ID: 998938714

View in Genome Browser
Species Human (GRCh38)
Location 5:147257589-147257611
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 2, 1: 0, 2: 7, 3: 50, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998938714_998938715 -9 Left 998938714 5:147257589-147257611 CCACAACTCTGGAGGGGGCAGCG 0: 2
1: 0
2: 7
3: 50
4: 251
Right 998938715 5:147257603-147257625 GGGGCAGCGCTTTCTTGACTCGG 0: 2
1: 6
2: 25
3: 41
4: 120
998938714_998938716 -8 Left 998938714 5:147257589-147257611 CCACAACTCTGGAGGGGGCAGCG 0: 2
1: 0
2: 7
3: 50
4: 251
Right 998938716 5:147257604-147257626 GGGCAGCGCTTTCTTGACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998938714 Original CRISPR CGCTGCCCCCTCCAGAGTTG TGG (reversed) Intronic
901421466 1:9154132-9154154 GGCTGGCCCATCCAGAGATGGGG + Intergenic
904712999 1:32445143-32445165 CGCCGCCCCCTCCAGAGTCATGG - Intergenic
905841474 1:41183195-41183217 CCCTGCCCCATTCAGAGTTTAGG + Intronic
910101565 1:83583329-83583351 CCCAGCCCCCTCCAGACTTTCGG - Intergenic
912093709 1:106113996-106114018 CTCAGCCCCCTCCAGACTTTGGG + Intergenic
912980458 1:114366385-114366407 TGCCACCCCCTCCAGAGTCGTGG - Intergenic
914871003 1:151473607-151473629 CGCCGCTCCCTCCCGGGTTGCGG - Intergenic
915120999 1:153629470-153629492 AGCTGCCCCCTCTGGGGTTGTGG + Intronic
916264962 1:162881719-162881741 CGCTGCGCCATCCAGAGCAGTGG + Intergenic
916296531 1:163226362-163226384 AGCTACCACCTCTAGAGTTGGGG + Intronic
918069305 1:181123161-181123183 CGGCGCCCCCTCCAGAGGGGTGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921263018 1:213400532-213400554 CCCTGCCCCTTCCAGAGATGAGG + Intergenic
922516389 1:226211199-226211221 CTCTGCACCCTCAGGAGTTGGGG + Intergenic
922680815 1:227593804-227593826 CACCACCCCATCCAGAGTTGTGG - Intronic
922690111 1:227682295-227682317 CGCCATCCCCTCCAGAGTCGTGG + Intergenic
922965394 1:229686778-229686800 CTCTGATCCCTCCAGAATTGGGG + Intergenic
1062895485 10:1100196-1100218 AGCTGCCACCTCAAGATTTGGGG + Intronic
1064756470 10:18576074-18576096 CGCTGCCCCATCCAGAGTCATGG + Intronic
1065201515 10:23317154-23317176 CTTGGCCCCCTCCAGAGTTTGGG - Exonic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1067801039 10:49359956-49359978 CGCTGCCCCATCCAGATCTTGGG + Intergenic
1068443779 10:57094991-57095013 CCCTGCCCCCTTCCAAGTTGTGG + Intergenic
1068671838 10:59730892-59730914 CGCCACCCCCTCCAGAGTCGTGG - Intronic
1068675839 10:59768447-59768469 CACCACCCCCTCCAGAGTCGTGG - Intergenic
1072391699 10:94993952-94993974 TGCTGCCCCCTCCAGAGTCATGG - Intergenic
1073144682 10:101272720-101272742 GTCTGCCCCCTGCAGACTTGGGG - Intergenic
1074116930 10:110463172-110463194 TGATGGCCCCTCCAGAGATGGGG + Intergenic
1075072145 10:119326502-119326524 CTCCGCCCCCTGCAGAGATGGGG - Exonic
1076678133 10:132158577-132158599 CCCAGTCCCCTCCAGAGTAGGGG - Intronic
