ID: 998938654

View in Genome Browser
Species Human (GRCh38)
Location 5:147257204-147257226
Sequence GTAGTTGGTCCAATGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 9, 1: 29, 2: 51, 3: 48, 4: 84}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998938654_998938663 9 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938663 5:147257236-147257258 GCTCTACGTCGGGGGCGGGGCGG 0: 1
1: 0
2: 2
3: 12
4: 112
998938654_998938657 -1 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938657 5:147257226-147257248 CAGCATAAAAGCTCTACGTCGGG 0: 1
1: 6
2: 16
3: 43
4: 78
998938654_998938666 12 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938666 5:147257239-147257261 CTACGTCGGGGGCGGGGCGGGGG No data
998938654_998938665 11 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938665 5:147257238-147257260 TCTACGTCGGGGGCGGGGCGGGG No data
998938654_998938658 0 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938658 5:147257227-147257249 AGCATAAAAGCTCTACGTCGGGG 0: 1
1: 4
2: 28
3: 57
4: 57
998938654_998938661 5 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938661 5:147257232-147257254 AAAAGCTCTACGTCGGGGGCGGG 0: 1
1: 0
2: 2
3: 7
4: 34
998938654_998938662 6 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938662 5:147257233-147257255 AAAGCTCTACGTCGGGGGCGGGG 0: 1
1: 0
2: 1
3: 2
4: 35
998938654_998938660 4 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938660 5:147257231-147257253 TAAAAGCTCTACGTCGGGGGCGG No data
998938654_998938656 -2 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938656 5:147257225-147257247 ACAGCATAAAAGCTCTACGTCGG 0: 2
1: 8
2: 20
3: 38
4: 76
998938654_998938659 1 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938659 5:147257228-147257250 GCATAAAAGCTCTACGTCGGGGG 0: 1
1: 20
2: 31
3: 35
4: 43
998938654_998938664 10 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938664 5:147257237-147257259 CTCTACGTCGGGGGCGGGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 140
998938654_998938670 25 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938670 5:147257252-147257274 GGGGCGGGGGGTAGGACTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 304
998938654_998938667 13 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938667 5:147257240-147257262 TACGTCGGGGGCGGGGCGGGGGG 0: 1
1: 0
2: 1
3: 56
4: 486
998938654_998938669 24 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938669 5:147257251-147257273 CGGGGCGGGGGGTAGGACTCTGG No data
998938654_998938668 17 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938668 5:147257244-147257266 TCGGGGGCGGGGCGGGGGGTAGG 0: 1
1: 4
2: 39
3: 382
4: 3000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998938654 Original CRISPR GTAGTTGGTCCAATGTTCTG TGG (reversed) Intronic
901946332 1:12706999-12707021 GTAGTTGGTCCAACGTTCTGTGG - Intergenic
902051988 1:13571011-13571033 GTAGTTGGTCCAATGTTCTGTGG + Intergenic
904712954 1:32444770-32444792 GTAATTGGTCAAACATTCTGTGG - Intergenic
904965623 1:34370207-34370229 GTAGTTGCTCCAGTGGTCTCTGG + Intergenic
