCTGAGTTCTGGTGAGG + Intergenic
1195739917 X:108053320-108053342 GACAATGATATTTAAAAGTGGGG + Intronic
1195952694 X:110292847-110292869 GATAATGATGTGTTAATGTAGGG + Intronic
1196305207 X:114094660-114094682 GACTATGATGTGTCTATGTGTGG + Intergenic
1196377909 X:115055088-115055110 GAAGATGATGAGTTCAAGTTTGG - Intergenic
1197880298 X:131159351-131159373 AACACTGATGTGTTGAAGGGAGG + Intergenic
1199252574 X:145680429-145680451 GAGAATGATGTATTCAAAAGTGG + Intergenic
1200369493 X:155708468-155708490 GACTAGGATGTGTCCAGGTGTGG + Intergenic
1201548712 Y:15195807-15195829 GACAATGATGTGTTAAAGGGAGG - Intergenic