1076691329 10:132225164-132225186 CTCTGCCCCCACCAGTGCTGGGG - Intronic
1076721566 10:132395620-132395642 AGCTGCCCCCTCCAGGGGTGGGG - Intergenic
1077249408 11:1554376-1554398 CACTGCCTCCTCCAGTGCTGCGG - Exonic
1077881403 11:6353593-6353615 AGCTGCCCCCTCCACATGTGAGG + Intergenic
1078085397 11:8230601-8230623 TGCTGCCCCCTCTAGGTTTGGGG + Intronic
1079957088 11:26879145-26879167 GGTTGCACCCTCCTGAGTTGTGG + Intergenic
1080822642 11:35821877-35821899 CACTGCCCCCTCCAGCCTTGGGG + Intergenic
1083706344 11:64518877-64518899 TGCTGCTCCCTCCAGTGTAGGGG + Intergenic
1083781140 11:64918282-64918304 GGCTGCCCCCTACAGAGCAGCGG - Intronic
1084532714 11:69738310-69738332 CACTGCCCCCTCCAGAACTCAGG + Intergenic
1084642647 11:70434902-70434924 AGATGCCCCCTGCAGAGATGCGG - Intronic
1084930000 11:72547524-72547546 TGCTGCCCCCTCCAGCTTTGGGG - Intergenic
1085212236 11:74791536-74791558 CTCGGCCCCCTCCAGACTTTGGG - Intronic
1085239747 11:75043376-75043398 CGCCACACCCTCCAGAGTCGTGG + Intergenic
1087456846 11:98397132-98397154 CGCTGCCCCCTCCAGAGCCGTGG - Intergenic
1087684475 11:101247858-101247880 CGCCACCTCCTCCAGAGTTGCGG + Intergenic
1087894764 11:103575356-103575378 TGCCACCCCCTCCAGAGTTGTGG + Intergenic
1089330045 11:117682742-117682764 CTCTGTCACCTCCAGACTTGGGG - Intronic
1089582171 11:119488420-119488442 TGAGGCCACCTCCAGAGTTGGGG - Intergenic
1090041867 11:123298967-123298989 CTCAGCCCCCTCCAGACTTTGGG + Intergenic
1090625453 11:128604341-128604363 CTCTGCCCCACCCAGAGCTGAGG + Intergenic
1092124745 12:6067072-6067094 CGCTGCCCCCTCTAGAAGAGCGG + Intronic
1093356703 12:18175980-18176002 TGCTGCCCCTTTCAGATTTGTGG + Intronic
1096787753 12:54027344-54027366 CCCTGCCCCCTCCAGACTCAGGG - Intronic
1098090596 12:66896615-66896637 GGCTACCCCTTCCAGAGATGTGG + Intergenic
1100793219 12:98153358-98153380 CCCTGTCACCTCCAGGGTTGGGG + Intergenic
1102427230 12:112853418-112853440 CTCTGAACCCTCCAGTGTTGGGG + Intronic
1103933025 12:124460570-124460592 CTCTGCCCCCTCCATAGAGGTGG + Intronic
1106443230 13:29799214-29799236 CCCTGCCCCCGGCAAAGTTGTGG + Intronic
1109426175 13:62168235-62168257 CGCAGCTCCCTCCAGACTTTGGG + Intergenic
1109563320 13:64078499-64078521 CTCTGCCCCCTTCAGACTTTGGG - Intergenic
1109909546 13:68891315-68891337 TGCCACCCCCTCCAGAGTCGTGG - Intergenic
1110653755 13:77972854-77972876 CGCCACCCCCTCCAGAGTCGTGG - Intergenic
1112086052 13:96033761-96033783 CTCAGCCCCCTCCAGACTTTGGG + Intronic
1113098749 13:106694638-106694660 CACTGCCACCTCCATAGTTTAGG + Intergenic
1113851981 13:113423071-113423093 AGCTGCCCCCAGCAGAATTGGGG - Intronic
1114223583 14:20718419-20718441 TGCCGCCCCCTCCAGAGTCGTGG - Intergenic
1114236134 14:20825269-20825291 CACCACCCCCTCCAGAGTCGTGG - Intergenic
1116083439 14:40204723-40204745 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
1118895376 14:69941319-69941341 CGCTGCCTCCTCCTGAGAGGTGG - Intronic
