ID: 998937112

View in Genome Browser
Species Human (GRCh38)
Location 5:147241040-147241062
Sequence CCTTATTTTTAGAAGGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998937112_998937116 29 Left 998937112 5:147241040-147241062 CCATGAACCTTCTAAAAATAAGG 0: 1
1: 0
2: 2
3: 14
4: 242
Right 998937116 5:147241092-147241114 AATTAGGAGTTTGTCATGATTGG 0: 1
1: 0
2: 1
3: 10
4: 151
998937112_998937115 13 Left 998937112 5:147241040-147241062 CCATGAACCTTCTAAAAATAAGG 0: 1
1: 0
2: 2
3: 14
4: 242
Right 998937115 5:147241076-147241098 TACAAAAGAAAAGAAGAATTAGG No data
998937112_998937117 30 Left 998937112 5:147241040-147241062 CCATGAACCTTCTAAAAATAAGG 0: 1
1: 0
2: 2
3: 14
4: 242
Right 998937117 5:147241093-147241115 ATTAGGAGTTTGTCATGATTGGG 0: 1
1: 0
2: 1
3: 10
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998937112 Original CRISPR CCTTATTTTTAGAAGGTTCA TGG (reversed) Intronic
907895114 1:58681000-58681022 AGTTATTTTTAGAAGGGACAGGG + Intronic
908991163 1:70091499-70091521 CTATATTTTTGGAAGGTACAGGG + Intronic
909968651 1:81951797-81951819 CCTTCGTCTTAGAAGTTTCAAGG - Intronic
910176176 1:84432867-84432889 CCTTCTTTTTAAAATGTTCATGG + Intergenic
910498369 1:87859552-87859574 CCTTAATTTTAGAAGAATGATGG + Intergenic
910756188 1:90694222-90694244 CTTCATTTTTAGAAGGTTCTGGG - Intergenic
912818820 1:112850625-112850647 CCTTATTTACAAAATGTTCATGG - Intergenic
912821756 1:112873457-112873479 CCTAATCTTTGCAAGGTTCATGG - Intergenic
912831508 1:112957152-112957174 CCTTATTTACAAAATGTTCAGGG - Intergenic
913073780 1:115324069-115324091 CATTATTTTGAGATGGTACAAGG + Intronic
913681425 1:121189235-121189257 TTTAATTTTTGGAAGGTTCAAGG + Intronic
914033255 1:143976872-143976894 TTTAATTTTTGGAAGGTTCAAGG + Intergenic
914156191 1:145091095-145091117 TTTAATTTTTGGAAGGTTCAAGG - Intronic
918569924 1:185977971-185977993 CTTTATTTTAAGTAGGTTGAAGG + Exonic
918659264 1:187069821-187069843 TTTTATTCTTAGAAGGTTCTTGG - Intergenic
918739551 1:188110660-188110682 TCTAAATTCTAGAAGGTTCAAGG - Intergenic
918763546 1:188447158-188447180 CCTTATTCTGAGAATGTTGACGG + Intergenic
918860681 1:189822805-189822827 CCTTATTTGAAGAAGCTTTATGG - Intergenic
920468739 1:206207753-206207775 TTTAATTTTTGGAAGGTTCAAGG + Intronic
920783082 1:209013370-209013392 CCTTAGCTTTAGAAGCCTCAAGG + Intergenic
921161400 1:212474781-212474803 CTGTATTTTCAGAAGGTTAATGG - Intergenic
1064276211 10:13907558-13907580 TCTTATTTGTTGAGGGTTCAAGG + Intronic
1066209177 10:33220057-33220079 CCTAAGATTTAGAAAGTTCAAGG - Intronic
1069289600 10:66761321-66761343 CCTTATTTTAGTAAGTTTCATGG - Intronic
1069418114 10:68220156-68220178 CTTTATTTTTTGCAAGTTCAAGG - Intergenic
1069509435 10:69030626-69030648 CCTTATTTTGTGATGCTTCAAGG + Intergenic
