ID: 998938666 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:147257239-147257261 |
Sequence | CTACGTCGGGGGCGGGGCGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
998938654_998938666 | 12 | Left | 998938654 | 5:147257204-147257226 | CCACAGAACATTGGACCAACTAC | 0: 9 1: 29 2: 51 3: 48 4: 84 |
||
Right | 998938666 | 5:147257239-147257261 | CTACGTCGGGGGCGGGGCGGGGG | No data | ||||
998938655_998938666 | -3 | Left | 998938655 | 5:147257219-147257241 | CCAACTACAGCATAAAAGCTCTA | No data | ||
Right | 998938666 | 5:147257239-147257261 | CTACGTCGGGGGCGGGGCGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
998938666 | Original CRISPR | CTACGTCGGGGGCGGGGCGG GGG | Intronic | ||