1120865528 14:89292629-89292651 CGCTGTACCCTCCAGAGGAGAGG - Intronic
1122375763 14:101255911-101255933 CGCTGCTCCTTCCAGAGGTCTGG - Intergenic
1202909580 14_GL000194v1_random:104592-104614 CTCGGCCCCCTCCAGACTTTGGG + Intergenic
1124717433 15:32077971-32077993 AGGTGCCACCTCCAGTGTTGGGG + Intronic
1126070168 15:44859081-44859103 CCCTTTCCCCTCCAGTGTTGGGG + Intergenic
1126087868 15:45026012-45026034 CCCTTTCCCCTCCAGTGTTGGGG - Intronic
1129814187 15:78537710-78537732 CTCTGCTCCCCCCAGTGTTGGGG + Intergenic
1130342474 15:83011336-83011358 CGCCGCCACCCCCAGAGCTGCGG - Intronic
1133464887 16:6019622-6019644 GGCTGTCCCCTCCAGATGTGGGG - Intronic
1133471532 16:6080491-6080513 TGCCTCCCCCTCCAGACTTGAGG - Intronic
1137588570 16:49679569-49679591 CTCAGCCCCCTCCAGACTTTTGG + Intronic
1138402017 16:56754239-56754261 GGGTGCCCCCTCCAATGTTGAGG + Intronic
1139088749 16:63618393-63618415 CGCAGCCCCCTCCAGATTTTGGG - Intergenic
1139625886 16:68188041-68188063 CTCAGCCCCCTCCAGACTTTGGG - Intronic
1139822087 16:69728730-69728752 CCCTGACCCATCCAGAGGTGGGG + Intergenic
1141124649 16:81392542-81392564 CTCTGCCCACTCTGGAGTTGGGG + Intergenic
1141167718 16:81671629-81671651 AGCAGCCCCCTCCTCAGTTGGGG - Intronic
1141687027 16:85576429-85576451 CGCTGCCCCTTCCACACTTTTGG + Intergenic
1143784041 17:9243705-9243727 CTCTGCCCCCTCCTGTGTTTTGG + Exonic
1146764117 17:35503928-35503950 CACCACCCCCTCCAGAGTTGTGG + Intronic
1147122412 17:38343493-38343515 CGCTGCCCCCTGTAGGCTTGGGG + Exonic
1147716733 17:42513711-42513733 TTCTGGCCCCTCCAGAGTTGAGG + Intronic
1148829010 17:50417139-50417161 CGCCACCCCCTCCAGAGTCGTGG - Intergenic
1151791253 17:76307370-76307392 CGCTCACCCCTCCAGGGTGGTGG + Intronic
1152063087 17:78093742-78093764 CGCTACCTCCTCAAGAGTGGAGG + Exonic
1153826426 18:8879125-8879147 CGCCACCGCCTCCAGAGTTGTGG - Intergenic
1153830339 18:8916969-8916991 CGCCACCCCCTCCAGAGTCATGG + Intergenic
1154014179 18:10601827-10601849 CGCCACCCCTTCCAGAGTCGTGG - Intergenic
1154463192 18:14617270-14617292 CGCCACCCCCTCCAGAGTCATGG + Intergenic
1155120845 18:22816932-22816954 CGCTGCCCCTGCCCGAATTGTGG - Intronic
1155192028 18:23438725-23438747 CTCTGCTCCCTCCAGCATTGAGG + Intergenic
1155746235 18:29358985-29359007 CACTGCCCCCTCCAGAGTCGTGG - Intergenic
1158950707 18:62492272-62492294 CACTGCTACCTCCAGAGTCGAGG - Intergenic
1159623807 18:70669385-70669407 CTCAGCCCCCTCCAGACTTTGGG + Intergenic
1160698656 19:496349-496371 CTCTGCCGCCTCCAGGGTCGGGG + Intronic
1160757419 19:764984-765006 CGCTGCTCCCAGCAGGGTTGGGG - Intergenic
1161286524 19:3471270-3471292 CTCTGTCCCCTCCAGACTGGGGG + Intergenic
1161420364 19:4173265-4173287 AGGTGTCCCCTCCGGAGTTGCGG + Intergenic
1161487213 19:4542887-4542909 CGCTTCCCTCTGCAGAGTGGGGG + Exonic
1162130843 19:8525473-8525495 CCCTGCGCCCCCCAGAGGTGAGG - Exonic