1070269701 10:74941032-74941054 CATTTTTTTTAGAAGATCCATGG + Intronic
1070665408 10:78339076-78339098 CCTAATTCTTAAAACGTTCAAGG + Intergenic
1071661889 10:87512623-87512645 TGTTAATTTTAGAGGGTTCAAGG - Intronic
1071908350 10:90200571-90200593 TCTTATTTTCAGAAGTTTCTGGG + Intergenic
1071990327 10:91095044-91095066 AATTATTTCTGGAAGGTTCAGGG + Intergenic
1075803532 10:125168274-125168296 CCTTATTTGTAGATTTTTCAGGG + Intergenic
1075803551 10:125168539-125168561 ACTTACCTTTAGATGGTTCAGGG - Intergenic
1076217017 10:128703184-128703206 CTTTATTCTTAGGAGATTCAAGG + Intergenic
1078949344 11:16111916-16111938 TCTTCTGTTTAGCAGGTTCAGGG - Exonic
1080646453 11:34191654-34191676 CCTTATTCTTAGAAGGGTTCAGG + Intronic
1084428027 11:69096176-69096198 CCGTGTGTTTTGAAGGTTCATGG + Intergenic
1087262671 11:96028185-96028207 TCTTATTTTTAAAACTTTCAAGG - Intronic
1087658530 11:100956836-100956858 ACTTATTTTTAAAATATTCATGG - Intronic
1088415337 11:109582367-109582389 CCTTATTTTTCCAAAGTTAAAGG - Intergenic
1090105496 11:123850847-123850869 CTTTATTTTTGGAAGGTTTTAGG + Intergenic
1091845934 12:3656479-3656501 CCTGATGTTGAGTAGGTTCAAGG - Intronic
1092470675 12:8776999-8777021 ACTTTTTTTGAGAAGGTTTATGG + Exonic
1093116599 12:15219590-15219612 CCCTATGTTTTTAAGGTTCAGGG + Intronic
1095047439 12:37523437-37523459 CTTTATTTGTAGAATGTCCAAGG - Intergenic
1095644289 12:44524513-44524535 CTTTATTTTTAAAATCTTCAAGG - Intronic
1095905806 12:47376917-47376939 TCTTATTCTCAGAGGGTTCAGGG - Intergenic
1097869972 12:64593753-64593775 CCTTTTTATTTGAAGGGTCATGG + Intergenic
1098577647 12:72061694-72061716 CATTAATTTTGGAAGATTCATGG + Intronic
1099023728 12:77439230-77439252 CCTCAGTTTTTGAGGGTTCACGG + Intergenic
1099569367 12:84296307-84296329 CCTTAGTTTTAGAATGTTTATGG + Intergenic
1100112156 12:91258956-91258978 CCATATTTTGAGAAAGATCAAGG + Intergenic
1100113132 12:91269842-91269864 CCAAATTCTTAGAAGTTTCAAGG - Intergenic
1101260483 12:103024688-103024710 CTTTATTTTTGGAAGATTTAAGG + Intergenic
1102536124 12:113582864-113582886 CCTTATCTTTACAGGGTTCTGGG - Intergenic
1103823378 12:123716485-123716507 CATGATTTTTAGAAAGTTTATGG + Intronic
1104297689 12:127532260-127532282 CCTTATGTTTTGAATGTTCCTGG + Intergenic
1106609196 13:31262429-31262451 CTTCATTCTTAGAAGGGTCAAGG + Intronic
1106913578 13:34488252-34488274 ACTTTATTTTAAAAGGTTCATGG + Intergenic
1107348948 13:39493958-39493980 CCCTCTTCTTAGAAGGTGCAAGG + Intronic
1107523929 13:41211751-41211773 TATTATTTTTAGTAGATTCAGGG + Intergenic
1112148005 13:96723123-96723145 CCTTAATTTTAGCTGGTGCATGG + Intronic
1112680565 13:101760021-101760043 CCCTATTTTTTGCAGGCTCAGGG - Intronic
1112964499 13:105170968-105170990 ACTTATTTTAAGAAAGTTCAGGG - Intergenic
