ID: 998938655

View in Genome Browser
Species Human (GRCh38)
Location 5:147257219-147257241
Sequence TAGAGCTTTTATGCTGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 10, 1: 30, 2: 50, 3: 41, 4: 147}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998938655_998938672 21 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938672 5:147257263-147257285 TAGGACTCTGGGTTGACATTGGG 0: 1
1: 0
2: 0
3: 10
4: 116
998938655_998938666 -3 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938666 5:147257239-147257261 CTACGTCGGGGGCGGGGCGGGGG No data
998938655_998938665 -4 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938665 5:147257238-147257260 TCTACGTCGGGGGCGGGGCGGGG No data
998938655_998938671 20 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938671 5:147257262-147257284 GTAGGACTCTGGGTTGACATTGG No data
998938655_998938663 -6 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938663 5:147257236-147257258 GCTCTACGTCGGGGGCGGGGCGG 0: 1
1: 0
2: 2
3: 12
4: 112
998938655_998938673 22 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938673 5:147257264-147257286 AGGACTCTGGGTTGACATTGGGG 0: 1
1: 0
2: 1
3: 18
4: 192
998938655_998938668 2 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938668 5:147257244-147257266 TCGGGGGCGGGGCGGGGGGTAGG 0: 1
1: 4
2: 39
3: 382
4: 3000
998938655_998938661 -10 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938661 5:147257232-147257254 AAAAGCTCTACGTCGGGGGCGGG 0: 1
1: 0
2: 2
3: 7
4: 34
998938655_998938662 -9 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938662 5:147257233-147257255 AAAGCTCTACGTCGGGGGCGGGG 0: 1
1: 0
2: 1
3: 2
4: 35
998938655_998938664 -5 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938664 5:147257237-147257259 CTCTACGTCGGGGGCGGGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 140
998938655_998938667 -2 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938667 5:147257240-147257262 TACGTCGGGGGCGGGGCGGGGGG 0: 1
1: 0
2: 1
3: 56
4: 486
998938655_998938670 10 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938670 5:147257252-147257274 GGGGCGGGGGGTAGGACTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 304
998938655_998938669 9 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938669 5:147257251-147257273 CGGGGCGGGGGGTAGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998938655 Original CRISPR TAGAGCTTTTATGCTGTAGT TGG (reversed) Intronic
901946333 1:12707014-12707036 TGGAGCTTTTATGCTGTAGTTGG - Intergenic
902051986 1:13570996-13571018 TAAAGCTTTTATGCCGTAGTTGG + Intergenic
904569933 1:31455797-31455819 CAGAGCTTCTCTGCTGAAGTTGG - Intergenic
904712956 1:32444785-32444807 TAGAGCTTTTATGCCGTAATTGG - Intergenic
905061151 1:35140169-35140191 TAGAGCTTTCATGCCATAGTTGG - Intergenic
