ID: 998936309

View in Genome Browser
Species Human (GRCh38)
Location 5:147234101-147234123
Sequence GTGTACACCCACTACTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998936309_998936313 9 Left 998936309 5:147234101-147234123 CCAATATAGTAGTGGGTGTACAC No data
Right 998936313 5:147234133-147234155 CACATTTCTACGAATATTCAGGG No data
998936309_998936312 8 Left 998936309 5:147234101-147234123 CCAATATAGTAGTGGGTGTACAC No data
Right 998936312 5:147234132-147234154 TCACATTTCTACGAATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998936309 Original CRISPR GTGTACACCCACTACTATAT TGG (reversed) Intergenic
No off target data available for this crispr