1114925265 14:27389539-27389561 GCTTCTTTTTAGAGGGTTTAAGG - Intergenic
1115252486 14:31364053-31364075 CCTTGTTTCTAGGAGGTTTAGGG - Intronic
1115872073 14:37815977-37815999 CATTAATTTTGGAAGTTTCAAGG - Intronic
1116142550 14:41017127-41017149 CCTGATTTTTAGAAGATTGAAGG - Intergenic
1116216170 14:42020240-42020262 CCTTACCTCTAGAAAGTTCAGGG - Intergenic
1116394080 14:44427778-44427800 GCTTAATTTTAGAATGCTCATGG - Intergenic
1118359216 14:65042032-65042054 CCTTATTTTTTTAAGGTTAAAGG + Intronic
1118651019 14:67894520-67894542 CCTTATTTGTAGAAGCCTTAAGG - Intronic
1118866370 14:69707288-69707310 CCTTACTTTTAGATGGTTCAGGG + Intronic
1120603552 14:86542933-86542955 CATTATTTTTATAAGGATAAAGG - Intergenic
1120674109 14:87399967-87399989 ATTTTTTTTTAGAATGTTCACGG + Intergenic
1120690924 14:87591496-87591518 CATTCTTTTTTGAAGGTTCTAGG - Intergenic
1121911631 14:97797223-97797245 TCTTATTGTTACCAGGTTCAGGG - Intergenic
1124168026 15:27346486-27346508 CATTAATTTTGGAAGGTTCTTGG + Intronic
1125077882 15:35641090-35641112 GCTTATTTTTAGTCTGTTCAGGG - Intergenic
1125396681 15:39256250-39256272 CTTTATTTTTATAAGTTCCAAGG + Intergenic
1127262782 15:57338095-57338117 CCATATTTTTAGCAGGAACATGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130769875 15:86913689-86913711 CTTTATTTTTTGTAGATTCAGGG - Intronic
1130864690 15:87922547-87922569 TTTTGTTTTTTGAAGGTTCAGGG - Intronic
1132140001 15:99384474-99384496 CCTTATTTTATGAAGCTGCAAGG - Intronic
1133340769 16:5034244-5034266 CCTTGTTCTTAGGAGATTCATGG - Intronic
1134042538 16:11079472-11079494 CATTTTTTATACAAGGTTCAAGG + Intronic
1137305550 16:47196273-47196295 CATTACTTTTAGAAGATTCTTGG + Intronic
1137541880 16:49368761-49368783 CCTTATTTTTAGTAGAGACAGGG - Intergenic
1137891496 16:52167434-52167456 CCACATTTTTAGCAGGTTCCTGG - Intergenic
1138053630 16:53809767-53809789 CTTTATTTTTAGTAGGGACAAGG - Intronic
1138223552 16:55273415-55273437 CATTATATTTTGAAGGCTCAGGG - Intergenic
1138445759 16:57062216-57062238 CCTTATTTTTTGGAGCTTCACGG - Intronic
1140074723 16:71687421-71687443 ACTTACTCTTAGAAGGTTGAAGG - Intronic
1146711295 17:35043970-35043992 CTTTATCTTTAGAAGGTTGGGGG - Intronic
1147736788 17:42644084-42644106 ACTTTTTTTTGGAGGGTTCAGGG - Intergenic
1149573020 17:57688170-57688192 CTTAGTTTTTAGAAGGTTTAAGG - Intergenic
1153944401 18:10006376-10006398 CTTTATTTTTAAAAGCCTCATGG + Intergenic
1154241259 18:12656594-12656616 CCTCACTTTTAGAAAGTTGATGG - Intronic
1154417329 18:14187148-14187170 CCTTATTATTAGATAGTCCATGG - Intergenic
1156129261 18:33949777-33949799 CCTTATTTTTAGAATATTATTGG + Intronic
1156924671 18:42561351-42561373 CCTAATTTTCAGAAGGGTCCTGG + Intergenic
1157788952 18:50513090-50513112 ACATATTTTTAGAAGGGTCCAGG + Intergenic