905848864 1:41258106-41258128 TAGAGCTGCTGTGCTGTACTGGG + Intergenic
909502043 1:76345527-76345549 TAGAGCTGCTATACTGTGGTAGG - Intronic
910437047 1:87215989-87216011 TAGACATTTTATCCTGTATTAGG + Intergenic
910808073 1:91208402-91208424 GAGAGCTTTCATGCCGTAGTTGG - Intergenic
910852953 1:91666523-91666545 TAGAGCTTTCATGCCATAGTTGG - Intergenic
911245610 1:95513018-95513040 TACCCCTTTTTTGCTGTAGTTGG - Intergenic
912816027 1:112829327-112829349 TAGAGCTTTTATGCCGTAGTTGG + Intergenic
912980412 1:114366029-114366051 TAGAGCTTTTATGCCGTAGTTGG - Intergenic
915500853 1:156316193-156316215 TATAGCATTTATGCTATATTAGG + Intronic
917311757 1:173686010-173686032 TAGAGCTTTTATGCTGTAGTTGG - Intergenic
919522856 1:198610745-198610767 TAAAGCTTTTATGATTTAGCTGG + Intergenic
920677391 1:208047858-208047880 TGCGGCCTTTATGCTGTAGTGGG + Intronic
920750491 1:208670156-208670178 TAAAGCTTTTATACTCTAGTTGG + Intergenic
922680766 1:227593454-227593476 TAGAGCTTTCATGCCATAGCTGG - Intronic
922690159 1:227682650-227682672 TAGAGCTTTCATGCCATAGTTGG + Intergenic
924605450 1:245530664-245530686 TAAAGCTCTTCAGCTGTAGTGGG + Intronic
1063838533 10:10044146-10044168 TAATGCTTTTATGCTGTACCTGG - Intergenic
1064756515 10:18576420-18576442 TAGAGCTTTTATGCCATAGTTGG + Intronic
1065931010 10:30479117-30479139 TAGAGCTTTTATGCCGTAGTTGG + Intergenic
1068671793 10:59730544-59730566 TAGAACTTTCATGCCATAGTTGG - Intronic
1069939250 10:71943128-71943150 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1071283126 10:84120750-84120772 TAGTGCTTTTATGCCATAGTTGG - Intergenic
1072334805 10:94388521-94388543 TAGAGCTTTTATGCTGTAGTTGG + Intergenic
1072827720 10:98625284-98625306 TAGATCTTTCATGTTGTAATAGG - Intronic
1075893978 10:125978610-125978632 TAGAGCAGCTATGCTGTACTGGG + Intronic
1079170285 11:18087378-18087400 TAGAGCTTTTATATTCTAATAGG + Intronic
1080324893 11:31059447-31059469 TAGCTGTTTTATGCTGTATTTGG - Intronic
1083082195 11:60105439-60105461 TAGAGCTTTTATGCCATAGTTGG - Intergenic
1083089896 11:60189105-60189127 TAGAACTTTTATGCCATAGTTGG + Intergenic
1085239786 11:75043728-75043750 TAGAGCTTTTATGCTGTAGTTGG + Intergenic
1086973459 11:93107584-93107606 TAGAGCTTTTATGCCGTTGTTGG - Intergenic
1086987564 11:93266933-93266955 CAGAGCTTCTCTGCTGAAGTTGG + Intergenic
1087456799 11:98396775-98396797 TAGAGCTTTTATGTTGTAGTTGG - Intergenic
1087684518 11:101248214-101248236 TAGAGCTTTCATGCCATAGTTGG + Intergenic
1088705726 11:112462556-112462578 TATAGCATTTATACTGTATTAGG - Intergenic
1089722215 11:120436683-120436705 TACAGCATTTATGCTGTATTAGG + Intronic
1089907444 11:122055681-122055703 TAAAGTTCTTATGCTGGAGTTGG + Intergenic
1091814514 12:3426420-3426442 TAGAGCTTTTATGCCATAGTTGG - Intronic