1162267857 19:9590525-9590547 CGCCACCACCTCCAGAGTGGTGG - Intergenic
1163867134 19:19782919-19782941 CACCGCCCCCTCCAGAGTCTTGG - Intergenic
1163991806 19:21005935-21005957 CGCCACCCCCTCCAGAGTCATGG + Intergenic
1164109089 19:22137923-22137945 CGCGACCCCCTCCATGGTTGGGG - Intergenic
1164130769 19:22359217-22359239 TGCCACCCCCTCCAGAGTCGTGG - Intergenic
1164725157 19:30461155-30461177 CGCTGTCCCCTCCAGACCTCTGG - Intronic
1165022564 19:32936283-32936305 CTCAGCCCCCTCCAGACTTTGGG + Intronic
1165339909 19:35204074-35204096 TGGTGCCCACCCCAGAGTTGTGG + Intergenic
1165585667 19:36913520-36913542 CACTGCCCCCTCCTGAGATGAGG + Intronic
1166897420 19:46032700-46032722 CACAGCCCCCTCCAGACTTTGGG + Intergenic
1166948490 19:46411749-46411771 CTCTGCCCCCTCCTCAGCTGGGG + Exonic
1167040797 19:47021471-47021493 TGCTCCCACCTCCAGAGATGTGG + Intronic
1167111553 19:47465484-47465506 TGCTGCACCCTCCAGAGATATGG + Intronic
1167795867 19:51708076-51708098 CGCTGCCCCCTCCAGTCCTTGGG - Intergenic
1202653031 1_KI270707v1_random:23887-23909 CTCCGCCCCCTCCAGACTTTCGG + Intergenic
925314428 2:2910128-2910150 TTCTGCCTCCCCCAGAGTTGAGG - Intergenic
925490845 2:4391047-4391069 GCTTGCACCCTCCAGAGTTGTGG + Intergenic
925515247 2:4674527-4674549 TGCTGCCCCTTCCAGACTTTGGG + Intergenic
926452885 2:13027280-13027302 TGCTGCACCCTCCAGAGTGGAGG + Intergenic
926491501 2:13530386-13530408 TGCCACCCCCTCCAGAGTCGTGG - Intergenic
926958912 2:18332571-18332593 CACAGCCCCCTCCAGACTTTGGG - Intronic
927236525 2:20880276-20880298 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
927533916 2:23837141-23837163 CACAGCCCCCTCCAGACTTTGGG - Intronic
930071339 2:47369121-47369143 CGCGGCCCTCTCCACAGGTGTGG - Intronic
930946707 2:57084499-57084521 CTCAGCCCCCTCCAGACTTTAGG - Intergenic
931429076 2:62195645-62195667 GGCCGCCCCCTCCAGTGCTGGGG - Intergenic
933389515 2:81652426-81652448 CACCACCCCCTCCAGAGTCGTGG - Intergenic
933691240 2:85181096-85181118 CTGTGACCCCTCCTGAGTTGGGG + Intronic
935721528 2:105983534-105983556 CGCCACCCCCTCCAGAGTCGTGG - Intergenic
935970536 2:108527029-108527051 TGCCACCCCCTCCAGAGTTGTGG + Intergenic
936290149 2:111216921-111216943 CCCAGCCCCCTCCAGAATTTGGG - Intergenic
936419642 2:112350861-112350883 CGCCACCCCCTCCAGAGTTGTGG - Intergenic
936477603 2:112853108-112853130 TGCTGCCCCCTTCTGGGTTGGGG + Intergenic
936955059 2:118014563-118014585 CGCTGCCCTCTCCAGCGTCCTGG + Intergenic
938133059 2:128733654-128733676 CGCTGCCCACTGCAGTGGTGTGG + Intergenic
938161512 2:128988619-128988641 CTCTGCCCTCTGCATAGTTGTGG + Intergenic
938722129 2:134076395-134076417 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
938753848 2:134361894-134361916 CCCTGCCCCCTACAGATTTCTGG + Intronic
940352775 2:152707388-152707410 TGCCGCCCCCTCCAGAGTCATGG + Intronic
942114409 2:172713510-172713532 CTCGGCCCCCTCCAGACTTTGGG - Intergenic
