ID: 998938666

View in Genome Browser
Species Human (GRCh38)
Location 5:147257239-147257261
Sequence CTACGTCGGGGGCGGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998938655_998938666 -3 Left 998938655 5:147257219-147257241 CCAACTACAGCATAAAAGCTCTA 0: 10
1: 30
2: 50
3: 41
4: 147
Right 998938666 5:147257239-147257261 CTACGTCGGGGGCGGGGCGGGGG No data
998938654_998938666 12 Left 998938654 5:147257204-147257226 CCACAGAACATTGGACCAACTAC 0: 9
1: 29
2: 51
3: 48
4: 84
Right 998938666 5:147257239-147257261 CTACGTCGGGGGCGGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998938666 Original CRISPR CTACGTCGGGGGCGGGGCGG GGG Intronic
No off target data available for this crispr