1093196373 12:16134154-16134176 AATGGCTTTTAAGCTGTAGTAGG - Intergenic
1093594109 12:20941113-20941135 TAGAGCATTTATGCCATAGTTGG - Intergenic
1094260951 12:28498873-28498895 TAGAGCTTATATTTTATAGTAGG - Intronic
1096207722 12:49737440-49737462 TAGAGCTTTTATGCTGTAGTTGG + Intronic
1098239852 12:68456033-68456055 TAGAGCTTTTATCCTGTTACAGG - Intergenic
1098248396 12:68543886-68543908 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1098808292 12:75050157-75050179 TAGAGTTTTCCTGCTTTAGTGGG - Intronic
1099444571 12:82736875-82736897 TAGAGCTTTTAAGACATAGTAGG + Intronic
1099847768 12:88050960-88050982 TAGAACTTTTGTGCTATATTTGG - Intronic
1100260241 12:92926578-92926600 TTCAGCTTTTATCTTGTAGTTGG - Intronic
1102606387 12:114070943-114070965 TAGAGCTTTTATGCCGTAGTTGG + Intergenic
1103174593 12:118851608-118851630 TTGATTTTTTATGTTGTAGTAGG + Intergenic
1105225658 13:18429235-18429257 CAGAGCTTTTATGATGTAGTTGG + Intergenic
1105569471 13:21588069-21588091 TAGAGCTTTTATGCCATAGTTGG + Intronic
1106768170 13:32936820-32936842 CAGAATTTTTATTCTGTAGTGGG - Intergenic
1108843379 13:54649465-54649487 TAAAGCATTTATGTTGTATTAGG + Intergenic
1109909493 13:68890960-68890982 TAGAGCTTTTATGCTGTAATTGG - Intergenic
1110080228 13:71300227-71300249 TTTATCTTTTATGCTGCAGTGGG - Intergenic
1110605610 13:77428487-77428509 TAGTGCTCTAATGCTGTAGATGG + Intergenic
1110653706 13:77972497-77972519 TAGAGCTTTTATGCCATAGTTGG - Intergenic
1114010116 14:18357587-18357609 CAAAGCTTTTATGACGTAGTTGG + Intergenic
1114146118 14:19980056-19980078 CTGAGTTTTTATGCTGCAGTTGG + Intergenic
1114206876 14:20580189-20580211 TAGAGCTTTTATGATGTGCTAGG - Intergenic
1114223499 14:20717777-20717799 CAGAGCTTTTATGCCACAGTTGG - Intergenic
1114236084 14:20824911-20824933 TAGAGCTTTTATGCCGTAGTTGG - Intergenic
1115211368 14:30970333-30970355 TAGAGCTTTTATGCCGTAGTTGG + Intronic
1115856205 14:37632631-37632653 CAGAGCTCTTGTGCTGTACTGGG + Intronic
1117179540 14:53177950-53177972 TACAGCTTTTATGCCATAGTTGG - Intergenic
1117911117 14:60638723-60638745 TAGAGATTTTCTGTTTTAGTAGG - Intergenic
1117955194 14:61117435-61117457 TAGAGCTTTCATGCCATAGTTGG - Intergenic
1124913521 15:33946404-33946426 TAGAGATTTTCTGCTGGTGTTGG - Intronic
1124934441 15:34156935-34156957 CAAAGCTTTTATGCTGTAGTTGG - Intronic
1125268699 15:37914370-37914392 TAAAGCTTTTAAGGTATAGTTGG - Intergenic
1125690327 15:41591011-41591033 TAGAGCTTTTATGCCGTAGTTGG + Intergenic
1126587252 15:50301172-50301194 TTGGGATTTTATGCTTTAGTAGG - Intronic
1126724468 15:51617435-51617457 CAGAGCATTTATGAAGTAGTGGG - Intronic
1129809524 15:78496859-78496881 TAGAGCTCTTATGATGTGGTAGG + Intronic
1137041601 16:35617681-35617703 TAGAGCTTTTATGCTGTAGTTGG - Intergenic
1138801430 16:60035143-60035165 TATAGCTTTTAAACTGTTGTAGG - Intergenic
