ID: 998938666 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:147257239-147257261 |
| Sequence | CTACGTCGGGGGCGGGGCGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998938655_998938666 | -3 | Left | 998938655 | 5:147257219-147257241 | CCAACTACAGCATAAAAGCTCTA | 0: 10 1: 30 2: 50 3: 41 4: 147 |
||
| Right | 998938666 | 5:147257239-147257261 | CTACGTCGGGGGCGGGGCGGGGG | No data | ||||
| 998938654_998938666 | 12 | Left | 998938654 | 5:147257204-147257226 | CCACAGAACATTGGACCAACTAC | 0: 9 1: 29 2: 51 3: 48 4: 84 |
||
| Right | 998938666 | 5:147257239-147257261 | CTACGTCGGGGGCGGGGCGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998938666 | Original CRISPR | CTACGTCGGGGGCGGGGCGG GGG | Intronic | ||
| No off target data available for this crispr | |||||