ID: 998936446

View in Genome Browser
Species Human (GRCh38)
Location 5:147234709-147234731
Sequence GTACCCGCTGTGCGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998936444_998936446 -3 Left 998936444 5:147234689-147234711 CCGTGATATGGGGCGTAATAGTA No data
Right 998936446 5:147234709-147234731 GTACCCGCTGTGCGTCCTGGTGG No data
998936439_998936446 25 Left 998936439 5:147234661-147234683 CCACATCGCAGGGGGGGTGAGGC No data
Right 998936446 5:147234709-147234731 GTACCCGCTGTGCGTCCTGGTGG No data
998936443_998936446 -2 Left 998936443 5:147234688-147234710 CCCGTGATATGGGGCGTAATAGT No data
Right 998936446 5:147234709-147234731 GTACCCGCTGTGCGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998936446 Original CRISPR GTACCCGCTGTGCGTCCTGG TGG Intergenic
No off target data available for this crispr