1146739737 17:35272567-35272589 TTGACCTTTTATGCTGTTTTTGG - Exonic
1146764164 17:35504285-35504307 GAGAGTTTTTATGCTGTAGTTGG + Intronic
1147810305 17:43164271-43164293 TAGAGTTTTTATGCCGTAGTTGG - Intergenic
1148828962 17:50416783-50416805 TAGAGCTTTTATGCCGTAGTTGG - Intergenic
1151737961 17:75957371-75957393 TAGAGCTTTTATGATAATGTCGG - Intronic
1152454949 17:80409424-80409446 TAGAGCTTTTATGCCGTAGTTGG + Intergenic
1153826377 18:8878767-8878789 TAGTGCTTTTATGCCATAGTTGG - Intergenic
1153830387 18:8917325-8917347 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1154014130 18:10601471-10601493 TAGAGCTTTAATGCCTTAGTTGG - Intergenic
1154463242 18:14617625-14617647 TAGAGCTTTTATGCTGCAGTTGG + Intergenic
1154527718 18:15310286-15310308 CAGAGCTTTTATGACATAGTTGG - Intergenic
1156564423 18:38168967-38168989 TATAGCATTTATATTGTAGTAGG + Intergenic
1159353329 18:67301966-67301988 TACAGGTTTTATACTGCAGTTGG + Intergenic
1162267806 19:9590162-9590184 TAGAGCTTTTATGCCGTAGTTGG - Intergenic
1162281901 19:9705462-9705484 TAGAGCTTTCATGCCATAGTTGG + Intergenic
1163867087 19:19782560-19782582 TAGAGCTTTTATGCTGTAGTTGG - Intergenic
1163991852 19:21006304-21006326 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1164121566 19:22269928-22269950 TAGAGCTTTTATGCCATAGCTGG - Intergenic
1164216956 19:23158950-23158972 TAGAACTTTTATGCCATAGTTGG - Intergenic
926987389 2:18639586-18639608 TAGAGCGTCTGTGCTGTATTGGG + Intergenic
930501171 2:52220250-52220272 TAGAGCATTTCTGATGAAGTAGG - Intergenic
931809237 2:65838400-65838422 AAGAACTTTTCTTCTGTAGTAGG + Intergenic
931829524 2:66036358-66036380 TATAGCATTTATACTGTATTAGG - Intergenic
932426811 2:71643002-71643024 TAGAGCTTATCTGGTTTAGTGGG - Intronic
933389462 2:81652068-81652090 TAGAGCTTTTATGCCATAGTTGG - Intergenic
935048418 2:99502590-99502612 TAGAGCTTTTATGCCCTAGTTGG + Intergenic
935721486 2:105983178-105983200 TAGAGCTTTTATGCCATAGTTGG - Intergenic
935958733 2:108403106-108403128 CAGAGCTTCTCTGCTGAAGTTGG + Intergenic
935970588 2:108527384-108527406 TAGACCTTTCATGCCATAGTTGG + Intergenic
936419594 2:112350506-112350528 TAGACCTTTCATGCCATAGTTGG - Intergenic
936490391 2:112965832-112965854 TATAGCATTTACGCTGTATTAGG - Intergenic
936746341 2:115581138-115581160 TAGAGCTTCTATGCTCTTGGTGG + Intronic
938036766 2:128041154-128041176 CAGAGCTTCTCTGCTGAAGTTGG + Intergenic
938703166 2:133897435-133897457 TAGAGCTTTTATGCCGTAGTTGG + Intergenic
940352827 2:152707753-152707775 CAGAGCTTTTATGCTGCAGTTGG + Intronic
941872405 2:170399648-170399670 TATCGCTTTTATGAAGTAGTTGG - Intronic
943408093 2:187514047-187514069 TAGAGCTTTTATGCCATAGTTGG + Intronic
943933082 2:193879754-193879776 TCAAACTTTTATTCTGTAGTTGG + Intergenic
944221131 2:197305663-197305685 TAGAGCTTATGTGCTGGCGTTGG + Intronic