1159388079 18:67753121-67753143 CCTTATATTTACAAGGCACAAGG - Intergenic
1162387617 19:10369363-10369385 CCTTTTTTTTTTAAGGGTCAGGG + Intronic
1164241652 19:23394794-23394816 AGATATTTTTATAAGGTTCATGG - Intronic
1164371817 19:27650098-27650120 CTTTATTTTTAGAATGCCCATGG + Intergenic
1168650342 19:58088400-58088422 CTTTATTTTCAGAGGGTTCATGG + Intronic
925700128 2:6628102-6628124 CATTATTTTTAGATGATCCAAGG + Intergenic
926192399 2:10738639-10738661 CCTTATTTTCACGAGCTTCAGGG + Intronic
927771015 2:25861301-25861323 CTTTATTTTTTCAATGTTCATGG - Intronic
928728221 2:34200660-34200682 CTTTATTTTCTGAAAGTTCATGG + Intergenic
928930918 2:36623263-36623285 CCTTTTTTTTAGGTGGTTTAAGG - Intronic
930319994 2:49842823-49842845 CAGTATTTTTAGTAGGTTTAAGG - Intergenic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
931825495 2:65996329-65996351 CCTTATTTTAAGAATATTGATGG - Intergenic
932632766 2:73360439-73360461 CCTTATTTTTTCAAAGTACAGGG - Intergenic
934516552 2:94991690-94991712 CCCTATTGTTAGAAAATTCAAGG - Intergenic
935150765 2:100433114-100433136 TTTTTTTTTTAGTAGGTTCAGGG - Intergenic
935548303 2:104424059-104424081 CCCTATTTTTAGATTGCTCATGG - Intergenic
936806716 2:116342055-116342077 CTTTATTACAAGAAGGTTCATGG - Intergenic
937551817 2:123102850-123102872 CCATATTTTGAGAAGGCTCATGG - Intergenic
938594918 2:132778735-132778757 TCTGAATTTTAAAAGGTTCATGG + Intronic
939223164 2:139329497-139329519 CCATATTTTTAGAAGGCTTCAGG + Intergenic
941639713 2:167974407-167974429 CCTTTCTTTTAGATGCTTCAGGG - Intronic
941771742 2:169352561-169352583 CTGTATTTTTAAAAGTTTCAAGG - Intronic
942636841 2:178016629-178016651 ACTTATTTTTATAGGGATCAAGG + Intronic
942966347 2:181897403-181897425 CCTGATTTTTAGAAAATTAAAGG + Intronic
942968250 2:181923802-181923824 CCTCATTTTTAGAATTTTAATGG + Intronic
943214065 2:185007483-185007505 CATTAATTTTAGAAGATTCTTGG - Intergenic
943529127 2:189056887-189056909 ACTTTATTTTGGAAGGTTCAGGG + Intronic
943936909 2:193930643-193930665 CATTATTTTTTTAAGTTTCAAGG + Intergenic
944125586 2:196289388-196289410 ACTCATTTTTAAAAGGGTCAAGG + Intronic
944367336 2:198937710-198937732 CCTAATTTTTGCAAGGTTTAGGG + Intergenic
944629200 2:201606378-201606400 CTGTATTTTTATAAAGTTCAAGG + Intronic
944872177 2:203924012-203924034 CCATATTTTTAAAAGTTACATGG + Intergenic
945370487 2:209010292-209010314 CCTGACTTTTACAAGGATCATGG + Intergenic
948666797 2:239539920-239539942 CCTTATTTTTAGTAGAGACAGGG + Intergenic
1171192171 20:23166494-23166516 CCACCTATTTAGAAGGTTCAGGG + Intergenic
1171479526 20:25443200-25443222 CCTTTGTTTTAGAAGCTCCAAGG - Intronic
1173816431 20:45992254-45992276 CCTTATTCTTTGGAGGTTTAAGG - Intergenic
1177687733 21:24461618-24461640 GTTTATTTTTAGAGGTTTCAAGG + Intergenic