905061149 1:35140154-35140176 ATAGTTGGTCCAACATTCTGTGG - Intergenic
906695146 1:47818430-47818452 ATAGTTTGTCCAATGCTCTTGGG + Intronic
910808071 1:91208387-91208409 GTAGTTGGTCCAACGTTCTGTGG - Intergenic
912816029 1:112829342-112829364 GTAGTTGGTCCAACGTTCTGTGG + Intergenic
912980410 1:114366014-114366036 GTAGTTGGTCCAACGTTCTGTGG - Intergenic
913658543 1:120984997-120985019 ATAGCTGGTCCAATATGCTGAGG - Intergenic
914009911 1:143768117-143768139 ATAGCTGGTCCAATATGCTGAGG - Intergenic
914648530 1:149676778-149676800 ATAGCTGGTCCAATATGCTGAGG - Intergenic
917311756 1:173685995-173686017 GTAGTTGGTCCAACATTCTGTGG - Intergenic
917329996 1:173870811-173870833 GAACTTGGTTCAATGATCTGAGG - Exonic
919364968 1:196648356-196648378 GGAGTTGCTAAAATGTTCTGTGG + Intergenic
921074646 1:211690521-211690543 ATAGTTGGACCAACGTTCTGTGG + Intergenic
922680764 1:227593439-227593461 ATAGCTGGTCCAACATTCTGTGG - Intronic
922690161 1:227682665-227682687 ATAGTTGGTCCAACATTCTGTGG + Intergenic
923535557 1:234848608-234848630 GTAGTTTTTCCAAGGTTGTGTGG + Intergenic
924859064 1:247902383-247902405 ATAGTTGGTCCAATGTTCTGTGG - Intergenic
1064756517 10:18576435-18576457 ATAGTTGGTCCAACATTCTGTGG + Intronic
1064918660 10:20490908-20490930 GTGGTTTTTCCACTGTTCTGTGG + Intergenic
1065931012 10:30479132-30479154 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1068514107 10:58004835-58004857 TTAGTTGATAAAATGTTCTGTGG - Intergenic
1068671791 10:59730529-59730551 ATAGTTGGTCCAACGTTCTGTGG - Intronic
1068675790 10:59768006-59768028 ATAGTTGGTCCAACATTCTGTGG - Intergenic
1069195246 10:65543492-65543514 TTATTAGGTCCCATGTTCTGAGG - Intergenic
1069939252 10:71943143-71943165 ATAGTTGGTCCAATGTTCTGTGG + Intergenic
1071283124 10:84120735-84120757 ATAGTTGGTCCAACATTCTGTGG - Intergenic
1072334806 10:94388536-94388558 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1073589909 10:104747132-104747154 AACGTTGGTCCATTGTTCTGTGG + Intronic
1079656773 11:22994802-22994824 GTAGATGGTCTAATGTTCTATGG - Intergenic
1080629318 11:34058934-34058956 GTAGTTGGTTCCTTTTTCTGGGG + Intronic
1085239787 11:75043743-75043765 GTAGTTGGTCCAATGTTCTGTGG + Intergenic
1086973457 11:93107569-93107591 GTTGTTGGTCCAATGTTCTGTGG - Intergenic
1087456798 11:98396760-98396782 GTAGTTGGTCCAATGTTCTGTGG - Intergenic
1087684520 11:101248229-101248251 ATAGTTGGTCCAACGTTCTGTGG + Intergenic
1087894814 11:103575725-103575747 ATAGTCAGTCCAACGTTCTGTGG + Intergenic
1091814512 12:3426405-3426427 ATAGTTGGTCCAACGTTCTGTGG - Intronic
1095162348 12:38933158-38933180 GCAACTGGTCCAATGTTCTGTGG - Intergenic
1096050172 12:48600535-48600557 GAAGTTGGTCCAATGTTCTATGG + Intergenic
1096207723 12:49737455-49737477 GTAGTTGGTCCAACATTCTATGG + Intronic
1097718379 12:62993029-62993051 GTAGTTGTTCCTCTGTTCTTGGG + Intergenic
1098248398 12:68543901-68543923 ATAGTTGGTCCAACATTCTGTGG + Intergenic
1102277548 12:111595076-111595098 GTAGTTTGTCAAATATTGTGGGG - Intronic
1102606389 12:114070958-114070980 GTAGTTGGTCTGATGTTCTGTGG + Intergenic
1104677389 12:130721460-130721482 GTTGTGGGTCCAATTTTGTGGGG + Intergenic