942585122 2:177466623-177466645 CTCAGCCCCCTCCAGACTTTGGG - Intronic
943191727 2:184685968-184685990 CTCAGCCCCCTCCAGACTTTGGG - Intronic
945720245 2:213410121-213410143 TGCCACCCCCTCCAGAGTCGTGG + Intronic
946001793 2:216488583-216488605 CTCAGCCCCCACCAGAGTTTTGG + Intergenic
947327328 2:228992673-228992695 CTCAGCCCCCTCCAGACTTCAGG - Intronic
948207742 2:236171577-236171599 CGCTGCCGCCGCCAGAGTCGAGG + Intergenic
948496919 2:238356594-238356616 CGCTGCCCCCTCCCAAGACGGGG - Intronic
948836509 2:240628646-240628668 CGCTCTCCCCTCCTGATTTGGGG + Intronic
948921291 2:241067122-241067144 CCCTGCCCGCTGCAGAGTTGGGG + Intronic
1168824153 20:797993-798015 CACCGCCCCCTCCAGAGTCGTGG + Intergenic
1169936626 20:10890765-10890787 TGCTGCATCCTCCAGAGTGGAGG + Intergenic
1170004112 20:11646923-11646945 CTCAGCCCCCTCCAGAGTTTGGG + Intergenic
1171301116 20:24061200-24061222 CGCTGCCTCCTTCAGAGGGGAGG + Intergenic
1172063849 20:32206259-32206281 CCCCGCCCACTCCAGAGTGGTGG + Intronic
1173681554 20:44885791-44885813 CGCTGCCGCCGCCTGAGTAGTGG + Exonic
1173727698 20:45308649-45308671 CGCTGTCCCCTCCAGGAGTGAGG + Intronic
1175138501 20:56842594-56842616 CTCGGCCCCCTCCAGACTTTGGG + Intergenic
1175681451 20:60991814-60991836 GCCTGCGCCCTCCAGAGCTGTGG + Intergenic
1175959961 20:62631026-62631048 CTCAGCCCCCTCCAGATTTTGGG - Intergenic
1176219318 20:63962561-63962583 AGCTGCCCCCCCCAGGGCTGTGG - Intronic
1176599121 21:8775764-8775786 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
1176628930 21:9119300-9119322 CTCGGCCCCCTCCAGAATTTGGG + Intergenic
1176811329 21:13541100-13541122 CGCCACCCCCTCCAGAGTCATGG - Intergenic
1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG + Exonic
1179667993 21:42925630-42925652 CCCTGCCCCCTCCTCACTTGGGG - Intergenic
1179670931 21:42947183-42947205 CGCCACCCCCTCCAGAGGTGGGG - Intergenic
1179805656 21:43835465-43835487 GGCTGCCCCCTCCTGTGTTCAGG - Intergenic
1180378201 22:12114144-12114166 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
1180419309 22:12799137-12799159 CTCGGCCCCCTCCAGACTTTGGG + Intergenic
1180707031 22:17816400-17816422 GGCTGCCTCCTCCAGAGAAGGGG + Intronic
1181456573 22:23063398-23063420 CCCTGCCCCCTGCAGCTTTGAGG + Intronic
1181659301 22:24330644-24330666 CCTGGCTCCCTCCAGAGTTGGGG - Intronic
1183056795 22:35311753-35311775 GGCTGCCCCCACGACAGTTGGGG + Intronic
1185376299 22:50484051-50484073 TGCTGCGGCCTCTAGAGTTGGGG - Exonic
949533369 3:4978419-4978441 CTCTGCCCCCTCCGGAGCAGAGG - Intergenic
950730180 3:14949157-14949179 CCCTGCCCTCACTAGAGTTGGGG + Intronic
950846188 3:16018106-16018128 CACCGCCCCCTCCAGAGTCATGG - Intergenic
951853601 3:27170203-27170225 TGCTGCCACCTCCTGAGTGGGGG + Intronic
952224870 3:31365299-31365321 AGCTGCCCTCTCCAGACTTTGGG + Intergenic
953748245 3:45591373-45591395 CTCGGCCCCCTCCAGACTTTGGG - Intronic