1178452973 21:32721502-32721524 CCTTATTTTTAGTAGAGACAGGG - Intronic
1178937706 21:36877875-36877897 CAATATTTTTAGAGGGCTCAAGG - Intronic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1182895271 22:33854466-33854488 TCTTATTTTTAAAAAGTACAAGG + Intronic
949502627 3:4696096-4696118 CTTAATTTTTAGAAGCTTCATGG + Intronic
952167100 3:30762238-30762260 AATTATGTTGAGAAGGTTCATGG + Intronic
953179414 3:40582307-40582329 GCCTGTTTTTACAAGGTTCATGG + Intergenic
954815548 3:53277598-53277620 CCTTATTTTTAGCAGAGACAAGG - Intergenic
954831143 3:53422270-53422292 CTTCATGATTAGAAGGTTCAGGG + Intergenic
956124521 3:65998804-65998826 CCTCATTTTTATGAGCTTCAAGG - Intronic
957487047 3:80875732-80875754 CATTATTTATATAATGTTCAAGG + Intergenic
957534261 3:81481053-81481075 CCTTATTTTAGGAATTTTCAGGG + Intergenic
958030499 3:88103566-88103588 CATTATTTTAAGAAAATTCATGG - Intronic
958541546 3:95481712-95481734 GATTATTTTTAGAAGATTCATGG - Intergenic
960093107 3:113662017-113662039 TCATATTTTTAGTAGATTCAGGG + Intronic
960524346 3:118692288-118692310 TTTGATTTTTAGAAAGTTCATGG - Intergenic
964524678 3:157605900-157605922 CATTATTTTTAAAATGTCCAAGG + Intronic
965858871 3:173123096-173123118 CGTTATTATTAGAAGGTAGAGGG + Intronic
966529294 3:180956563-180956585 GCTTACTTTTAGCAGGGTCAAGG + Intronic
968116309 3:196092773-196092795 TCTTATTTTTAGAAGTATCTGGG - Intergenic
970401848 4:15724804-15724826 CTTGAATTTTAGATGGTTCATGG + Intronic
970895748 4:21101909-21101931 CCTTTTTTTGAGATGTTTCATGG + Intronic
971436522 4:26631177-26631199 CCTTATGTTTAGGATTTTCAAGG + Intronic
972407932 4:38764213-38764235 CCTTAGGTCTAGAAGGTTCCTGG + Intergenic
973339813 4:48992679-48992701 CCTTCTTTTTAGAAGAGTCTCGG - Intronic
977431131 4:96931145-96931167 CCTTGTTTATAAAAGGTACAGGG + Intergenic
978657706 4:111084848-111084870 ACTTAATTTTATTAGGTTCATGG - Intergenic
978718653 4:111877290-111877312 CCTTATTTTTAAAAAGACCATGG - Intergenic
979874866 4:125875696-125875718 CCTATTTTTTAGAAGGTAAAAGG + Intergenic
981599937 4:146475807-146475829 TCTTAATTTTAAAAGCTTCAAGG - Intronic
982472374 4:155808689-155808711 CCTATTTTGTGGAAGGTTCAAGG - Intergenic
983667480 4:170197358-170197380 ACTTATTTTTAGAAGAGTCCAGG - Intergenic
986345623 5:6832617-6832639 CCTTAATTTTAGAGGATTCTTGG - Intergenic
989080858 5:37619111-37619133 CCTTATTTTTTAATGGTTAATGG + Intronic
990696554 5:58424492-58424514 CCTGATTTTAAGAATGTTAATGG + Intergenic
990721822 5:58704713-58704735 CCATATTTTCAGAAGTTTAAAGG + Intronic
990834877 5:60006752-60006774 CTTAATTTTTAAAAGGTTAATGG - Intronic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
993661947 5:90648412-90648434 CCTTACTCTCAAAAGGTTCAAGG - Intronic
993844445 5:92922999-92923021 CCTTAGTTTTAGAATGTTTTTGG + Intergenic