1105569473 13:21588084-21588106 ATAGTTGGTCCAACGTTCTGCGG + Intronic
1106940740 13:34776454-34776476 GTAGTTTGTCCAAAGTTATGTGG - Intergenic
1108115813 13:47126662-47126684 GAAATTGGTCAAATGTGCTGTGG - Intergenic
1109909492 13:68890945-68890967 GTAATTGGTCCAACGTTCTGTGG - Intergenic
1110653704 13:77972482-77972504 ATAGTTGGTCCAACATTCTGTGG - Intergenic
1111132361 13:83993645-83993667 GTAGTTGTTCCACAGTTCTTGGG - Intergenic
1114006838 14:18322787-18322809 GTTGTTGTTCCACTGTCCTGAGG - Intergenic
1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG + Intergenic
1114223497 14:20717762-20717784 ACAGTTGGTCCAACATTCTGTGG - Intergenic
1114236082 14:20824896-20824918 GTAGTTGGTCCAACGTTCTGTGG - Intergenic
1114876211 14:26722036-26722058 GGAGATAGTCCAATGTCCTGAGG - Intergenic
1115211370 14:30970348-30970370 GTAGTTGGTCCAACGTTCTGTGG + Intronic
1115749409 14:36473951-36473973 CTATTTGGTTCATTGTTCTGAGG - Intronic
1117179538 14:53177935-53177957 ATAGTTGGTCCAACATTCTGTGG - Intergenic
1117955192 14:61117420-61117442 ATAGTTGGTCCAATATTCTGTGG - Intergenic
1118173385 14:63411823-63411845 GTATTTGGTTCATTGTTCTTCGG - Intronic
1120922462 14:89767327-89767349 GTGGTTGGGCCAATGATCTCTGG - Intergenic
1124934440 15:34156920-34156942 GTAGTTGGTCCAACATTCTGTGG - Intronic
1125309155 15:38359830-38359852 CTAGTTGGTCCTAGGTCCTGCGG - Intergenic
1126236783 15:46394837-46394859 GGAGCTGGTGCAGTGTTCTGGGG - Intergenic
1128461210 15:67869135-67869157 TCAGTTGGTCCGAAGTTCTGAGG + Intergenic
1136157643 16:28394965-28394987 TTAGTTGAATCAATGTTCTGAGG - Intronic
1136205444 16:28720319-28720341 TTAGTTGAATCAATGTTCTGAGG + Intronic
1144524227 17:15976634-15976656 CTAGGTGTTGCAATGTTCTGTGG - Exonic
1146250873 17:31342843-31342865 GTAGTAGCTAAAATGTTCTGTGG + Intronic
1146764165 17:35504300-35504322 GTAGTTGGTCCAATGTTCTGTGG + Intronic
1147810303 17:43164256-43164278 GTAGTTGGTCCAACGTTCTGTGG - Intergenic
1148828960 17:50416768-50416790 GTAGTTGGTCCAACATTCTGTGG - Intergenic
1149079935 17:52643182-52643204 GGGGTTGGTCCAATTTTATGAGG + Intergenic
1150837675 17:68579183-68579205 GGAGGTGATCCAATGTGCTGGGG + Intronic
1152454951 17:80409439-80409461 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1153357846 18:4157607-4157629 GTAGTTGAACCAGTGTTTTGTGG + Intronic
1153826375 18:8878752-8878774 ATAGTTGGTCCAACATTCTGTGG - Intergenic
1153830389 18:8917340-8917362 ATAGTTGGTCCAACATTCTGTGG + Intergenic
1154014128 18:10601456-10601478 TTAGTTGGTCCAATGTTCTGTGG - Intergenic
1154091339 18:11366498-11366520 GTATTTGGTTCAATTCTCTGCGG + Intergenic
1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG + Intergenic
1159812122 18:73028258-73028280 GTAGTTGTTCCACAGTTCTTGGG - Intergenic
1162267804 19:9590147-9590169 GTAGTTGGTCCAACGTTCTGTGG - Intergenic
1162281903 19:9705477-9705499 ATAGTTGGTCCAACGTTCTGTGG + Intergenic
1163867086 19:19782545-19782567 GTAGTTGGTCCAACATTCTGTGG - Intergenic
1163991854 19:21006319-21006341 ATAGTTGGTCCAACATTCTGTGG + Intergenic
1164121564 19:22269913-22269935 ATAGCTGGTCCAACTTTCTGTGG - Intergenic