944521967 2:200580118-200580140 TTAAGCTTTTTTGCTGTAATGGG + Intronic
945720289 2:213410484-213410506 TAGAGCTTTTATGCTGTAGTTGG + Intronic
947043049 2:225946385-225946407 TAGAGATTTTATCCTGCAGAAGG - Intergenic
949006872 2:241654718-241654740 CAGAGCTTTTCTGGTGTCGTGGG + Intronic
1168824203 20:798347-798369 TAGAGCTTTTAAGCCATAGTTGG + Intergenic
1168966295 20:1900397-1900419 TGTAGCTTTTATGCTGTTGGGGG + Intronic
1169433892 20:5567120-5567142 TAGGCCTTTTATGCAATAGTTGG - Intronic
1170377359 20:15714561-15714583 TAGAGCTTTTAGGCTTGATTAGG + Intronic
1173381869 20:42552105-42552127 TGAGGCTTTTATGCTGTTGTAGG - Intronic
1174219693 20:48944345-48944367 TTGAGCTCTTAGCCTGTAGTGGG + Intronic
1176769711 21:13058258-13058280 CAGAGCTTTTATGATGTAGTTGG + Intergenic
1176811281 21:13540748-13540770 TAGAGCTTTTATGCTGCAGTTGG - Intergenic
1178782506 21:35617537-35617559 TATAGCTTTTCTCCTGTAATGGG - Intronic
1179670881 21:42946826-42946848 TAGAGCTTTCATGCCATAGTTGG - Intergenic
1180434614 22:15288396-15288418 CAAAGCTTTTATGACGTAGTTGG + Intergenic
949610943 3:5702826-5702848 TAGAGCTTTTATGCTGTCATTGG - Intergenic
950594288 3:13965228-13965250 CAGAGCTTTTATGCCATAGTTGG - Intronic
950846137 3:16017751-16017773 TAGAGCTTTTATGCCGTACTTGG - Intergenic
951248547 3:20368051-20368073 TAGAGCTTTCATGCTATAGTTGG - Intergenic
951729561 3:25795691-25795713 AAGAACGTTTATGTTGTAGTGGG + Intergenic
954604743 3:51900635-51900657 TAGAGCTTTTATACCATAGTTGG + Intronic
957999916 3:87737643-87737665 TAGAGCTTTCATGCCATAGTTGG - Intergenic
960105478 3:113791358-113791380 TTGAGATTTTATTTTGTAGTAGG + Intronic
960189104 3:114681623-114681645 TAGAGGGTTTATGGAGTAGTGGG + Intronic
960720355 3:120619181-120619203 TAGAGCTTTTATGCCATAGTTGG - Intergenic
960901715 3:122560729-122560751 TAGTGCTCTGATGCTGTAGATGG - Intronic
961717890 3:128871163-128871185 AAGATATTTTATGTTGTAGTTGG - Intergenic
962096743 3:132300143-132300165 TAGAGCTTTCATGCCATAGTTGG - Intergenic
962097373 3:132306324-132306346 TAGAGCTTTTATGCCATAGTTGG + Intergenic
962277071 3:134023546-134023568 TAGAGCTTTCATGCCATAGTTGG + Intronic
964933014 3:162048595-162048617 TAGAGCTTTTATGCCATAGTTGG - Intergenic
965025147 3:163292155-163292177 TCAAACTTTTATGCTGTACTTGG + Intergenic
967341285 3:188401215-188401237 TAGAGCTTTTATCCTTGAATAGG - Intronic
970092601 4:12427195-12427217 CAGAGCTTTTATACCGTAGTTGG - Intergenic
970095325 4:12457492-12457514 TAGAGCTATTAAGTTGAAGTAGG + Intergenic
971105925 4:23524352-23524374 TAGAGCATCTATGCTGTGCTGGG - Intergenic
971146452 4:23981664-23981686 TACAGCATTTCTGCTGTATTAGG - Intergenic
972190226 4:36582464-36582486 TATAGCTATCAGGCTGTAGTAGG - Intergenic
972217059 4:36909292-36909314 TAGAGCTTTCATGCCATAGTTGG + Intergenic
972991222 4:44824184-44824206 TAGAGCTTTTATGCCATAGTTGG - Intergenic