994048388 5:95334677-95334699 CTTTATTTTTAATAGGTTCTGGG + Intergenic
995150472 5:108838795-108838817 TATTATTTTTAGAATGTTTAAGG - Intronic
996939251 5:128984028-128984050 CTATACATTTAGAAGGTTCAAGG - Intronic
998937112 5:147241040-147241062 CCTTATTTTTAGAAGGTTCATGG - Intronic
999643359 5:153694331-153694353 CTTTATGTATAGAATGTTCAGGG - Intronic
1000760053 5:165212047-165212069 ACCTATTTTTAGAAGGTCCATGG + Intergenic
1001018635 5:168164031-168164053 CATTATCTTGTGAAGGTTCAAGG + Intronic
1002544341 5:179929068-179929090 CTTATTTTTTAGAAGCTTCATGG + Intronic
1003972259 6:11310922-11310944 CCTTATTGTTACAAGGATGAGGG - Intronic
1004411501 6:15385328-15385350 CCTTTTTACTAGAATGTTCAAGG - Intronic
1004733378 6:18380802-18380824 CCTTATGTTTGCAAGGTTTACGG - Intergenic
1005209176 6:23441008-23441030 CCCTATTTTTATTAGATTCAGGG + Intergenic
1005636328 6:27756958-27756980 CTTAATTTTTAGAAGCTTCCAGG + Intergenic
1006835187 6:36994370-36994392 CCCTTTATTTTGAAGGTTCAGGG + Intergenic
1006976600 6:38108218-38108240 GCTTATTTTCAGATGGTTCTGGG + Intronic
1007696043 6:43734757-43734779 CCTCACTTCTAGCAGGTTCAGGG + Intergenic
1010843947 6:80681697-80681719 CTTTATTTTTAGAAGATTGTGGG + Intergenic
1014012852 6:116496249-116496271 CCTTTATTTTAGAAGTTTCCTGG + Intronic
1014337721 6:120158729-120158751 ACTCATTTCAAGAAGGTTCAAGG - Intergenic
1014986766 6:128021152-128021174 CCTTATTTTTAAATGGTTCTTGG + Intronic
1015998533 6:139019141-139019163 CATTATTTCTAGAATTTTCATGG - Intergenic
1016052132 6:139540692-139540714 CAATATTTTTAGAATGTTCTGGG + Intergenic
1016301934 6:142642238-142642260 GCTTATTTTAAGAAGGGACAAGG + Intergenic
1016481085 6:144482614-144482636 CCTAATTATCAGAAGGTTCTTGG + Intronic
1017369686 6:153690462-153690484 CCCTAATTTTAGTTGGTTCAGGG + Intergenic
1018291616 6:162297747-162297769 ATTTATTTTTAGATGATTCAAGG - Intronic
1018352860 6:162980103-162980125 CATACTCTTTAGAAGGTTCAAGG + Intronic
1018490503 6:164287833-164287855 CCCTAATTTTAGGAGGTCCAAGG - Intergenic
1021137873 7:16987780-16987802 CCATATTTTTAGTTGTTTCATGG + Intergenic
1021596280 7:22320423-22320445 CCTCATTTTTAGCAGGTACTGGG + Intronic
1022163639 7:27736944-27736966 CCTGATTTTAAGCAGTTTCAGGG + Intergenic
1023305794 7:38825624-38825646 ATTTTTTTTTAGCAGGTTCAGGG - Intronic
1026215507 7:68344867-68344889 CAGTATTTTTAGCAGGCTCATGG + Intergenic
1026277820 7:68895571-68895593 TTTTATTTTTAGATGGATCATGG - Intergenic
1027412417 7:77935035-77935057 AATTTTTTTTAAAAGGTTCAGGG - Intronic
1027461753 7:78463076-78463098 CCTTTTTCTTCAAAGGTTCAAGG - Intronic
1027690445 7:81338223-81338245 GTTTACTTTGAGAAGGTTCAGGG - Intergenic
1031648537 7:124257039-124257061 CTTTATTTTTAGAATGTTTTTGG + Intergenic