1164130719 19:22358844-22358866 ATAGTTGATCCAACATTCTGTGG - Intergenic
1164216954 19:23158935-23158957 ATAGTTGGTCCAACGTTCTTTGG - Intergenic
1166069875 19:40380815-40380837 GTAGGGGGTCCCATCTTCTGCGG + Exonic
926491449 2:13530021-13530043 ATAGTTGGTCCAACGTTCTGTGG - Intergenic
926614085 2:14977664-14977686 GTAGTTGGTCCAAGGTATGGTGG + Intergenic
930770155 2:55122472-55122494 ATAGTTGGTTTAATGTCCTGTGG + Intergenic
933389460 2:81652053-81652075 ATAGTTGGTCCAACCTTCTGTGG - Intergenic
933634379 2:84691537-84691559 GGAGTTGGCCAAAAGTTCTGGGG + Intronic
935048421 2:99502605-99502627 CTAGTTGGTCCAATGTTCTGTGG + Intergenic
935317101 2:101845852-101845874 GTTGTTGGCCCATTTTTCTGGGG - Intronic
935672811 2:105570337-105570359 GGGGTTGGTACAATGTTCAGAGG - Intergenic
935721484 2:105983163-105983185 ATAGTTGGTCCAACGTTCTGTGG - Intergenic
935970591 2:108527399-108527421 ATAGTTGGTCCAACGTTCTGTGG + Intergenic
936419591 2:112350491-112350513 ATAGTTGGTCCAACGTTCTGTGG - Intergenic
938703168 2:133897450-133897472 GTAGTTGGTCCAATGTTCTGTGG + Intergenic
943408095 2:187514062-187514084 ATAGTTGGTCCAACATTCCGTGG + Intronic
943743162 2:191433239-191433261 GTGATTGGTCCAAGGTTTTGTGG + Intergenic
945289742 2:208115477-208115499 GCAGTTTGTCCAACATTCTGTGG + Intergenic
945720290 2:213410499-213410521 GTAGTTGGTCCAACGTTCTGTGG + Intronic
1168824205 20:798362-798384 ATAGTTGGTCCAAAGTTCTGTGG + Intergenic
1173277573 20:41597998-41598020 ATAGCTGGTCCAATGTTCTATGG + Intronic
1176811280 21:13540733-13540755 GCAGTTGGTCCAACGTTCTGTGG - Intergenic
1178147178 21:29753565-29753587 GGAGTTGGTAAAATTTTCTGTGG - Intronic
1179670879 21:42946811-42946833 ATAGTTGGTCCAACGTCCTGTGG - Intergenic
1180431347 22:15253597-15253619 GTTGTTGTTCCACTGTCCTGAGG - Intergenic
1181925263 22:26353553-26353575 GGATTTGGCCCAAGGTTCTGGGG - Intronic
949242679 3:1890657-1890679 GTAGCTGATCCAATGTTCTATGG + Intergenic
949776227 3:7635592-7635614 GGAGTTGTTCCACTGATCTGAGG + Intronic
950594286 3:13965213-13965235 ATAGTTGGTCCAACGTTCTGTGG - Intronic
950846135 3:16017736-16017758 GTACTTGGTCCAGTGTTCTGTGG - Intergenic
951248546 3:20368036-20368058 ATAGTTGGTCCAACGTTCTGTGG - Intergenic
954604747 3:51900650-51900672 ATAGTTGGTCCAGGGTTCTGTGG + Intronic
957999914 3:87737628-87737650 ATAGTTGGTCCAACATTCTATGG - Intergenic
960720353 3:120619166-120619188 ATAGTTGGTCCAATGTTCTTTGG - Intergenic
961143868 3:124578073-124578095 GAAGTTGGTTTAATTTTCTGTGG - Intronic
962096741 3:132300128-132300150 ATAGTTGGTCCAATGTTCTGTGG - Intergenic
962097375 3:132306339-132306361 ATAGTTGGTCCAACATTCTGTGG + Intergenic
962164584 3:133036031-133036053 GGTGTTGGTAGAATGTTCTGAGG + Intergenic
962277073 3:134023561-134023583 ATAGTTGGTCCAATGTTCTGTGG + Intronic
963441949 3:145351694-145351716 GTGGTTGATCCAATTTTCTATGG + Intergenic
964933012 3:162048580-162048602 ATAGTTGGTCCAATGTTCTGTGG - Intergenic
970092599 4:12427180-12427202 GTAGTTGGTCCAATGTTCTGTGG - Intergenic
972217061 4:36909307-36909329 ATAGTTGGTCCAACGTTCTGTGG + Intergenic
972991220 4:44824169-44824191 ATAGTTGGTCCAACGTTCTGTGG - Intergenic