956564974 3:70626021-70626043 TGCTGCATCCTCCAGAGTGGGGG - Intergenic
958195256 3:90235493-90235515 CCCTGCCCCCTCCAGTCTTTGGG + Intergenic
960063412 3:113347211-113347233 CGCTCCCAACTCCAGAGTCGGGG - Intronic
960995766 3:123339169-123339191 CACTGGCCCATCCAGAGGTGTGG - Intronic
961943025 3:130656791-130656813 CTCAGCCCCCTCCCGAGTTTGGG - Intronic
962097330 3:132305973-132305995 TGCCACCCCCTCCAGAGTCGTGG + Intergenic
962277025 3:134023189-134023211 CGCCACCCCCTCCAGAATTGTGG + Intronic
962301948 3:134250834-134250856 CGCTGCATCGTCCGGAGTTGGGG + Intergenic
962755059 3:138460372-138460394 CCCTGCCCCATCCTGAGCTGAGG + Intronic
964933106 3:162049260-162049282 AGCCACCCCCTCCAGAGTTGTGG - Intergenic
966880349 3:184346470-184346492 CCCAGCCCCCTCCAGACCTGGGG - Exonic
969483037 4:7456944-7456966 CGCAGCCACCTCCAGGGTTGTGG + Intronic
969524669 4:7698086-7698108 CGGTGCCCCCTCCTGGGGTGGGG - Intronic
969638623 4:8383593-8383615 CCCTGCCCCATCCTGACTTGGGG + Intronic
972784942 4:42318061-42318083 TGCAGCCCCCTCCAGAGACGTGG + Intergenic
972931107 4:44072258-44072280 CTCTGCCCCCTCCTGACTTTGGG - Intergenic
972991264 4:44824540-44824562 TGCTACCCCCTCCAGAGTCGTGG - Intergenic
973127773 4:46609536-46609558 CTCTCCCACCTCTAGAGTTGGGG + Intergenic
973362479 4:49178136-49178158 CTCGGCCCCCTCCAGAATTTGGG - Intergenic
973398622 4:49618725-49618747 CTCGGCCCCCTCCAGACTTTGGG + Intergenic
975254394 4:72216424-72216446 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
975325499 4:73054145-73054167 CGCTGGGCCCTGCAGAGTTCAGG - Intergenic
975913609 4:79297668-79297690 CTCAGCCCCCTCCAGACTTTGGG + Intronic
977043613 4:92042833-92042855 CGCCACCCCCTCCAGAGTCGTGG - Intergenic
977570201 4:98621265-98621287 AGCTGCAGCCTCCAGAGTTGTGG + Intronic
977972329 4:103227010-103227032 CGCCACCCCCTCCAGAGTGGTGG + Intergenic
978314133 4:107417345-107417367 TGCCGCCCCCTCCAGAGTAGTGG + Intergenic
980072953 4:128263226-128263248 TGGCACCCCCTCCAGAGTTGTGG + Intergenic
980438838 4:132815164-132815186 CGCCACCCCCTCTGGAGTTGTGG - Intergenic
983897931 4:173101811-173101833 CGCCACCCCATCCAGAGTCGTGG + Intergenic
984760848 4:183361397-183361419 TGCTGCCTCCTCCAGAGGGGAGG - Intergenic
985286068 4:188337172-188337194 GGCTGCGTTCTCCAGAGTTGCGG - Intergenic
1202759820 4_GL000008v2_random:99609-99631 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
988565974 5:32320364-32320386 CTCGGCCCCCTCCAGACTTTGGG - Intergenic
989096085 5:37782510-37782532 CGCCACCCCCTCCAGAGTCATGG - Intergenic
989613573 5:43317757-43317779 TGCCACCCCCTCCAGAGTAGTGG - Intergenic
991306034 5:65177199-65177221 CGCCCCCACCTCCAGAGTCGTGG + Intronic
993278267 5:85890664-85890686 TGCTGCATCCTCCAGAGTGGAGG + Intergenic
993901447 5:93586134-93586156 GGCCGCCTCCTCCAGAGCTGTGG + Intronic
998552528 5:143091147-143091169 CGCCGCCCCCTCCAGAGTCGTGG - Intronic