974196732 4:58585083-58585105 CAGAGCTTAAATGCTGTACTAGG + Intergenic
974640707 4:64626129-64626151 TTGAGCTTTTTTGCTGTTGTTGG + Intergenic
975205646 4:71641907-71641929 TAGAGCTTTCATGCTGTAGTTGG + Intergenic
976855606 4:89601697-89601719 CATAGCTTTTACGTTGTAGTAGG + Intergenic
977043569 4:92042477-92042499 TAGAGCTCTTATGCCGTAGTTGG - Intergenic
977706445 4:100076178-100076200 TAGAGTTTTTATTCTGGTGTAGG + Intergenic
977914871 4:102580242-102580264 AAGAGCTTTTCTGATGTATTGGG - Intronic
977972381 4:103227366-103227388 TGGAGCTTTTATGCTGTAGTTGG + Intergenic
980073002 4:128263581-128263603 TAGAGCTTTTATGCCATAGTTGG + Intergenic
981062566 4:140441089-140441111 TAGACCTTTCACCCTGTAGTAGG - Intergenic
981261148 4:142720558-142720580 TATAGCGTTTACACTGTAGTAGG - Intronic
981912422 4:149996995-149997017 TAAAACTTTTAGGCTGTGGTAGG + Intergenic
982024019 4:151233975-151233997 TGCATCCTTTATGCTGTAGTTGG + Intronic
982288436 4:153758035-153758057 TGGAGCTTTCATGCTGAAGGAGG + Intronic
983483804 4:168309531-168309553 TAGAGCTTTTATGTGGGTGTGGG + Intronic
983708442 4:170686753-170686775 TAGAGCTTTTATGCCATAGTTGG + Intergenic
983897976 4:173102168-173102190 TAGAGCTTTCATGCCATAGTTGG + Intergenic
984018660 4:174457299-174457321 TAAGGCTTTTATTCTGTAGGAGG + Intergenic
984224467 4:177017840-177017862 CAGAGCTTAAATGCTGTACTGGG - Intergenic
984511773 4:180687276-180687298 TAGAGCTGTTAAGAAGTAGTTGG + Intergenic
986007490 5:3680314-3680336 CAGATCTTTTCTGCTGTAATTGG - Intergenic
987370769 5:17190955-17190977 AAGAGCTTTTAAACTGTGGTTGG + Intronic
987930537 5:24394900-24394922 TAGAGCTTTTATGCCATAGTTGG - Intergenic
988355367 5:30166897-30166919 GAGAGCTTTTATGCTATTGATGG - Intergenic
989096042 5:37782154-37782176 TAGAGCTTTTATGCCATAGTTGG - Intergenic
989613524 5:43317399-43317421 CAGAGCTTTTATGCTGTAGTTGG - Intergenic
990877957 5:60507976-60507998 TAGAGCCTGTATGGTTTAGTGGG + Intronic
991153114 5:63395716-63395738 TAGGACTTCTATGCTGAAGTTGG + Intergenic
991306082 5:65177555-65177577 TAGAGCTTTTATGCTGTAGTTGG + Intronic
995315696 5:110769829-110769851 TAGAGCCTTTTTGTTGTACTGGG - Intergenic
995867431 5:116706637-116706659 CAGAGCTTTCATGCCATAGTTGG + Intergenic
998552481 5:143090791-143090813 TAAAGCTTTTATGATGTAGTTGG - Intronic
998554620 5:143111127-143111149 TAGAGATTTTATACTGTTGGTGG + Intronic
998601302 5:143588046-143588068 TAATGCTTATATGCTGTGGTGGG + Intergenic
998938655 5:147257219-147257241 TAGAGCTTTTATGCTGTAGTTGG - Intronic
1000236828 5:159369790-159369812 TACAGCTTTTATGCCATAGTTGG + Intergenic
1001558438 5:172652575-172652597 TAGAGCTTTTATGCCGTAGTTGG - Intronic
1001819274 5:174696959-174696981 AAGAGCTAATATGCTTTAGTGGG - Intergenic
1002999116 6:2314467-2314489 TAGAGCTTTTATGCCGTAGTTGG - Intergenic