974511634 4:62850169-62850191 GTTGTCTGTTCAATGTTCTGTGG + Intergenic
975205647 4:71641922-71641944 GTAGTTGGTCCAACATTCTGTGG + Intergenic
976647026 4:87397525-87397547 GTAATTTGTCGAATGTTCTATGG + Intergenic
977043567 4:92042462-92042484 GTAGTTGGTCCAACATTCTGTGG - Intergenic
977972382 4:103227381-103227403 GTAGTTGGTCTAACGTTCTGTGG + Intergenic
978314184 4:107417718-107417740 ATAGTTAGTCCAACATTCTGTGG + Intergenic
980073004 4:128263596-128263618 ATAGTTGGCCCAACGTTCTGTGG + Intergenic
980438790 4:132814794-132814816 GTAGTTTGTCCAACGTTGTGTGG - Intergenic
983708444 4:170686768-170686790 ATAGTTGGTCCAATGTTCTGTGG + Intergenic
983897978 4:173102183-173102205 ATAGTTGGTCCAACGTTCTGTGG + Intergenic
987930535 5:24394885-24394907 ATAGTTGGTCCAACATTCTGTGG - Intergenic
989613523 5:43317384-43317406 GTAGTTGGTCCAACGTTCTGTGG - Intergenic
990969156 5:61484103-61484125 GAATTTGGTCCAGTCTTCTGTGG - Intronic
991306083 5:65177570-65177592 GTAGTTGGTCCAACATTCTGTGG + Intronic
995867433 5:116706652-116706674 ATAGTTGGTCCAACATTCTGTGG + Intergenic
997649703 5:135507238-135507260 GTAGTTGGTTCCTTGTCCTGTGG + Intergenic
998552480 5:143090776-143090798 GTAGTTGGTCCAATGTTCTGCGG - Intronic
998617499 5:143756672-143756694 GTAGTTGGTCCACTTTTATATGG - Intergenic
998938654 5:147257204-147257226 GTAGTTGGTCCAATGTTCTGTGG - Intronic
1000236830 5:159369805-159369827 ATAGTTGGTCCAACGTTCTGTGG + Intergenic
1000943511 5:167392303-167392325 GTAGCTGGTTAAATGTTCTCTGG + Intronic
1001558436 5:172652560-172652582 GTAGTTGGTCCAACGTTCTGTGG - Intronic
1002999114 6:2314452-2314474 GTAGTTGGTCCAACATTCTGTGG - Intergenic
1005461940 6:26077683-26077705 ATAGTTGGTCGAATGTTGTGTGG + Intergenic
1006325769 6:33352745-33352767 GTAGTCGGTCCAACGTTCTGTGG - Intergenic
1008123474 6:47644112-47644134 ATAGTTGGTCCAATGTTCTGTGG + Intergenic
1009635775 6:66262640-66262662 ATAGTTGGTCCAACATTCTGTGG + Intergenic
1011175591 6:84556460-84556482 GTATTTTGTCCAAAGTTATGTGG - Intergenic
1011570389 6:88728443-88728465 GTAGCTGGTCCAAAGTTCTGTGG + Intronic
1014654330 6:124080587-124080609 GTAGTTGGTACAATGTTTTTTGG - Intronic
1015171932 6:130263880-130263902 ATAGTTGGTCCAACATTCTGTGG + Intronic
1018191374 6:161311849-161311871 ATAGTTGGTCCAGCATTCTGTGG - Intergenic
1019051473 6:169186867-169186889 GTTGTGGGTGGAATGTTCTGTGG - Intergenic
1020043886 7:5025233-5025255 ATAGTTGGTCCAACGTTCTGTGG - Intronic
1020745434 7:12073204-12073226 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1021168986 7:17374904-17374926 GTAGTTGGGCCAAAGTTGTAGGG - Intergenic
1021849352 7:24792305-24792327 ATAATTGGTCCAACGTTCTGTGG - Intergenic
1023436337 7:40144042-40144064 GTAGTTTGTCCAACATTCTGTGG - Intronic
1023799112 7:43818095-43818117 ATAGTTGATCCAATGTTCTGTGG + Intergenic
1023799512 7:43821749-43821771 GTAGTTGGTCCTACATTCTGTGG + Intergenic
1024812949 7:53235015-53235037 ATAGTTGGTCCAATGTTCTGTGG + Intergenic
1028333988 7:89628800-89628822 ATAGTTAGTCCAACGTTCTGTGG + Intergenic
1029486100 7:100842532-100842554 ATAGTTGGTCCAATGTTCTGTGG + Intronic
1029822074 7:103156193-103156215 ATAGTTGGTCCAATGTTCTGTGG + Intergenic