998938714 5:147257589-147257611 CGCTGCCCCCTCCAGAGTTGTGG - Intronic
1000236784 5:159369434-159369456 CACCACCCCCTCCAGAGTCGTGG + Intergenic
1001558484 5:172652915-172652937 CACCACCCCCTCCAGAGTCGTGG - Intronic
1002377841 5:178801059-178801081 CACTGACCCCTCCAGGGATGTGG + Intergenic
1002455632 5:179344421-179344443 CCCTGCCCCGTTCAGGGTTGGGG + Intronic
1002999161 6:2314820-2314842 CGCCACCCCCTCCAGAGTCGTGG - Intergenic
1003526648 6:6903775-6903797 TGCTGCCCCATCCACAGTTTGGG - Intergenic
1006325822 6:33353116-33353138 CACCACCCCCTCCAGAGTTGTGG - Intergenic
1006735105 6:36267883-36267905 GGCTGCCTCCTGCAGAGTTGGGG - Intronic
1007665088 6:43509170-43509192 CCCTGCCCACTGCAGAGTTCCGG - Intronic
1012983038 6:105850129-105850151 CGCTGCCCCCGTAAGACTTGTGG + Intergenic
1015171884 6:130263518-130263540 CGCCACCCCCTCCAGAGTCGTGG + Intronic
1017236386 6:152120994-152121016 TGCTGTCCCTTCCAGAATTGGGG - Intronic
1018854614 6:167666601-167666623 CGCTGCCCCTTTCGGAGGTGGGG + Intergenic
1019357358 7:587636-587658 CACAGCCCCTTCCACAGTTGGGG + Intronic
1020655736 7:10926465-10926487 CGCCACCCCCTCCAGAGTCGTGG + Intergenic
1020959628 7:14786756-14786778 CTCAGCCCCCTCCAGATTTTGGG + Intronic
1021677609 7:23097212-23097234 CTCAGCCCCCTCCAGACTTTGGG + Intergenic
1022507468 7:30915853-30915875 TGCTGCCTCCTCCAGAGCTCAGG + Intronic
1023436385 7:40144415-40144437 CGCCGCCCCCTCCAGAGTCATGG - Intronic
1023799458 7:43821375-43821397 CGCTGCCCCCTCCAGAGTTGTGG + Intergenic
1024210528 7:47199463-47199485 TGCTGCATCCTCCAGAGTGGAGG + Intergenic
1024812901 7:53234645-53234667 CGCCACGCCCTCCAGAGTCGTGG + Intergenic
1027052906 7:75030954-75030976 CCCTGCCACCTCCAAAGTTTGGG - Intronic
1027264784 7:76488360-76488382 CCCCGCCCCCACCAGAGATGGGG - Intronic
1027316155 7:76986462-76986484 CCCCGCCCCCACCAGAGATGGGG - Intergenic
1027995738 7:85423721-85423743 CTCAGCCCCCTCCAGACTTTGGG + Intergenic
1028333935 7:89628425-89628447 CGCCGCCCCCTCCAGAGTCGTGG + Intergenic
1028738978 7:94250401-94250423 TGCTGCTCCCTCCAGTGTAGGGG - Intergenic
1030890986 7:114998952-114998974 GCCTGCCACCTCCAGAGTTTTGG + Intronic
1032170511 7:129580801-129580823 TACCACCCCCTCCAGAGTTGTGG + Intergenic
1035105695 7:156440275-156440297 CTCTGGCCCCGCCAGAGTTAGGG + Intergenic
1035582686 8:749832-749854 GCCTGCTCCCTCCAGAGGTGTGG + Intergenic
1036204081 8:6792727-6792749 GGCTGCACCCTCCAGAGGGGAGG - Intergenic
1036670872 8:10786631-10786653 CTCTGCCCCCTCCAAAGATCTGG + Intronic
1039442047 8:37601872-37601894 AGCTGCCCCCTCAAACGTTGGGG - Intergenic
1041515424 8:58694415-58694437 CGCCACCCCCTCCAGAGTCCTGG + Intergenic
1042087917 8:65128802-65128824 CACCGCCCCCTCCAGAGTCGTGG - Intergenic
1043758064 8:84029568-84029590 CTCAGCCCCCTCCAGACTTTGGG + Intergenic
1044184627 8:89236758-89236780 CACTGTCCCCTCCAGAGTCGTGG - Intergenic