1034755731 7:153617389-153617411 CCGTATTTTTTGAAGATTTAAGG - Intergenic
1036543970 8:9748644-9748666 CCTGGTTTTCAGAAAGTTCACGG - Intronic
1038167064 8:25095825-25095847 CATTATTTCCAAAAGGTTCATGG - Intergenic
1038544846 8:28417879-28417901 AAATATTTTTAGAAGATTCATGG - Intronic
1038921018 8:32084373-32084395 CCTTATTTATAGAACTTTCCTGG - Intronic
1039515146 8:38126416-38126438 CTTAATTTTAAGAAGGTCCATGG + Intronic
1044647189 8:94456490-94456512 ACTTATTTTCAAAAGGTTGAGGG + Intronic
1046837116 8:118814300-118814322 CATTATTTTTAGAAGAGACAAGG - Intergenic
1048092879 8:131260225-131260247 GCTTATTTTTAGATGATTTAAGG - Intergenic
1052252513 9:26415500-26415522 CCTTGTTTTTGGCAGGTACAGGG + Intergenic
1052917444 9:33934394-33934416 CCTGGGTTTTAGAAGGGTCAAGG - Intronic
1053140962 9:35682421-35682443 CCTCTTCTTTAGAAGGTTTAAGG + Intronic
1055661222 9:78505956-78505978 CCTTGATTTGAGAAGATTCATGG + Intergenic
1056341775 9:85641869-85641891 TCTTATTTTTAGAAGAAACAGGG + Intronic
1056496937 9:87165784-87165806 CCTTATTTTTGGAAAGTTCAAGG + Intergenic
1056745828 9:89301272-89301294 CCTCTTTTTCAGATGGTTCAGGG - Intergenic
1058131263 9:101256461-101256483 CCATATTTTTCGAGGGTTCAGGG + Intronic
1061442656 9:130616897-130616919 ATTTACTTTTTGAAGGTTCAGGG + Intronic
1187267104 X:17745012-17745034 TCTTATTTTTAAAAGTTTTAAGG + Intronic
1191835947 X:65462208-65462230 CCTCATTTTTAAAAACTTCAAGG + Intronic
1191944420 X:66516089-66516111 TCTGATTTTTAGAAAGGTCATGG + Intergenic
1195148254 X:102040178-102040200 ACTAATTTTTATAAGGTTTAAGG - Intergenic
1195796405 X:108653175-108653197 CTTTATTTTTAAAAGGTACTTGG + Intronic
1196102426 X:111860824-111860846 CCTCTTTTTTGGATGGTTCAGGG + Intronic
1196767528 X:119261591-119261613 CATTATTTTAAGTAGCTTCATGG + Intergenic
1197957708 X:131970661-131970683 CCTAATATTTTGAAGGTTCCAGG - Intergenic
1199994569 X:153013321-153013343 GATTTTTTTTAGAAGGTTAAAGG - Intergenic
1201996071 Y:20091009-20091031 CCTTACTTCTGGCAGGTTCATGG + Intergenic
1201998741 Y:20126004-20126026 TCTTCCTTTTGGAAGGTTCATGG + Intergenic
1202004367 Y:20201150-20201172 TCTTCCTTTTAGCAGGTTCATGG + Intergenic
1202005865 Y:20270819-20270841 TCTTCTTTCTGGAAGGTTCATGG + Intergenic
1202006808 Y:20283537-20283559 TCTTCTTTCTGGAAGGTTCATGG + Intergenic
1202007831 Y:20297157-20297179 CCTTACTTCTGGGAGGTTCATGG + Intergenic
1202007956 Y:20298777-20298799 CCTTACTTCTGGGAGGTTCATGG + Intergenic
1202008200 Y:20302139-20302161 CCTTACTTCTGGGAGGTTCATGG + Intergenic
1202008314 Y:20303634-20303656 CCTTACTTCTGGGAGGTTCATGG + Intergenic
1202008438 Y:20305254-20305276 CCTTACTTCTGGGAGGTTCATGG + Intergenic
1202008981 Y:20312106-20312128 CCTTACTTCTGGGAGGTTCATGG + Intergenic
1202011009 Y:20338730-20338752 TCTTCCTTTTAGCAGGTTCATGG + Intergenic