1003851518 6:10227824-10227846 TAGAGCTTTTATTGTGTGTTAGG - Intergenic
1005461938 6:26077668-26077690 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1006325771 6:33352760-33352782 TAGAGCTTTTATGCCGTAGTCGG - Intergenic
1008123473 6:47644097-47644119 TAGAGCTTTTATGCTATAGTTGG + Intergenic
1008258292 6:49332332-49332354 AAGATCATTTATGCTGTTGTTGG - Intergenic
1008338939 6:50341183-50341205 TATAGTTTTTATTCTGTAATAGG - Intergenic
1009635773 6:66262625-66262647 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1011570388 6:88728428-88728450 TAGAGCTTTTATGCTGTAGCTGG + Intronic
1011637332 6:89386344-89386366 TGAGGCTTTTCTGCTGTAGTTGG - Intronic
1015171930 6:130263865-130263887 TAGAGTTTTCATGCCATAGTTGG + Intronic
1015565370 6:134564536-134564558 TAGAGATTTTATTCTGTACATGG + Intergenic
1016041138 6:139432893-139432915 AAAAGCTTTTATACTCTAGTAGG - Intergenic
1016516949 6:144904485-144904507 TAGACTTTTTATGCTGAAGCTGG - Intergenic
1018191376 6:161311864-161311886 TACAGCTTTTATGCCATAGTTGG - Intergenic
1020043888 7:5025248-5025270 TAGAGTTTTCATGCCATAGTTGG - Intronic
1020655789 7:10926823-10926845 TAGAGCTTTTATGCTGTAGTTGG + Intergenic
1020745433 7:12073189-12073211 CAGAGCTTTTATGCTGTAGTTGG + Intergenic
1021849354 7:24792320-24792342 TACAGCTTTTATGCCATAATTGG - Intergenic
1023585873 7:41729260-41729282 TGGAGCTTTTCTTCTGGAGTTGG - Intergenic
1023799510 7:43821734-43821756 TGGAGCTTTTATGCCGTAGTTGG + Intergenic
1024812948 7:53235000-53235022 TAGAGCTTTTATGTCATAGTTGG + Intergenic
1027836030 7:83244268-83244290 AAAAGCTTTTCTGCTGTATTGGG - Intergenic
1028342406 7:89737790-89737812 TGTAGCTTTCATTCTGTAGTGGG - Intergenic
1028681443 7:93539048-93539070 TAGATCTTATATGCTTTATTCGG + Intronic
1029486098 7:100842517-100842539 TAGAGCTTTCATGCCATAGTTGG + Intronic
1029822072 7:103156178-103156200 TAGAGCTTTCATGCCATAGTTGG + Intergenic
1029849717 7:103448974-103448996 GAAAGCTTTTATGCTGTTGGTGG - Intergenic
1030809570 7:113957205-113957227 TAGAGCGGCTATGCTGTACTGGG + Intronic
1032170557 7:129581151-129581173 TAGAGTTTTTATGCCATAGTTGG + Intergenic
1033097536 7:138443866-138443888 TAGAGCTTTTATGCCGTAGTTGG - Intergenic
1033976667 7:147110986-147111008 GAAAGCTTTTATGCTGTTGGTGG - Intronic
1037355279 8:18012577-18012599 TAGATCTTTTCTTCTGGAGTTGG + Intronic
1039114494 8:34077186-34077208 AAGAGCTTTTCTGTTGAAGTGGG - Intergenic
1040993396 8:53376159-53376181 TAGAGCTTTCATGCCATAGTTGG - Intergenic
1041515470 8:58694772-58694794 TAGAGCTTTCATACCATAGTTGG + Intergenic
1042087872 8:65128444-65128466 TAGAGCTTTTATGCCATAGTTGG - Intergenic
1042108648 8:65355900-65355922 TAGAGCTTCTGTGCTGTGCTGGG + Intergenic
1042405612 8:68402038-68402060 TTGGGCTTTTATGTTGTTGTGGG + Intronic
1042828980 8:73006791-73006813 TAGTGCCTTTGTGCTGGAGTGGG - Intergenic