1044613848 8:94119834-94119856 CTCGGCCCCCTCCGGACTTGGGG + Intergenic
1044660700 8:94590974-94590996 AGCCGCCCCGTCCAGAGGTGAGG + Intergenic
1044849875 8:96417753-96417775 CCCTGCCTCCTCCAGAGTCCAGG - Intergenic
1045300786 8:100908358-100908380 CTCTGCCCCCTCCAGACTTTGGG - Intergenic
1045392986 8:101733625-101733647 CGATGAGCCCTCCAGAGTTGGGG + Intronic
1048450125 8:134525730-134525752 CTCTGCCTCCACCAGGGTTGGGG - Intronic
1049515797 8:143054604-143054626 CGCTGTCCCTTCCAGAGTGGAGG - Intronic
1053033909 9:34808661-34808683 CACTGCATCTTCCAGAGTTGGGG + Intergenic
1057020308 9:91692234-91692256 CACAGGCCCCCCCAGAGTTGGGG + Intronic
1057365235 9:94414258-94414280 CCCTGTCCCCTCCAAACTTGTGG - Intronic
1057658086 9:96973826-96973848 CCCTGTCCCCTCCAAACTTGTGG + Intronic
1057687932 9:97252908-97252930 TGCTGCAGCCTCCAGAGTAGCGG - Intergenic
1059401161 9:114071391-114071413 CTCAGCCCCCTCCAGACTTTGGG + Intronic
1059535484 9:115076444-115076466 CGTGGTCCCCTCCAGAGATGGGG + Exonic
1059563415 9:115357891-115357913 AGCTGCCCACTCCAGTGATGAGG + Intronic
1060434536 9:123582246-123582268 CGCTGCCACCTCTAGAGATCAGG - Intronic
1061009871 9:127948530-127948552 CTCTGCCCCCTCCTGGCTTGGGG + Intronic
1061755956 9:132812729-132812751 CGCTGCCCCCACCAGCCATGTGG - Intronic
1203691607 Un_GL000214v1:47824-47846 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
1203751777 Un_GL000218v1:86981-87003 CTCGGCCCCCTCCAGAATTTGGG + Intergenic
1203363776 Un_KI270442v1:239949-239971 GGCTCACCCCTCCAGACTTGTGG + Intergenic
1203540596 Un_KI270743v1:84504-84526 CTCAGCCCCCTCCAGACTTTGGG - Intergenic
1203644688 Un_KI270751v1:56367-56389 CTCAGCCCCCTCCAGACTTTGGG + Intergenic
1189034521 X:37482235-37482257 TGCCGCCCCCTCCTGAGTTGTGG + Intronic
1189407965 X:40742927-40742949 CCTTGCCCCTTCCAGAGGTGAGG - Intergenic
1190369445 X:49727108-49727130 CTCTGCCCCCTCCAAACTTTGGG + Intergenic
1191639192 X:63412278-63412300 CGCCACCCCCTCCAGAGTTGTGG + Intergenic
1192729201 X:73785634-73785656 CTCTTCCCTCTCCAGAGTTTGGG + Intergenic
1193591294 X:83391433-83391455 CCCTCCTCCCTTCAGAGTTGGGG - Intergenic
1194212071 X:91082070-91082092 CCCTGCCCCCTTCTGAGTTGGGG + Intergenic
1194832330 X:98638875-98638897 CACTGCCCCTTCCAATGTTGAGG - Intergenic
1196281983 X:113832834-113832856 TGATGCCCCCTCCAGAGAGGAGG + Intergenic
1196423048 X:115542100-115542122 CGCCACCCCCTCCAGAATCGTGG - Intergenic
1197890230 X:131262927-131262949 TGCTGCTCCCTCCAGTGGTGGGG - Intergenic
1198742428 X:139855528-139855550 CGCCACCCCCTCCAGAGTTGTGG + Intronic
1199638312 X:149834809-149834831 TGCCACCCCCTCCAGAGTTGTGG + Intergenic
1200763310 Y:7059405-7059427 CGCCACCCCCTCCAGAGTCGTGG - Intronic
1200769199 Y:7108021-7108043 CGCCACCCCCTCCAGAGTCGTGG + Intergenic
1201165432 Y:11204601-11204623 CTCGGCCCCCTCCAGACTTTGGG + Intergenic
1201972390 Y:19811898-19811920 CGCTGCCACCTCCAGAATCATGG - Intergenic