1031203060 7:118716165-118716187 GTAGTTGTTCCAATTTACAGTGG + Intergenic
1032170559 7:129581166-129581188 ATAGTTGGTCCAACATTCTGTGG + Intergenic
1032536201 7:132666768-132666790 GTAGTTGGCAGAATGTTCTCGGG + Intronic
1035557718 8:579116-579138 GTCCTTGGTCCCATGTGCTGTGG - Intergenic
1037274506 8:17163237-17163259 GTGGTGGTTCCAGTGTTCTGTGG - Intronic
1038089670 8:24239253-24239275 CAAGTTGGTCCAACGTTCTGTGG + Intergenic
1040993394 8:53376144-53376166 ATAGTTGGTCCAACATTCTGTGG - Intergenic
1041227140 8:55711976-55711998 GTAGTTAGTCCAACATTCTGTGG + Intronic
1041515472 8:58694787-58694809 ATAGTTGGTCCAATGTTCTGTGG + Intergenic
1042087870 8:65128429-65128451 ATAGTTGGTCCAACGTTCTGTGG - Intergenic
1044184582 8:89236385-89236407 ATAGTTGGTCCAACGTTCTGTGG - Intergenic
1045435781 8:102162402-102162424 ATAGTTGGTGCAATTTTCTAGGG - Intergenic
1046164727 8:110417402-110417424 TGAGTTGGTCAAATGCTCTGAGG + Intergenic
1046837274 8:118816602-118816624 ATAGTTGGTCCCTTGGTCTGAGG - Intergenic
1048769343 8:137879052-137879074 GCAGTTTGTCCAATGTTGTCTGG - Intergenic
1052213354 9:25934083-25934105 TTAGTTGGTGCCATGTTCTTAGG - Intergenic
1052508091 9:29380830-29380852 ATAGTTGGTCCAACATTCTGTGG + Intergenic
1053110735 9:35457576-35457598 GTAGTTGGTCCAACGTTCTGTGG - Intergenic
1056414416 9:86362503-86362525 GTAGTTGGTCCTACGTTCTGTGG - Intergenic
1056483910 9:87034965-87034987 GTAGTTGGCCCAGTGTTTTCGGG - Intergenic
1057070885 9:92099058-92099080 TTAGTTGGGCCAATGTTATGAGG - Intronic
1187663384 X:21574778-21574800 GTAGATGATCCAGTTTTCTGTGG + Intronic
1188749039 X:33883368-33883390 GTAGATGGGGCAATGTTATGAGG + Intergenic
1189833867 X:45001394-45001416 GTAGTTAGTCCAACATTCTGTGG - Intronic
1190270270 X:48857734-48857756 GTACTTGGTCCAACATTCTGTGG + Intergenic
1190771222 X:53516384-53516406 ATAGTTGGTCCAAAGTTCTGTGG + Intergenic
1191639241 X:63412650-63412672 GTAGTTGGTCCAATGTTCTGTGG + Intergenic
1191917974 X:66222611-66222633 ATAGTTGGCCCAACATTCTGTGG - Intronic
1192915464 X:75646695-75646717 ATAGTTGGTCCAACATTCTGTGG - Intergenic
1193717336 X:84948397-84948419 ATAGTTGGTCCAACGTTCTGTGG + Intergenic
1195846846 X:109238108-109238130 ATAGTTGGTCCAACATTCTGTGG - Intergenic
1196422993 X:115541728-115541750 ATAGTTGGTCCAATGTTCTGTGG - Intergenic
1196460073 X:115920480-115920502 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1196869415 X:120098707-120098729 GTAGTTGGTCCAAAGTTCTGTGG + Intergenic
1198742481 X:139855897-139855919 GTAGTTGGTCCAGTGTTCTGTGG + Intronic
1198832249 X:140763428-140763450 GTAGTTGGTGCATTGTTCTTGGG + Intergenic
1199278622 X:145974283-145974305 ATAGTTGGTCCAACATTCTGTGG + Intergenic
1199638356 X:149835182-149835204 GTAGTTGGTCCAACGTTTTCTGG + Intergenic
1200763260 Y:7059043-7059065 ATAGTTGGTCCAATGATCTGTGG - Intronic
1200769246 Y:7108384-7108406 ATAGTTGGTCCAATGATCTGTGG + Intergenic
1200777116 Y:7179387-7179409 ATAGCTGGTCTAATGTTCTATGG - Intergenic
1201911939 Y:19141659-19141681 ATAGTTGGCCCAATGTTCTGTGG + Intergenic
1202093072 Y:21214410-21214432 GCAAATGGTACAATGTTCTGAGG - Intergenic