1043140933 8:76589610-76589632 TTTAGATTTTATGCTGTAGAAGG + Intergenic
1044184584 8:89236400-89236422 TAGAGCTTTTATGCCATAGTTGG - Intergenic
1047575670 8:126151721-126151743 TAGTCCTTTTTTACTGTAGTTGG - Intergenic
1048161201 8:132023696-132023718 TTGAGCTTTTATGGTGTACCTGG - Intergenic
1052647934 9:31261558-31261580 TAGAGCTTTTATGATGTGCCAGG - Intergenic
1053110737 9:35457591-35457613 TAGAGCTTTTATGCCGTAGTTGG - Intergenic
1053328986 9:37186502-37186524 TAGAGATTATATACTGTAATAGG + Intronic
1053705507 9:40749098-40749120 CAGAGCTTTTATGACGTAGTTGG - Intergenic
1054415583 9:64872705-64872727 CAGAGCTTTTATGACGTAGTTGG - Intergenic
1056414418 9:86362518-86362540 TAGAGCTTTTATGCCGTAGTTGG - Intergenic
1056966171 9:91164513-91164535 GAGTGGTTTTATGCTGCAGTAGG + Intergenic
1190270269 X:48857719-48857741 TAGAGCTTTTATGCTGTACTTGG + Intergenic
1190585978 X:51942761-51942783 GAATGCTTTTATGCTGTTGTTGG + Intergenic
1190718918 X:53130723-53130745 AAGAGCTTCTATGCTGCAATGGG + Intergenic
1190771220 X:53516369-53516391 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1190836591 X:54106930-54106952 TAACGCTTTTATGCTGTTGGTGG + Intronic
1191616239 X:63173146-63173168 TTGAGTATGTATGCTGTAGTGGG - Intergenic
1191620058 X:63205777-63205799 TTGAGTATGTATGCTGTAGTGGG + Intergenic
1191639239 X:63412635-63412657 TAGAGCTTTCATGCCGTAGTTGG + Intergenic
1191917976 X:66222626-66222648 TAGAGCTTTTATGCCATAGTTGG - Intronic
1192915466 X:75646710-75646732 TAGAGCTTTTATGCCATAGTTGG - Intergenic
1193717334 X:84948382-84948404 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1193852347 X:86554156-86554178 AAGAGTTTTGATGCTTTAGTTGG + Intronic
1195846847 X:109238123-109238145 TAGAGCTTTTATGCAATAGTTGG - Intergenic
1196135058 X:112199927-112199949 TTGAGCATTTATTCTGTGGTGGG + Intergenic
1196422995 X:115541743-115541765 TACAGCTTTCATGCCATAGTTGG - Intergenic
1196460071 X:115920465-115920487 TAGAGCTTTTATGCCGTAGTTGG + Intergenic
1196869413 X:120098692-120098714 TGGAGCTTTTATGCCGTAGTTGG + Intergenic
1197407961 X:126076810-126076832 TAGAGCTTTTATGGTGTTGGTGG - Intergenic
1197565052 X:128073083-128073105 TTGAGCTTTTTTGTTGTTGTTGG + Intergenic
1198112410 X:133513549-133513571 TAGTCCTTTTCTGCTGGAGTAGG + Intergenic
1198200634 X:134414171-134414193 TATAGCCTTTATGTTTTAGTAGG + Intronic
1198648611 X:138837193-138837215 TAGAGCTGCTATGCTGTGCTGGG + Intronic
1199278621 X:145974268-145974290 CAGAGCTTTTATGCAATAGTTGG + Intergenic
1199447593 X:147944073-147944095 TAGAGCTGATATTCTGGAGTTGG + Intronic
1199638355 X:149835167-149835189 TACAGCTTTTATGCAGTAGTTGG + Intergenic
1200763262 Y:7059058-7059080 TAGAGCTTTTATGCCATAGTTGG - Intronic
1200769244 Y:7108369-7108391 TAGAGCTTTTATGCCATAGTTGG + Intergenic
1201308908 Y:12576834-12576856 TAGAGCTTTTTTGCCATAGCTGG + Intergenic