ID: 998918356

View in Genome Browser
Species Human (GRCh38)
Location 5:147040680-147040702
Sequence CTTGTTAGGTACTCCGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998918351_998918356 -7 Left 998918351 5:147040664-147040686 CCTGGCCCTGAATGACCTTGTTA 0: 1
1: 0
2: 2
3: 26
4: 233
Right 998918356 5:147040680-147040702 CTTGTTAGGTACTCCGTGTGAGG No data
998918350_998918356 -6 Left 998918350 5:147040663-147040685 CCCTGGCCCTGAATGACCTTGTT 0: 1
1: 0
2: 3
3: 17
4: 176
Right 998918356 5:147040680-147040702 CTTGTTAGGTACTCCGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998918356 Original CRISPR CTTGTTAGGTACTCCGTGTG AGG Intronic
No off target data available for this crispr