ID: 998940468

View in Genome Browser
Species Human (GRCh38)
Location 5:147276679-147276701
Sequence TAGCATAAGCTTAATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998940468_998940472 7 Left 998940468 5:147276679-147276701 CCACCCTCATTAAGCTTATGCTA 0: 1
1: 0
2: 1
3: 12
4: 120
Right 998940472 5:147276709-147276731 TGAAATAAACTCAGAAGTCAAGG 0: 1
1: 1
2: 5
3: 132
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998940468 Original CRISPR TAGCATAAGCTTAATGAGGG TGG (reversed) Intronic
902185924 1:14725431-14725453 AACCATAAGTTTCATGAGGGTGG + Intronic
902671330 1:17976156-17976178 TAACATAAGCTCCATGAGAGTGG + Intergenic
902999385 1:20254183-20254205 TAGCATAAACTTCTTTAGGGTGG - Intergenic
906822484 1:48944095-48944117 TATCATGAGCTCAATGAGGCAGG - Intronic
906834440 1:49068000-49068022 GAGCATAAGCTTCTTGAGGGAGG + Intronic
908333242 1:63092926-63092948 TAGAGTAAGCTTAGTGAGGAAGG - Intergenic
908880531 1:68726744-68726766 TACCATAAGCTACTTGAGGGTGG + Intergenic
912803387 1:112736188-112736210 TATCACAAACTTAATCAGGGTGG + Intergenic
913447139 1:118961556-118961578 AAGCAGAAGCTTGATGATGGAGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916205649 1:162313933-162313955 TAGCATGAACTCCATGAGGGTGG + Intronic
917702741 1:177597497-177597519 TTGCATATGTTTAATGGGGGAGG - Intergenic
918036878 1:180882326-180882348 TAGCATATCCTTAATGTGTGTGG + Intronic
922087355 1:222363560-222363582 TGGCAAAAGCCTAATTAGGGTGG + Intergenic
922316089 1:224443490-224443512 TAGCATAAGCTTAATATCGAGGG + Intronic
922392872 1:225164795-225164817 TAGCATCAACATAATGAGAGTGG - Intronic
1068611642 10:59066894-59066916 TAGCACAAGCCCAATGAAGGTGG + Intergenic
1069704104 10:70446777-70446799 AAGCATAAGCTTTGTGAGGGTGG + Intronic
1074067724 10:110032743-110032765 TAGCATGATCTTAATCAGGAAGG - Intronic
1075931191 10:126297598-126297620 TACCATCAGCTTAATGACTGTGG - Intronic
1078928985 11:15898970-15898992 AAATATAAGCTTCATGAGGGAGG - Intergenic
1080720517 11:34843760-34843782 TAGCTGAAGTTTAATGAGAGGGG - Intergenic
1085373450 11:76034586-76034608 TAACATAAGGTCAATGTGGGTGG + Intronic
1089624791 11:119744470-119744492 TAGCATGAGATTAATGTGGTTGG + Intergenic
1092599623 12:10045260-10045282 TAGCATAAGATTAAGGAGCAAGG - Intronic
1093143305 12:15535459-15535481 AAGCATAAGTTTGATGATGGTGG - Intronic
1093338696 12:17943486-17943508 TAGCAGAATCCCAATGAGGGAGG + Intergenic
1093435983 12:19135540-19135562 TATCCAAAGCTTAAAGAGGGAGG - Intronic
1096310334 12:50515121-50515143 TTTCAGAAGCTTAATGAGGCAGG - Intronic
1098002312 12:65958191-65958213 TAGCATCAGCTTAATAAAGTTGG - Intronic
1099403632 12:82231840-82231862 TACCATATGCTTAATGACAGAGG + Intronic
1100538288 12:95532603-95532625 TAGCAAAAGCTTTTGGAGGGAGG - Intronic
1100572129 12:95852682-95852704 GAAAATAAGCTTAGTGAGGGCGG + Intergenic
1102940981 12:116941504-116941526 TAGCAGAAGCATAATTAAGGAGG + Intronic
1105390315 13:19971038-19971060 TAGCTGAAGCTTAATGAGCAAGG + Intronic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110350237 13:74498590-74498612 TAACATAAGCATAATTTGGGGGG + Intergenic
1113487013 13:110661654-110661676 ATGCTTAAGCTTAATGAGGAGGG - Intronic
1114995605 14:28348109-28348131 CAGCATAAGCAAAATGAGTGTGG - Intergenic
1118524519 14:66623937-66623959 TATCAGAAGCTACATGAGGGAGG + Intronic
1118574254 14:67225901-67225923 CAGCATTAGCTTTATGAAGGAGG - Intronic
1121936915 14:98028296-98028318 TAGCATCAGTGTAAGGAGGGCGG - Intergenic
1122005073 14:98696727-98696749 AAGTACAAGCTTAATGAGAGGGG - Intergenic
1123453303 15:20388254-20388276 TAGTATAAGAAAAATGAGGGTGG + Intergenic
1125108538 15:36003334-36003356 TTGCAGAAGGTTAATGAGGCTGG - Intergenic
1139182287 16:64762380-64762402 TATCATTAACATAATGAGGGAGG + Intergenic
1146094562 17:29916685-29916707 TAACATAAACCTTATGAGGGTGG - Intronic
1146225173 17:31059716-31059738 TAGCATGAGATGAATGAGGCAGG - Intergenic
1149475632 17:56959032-56959054 TAGCTGAAGCTTAAAGGGGGTGG + Intronic
1156776792 18:40799616-40799638 TACCATGAGCTGAATGGGGGTGG - Intergenic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159495347 18:69195521-69195543 TACCAGAAGATTAAAGAGGGAGG - Intergenic
1162306905 19:9880370-9880392 GAGCAGAAGCTTTATGAGGTTGG - Intronic
1164800302 19:31070341-31070363 GAGCATTAGCTTCATGAGGATGG - Intergenic
926481996 2:13410978-13411000 TAGTATAAGAAAAATGAGGGTGG - Intergenic
927581731 2:24256775-24256797 GATCATAAGCTCAATGAGGCTGG - Intronic
929974163 2:46616312-46616334 TATCTTAAGCTGATTGAGGGAGG + Intronic
933011798 2:77074501-77074523 TACCATAAGCTTAATAACAGGGG - Intronic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
937404619 2:121615382-121615404 CAGCATAAGTAAAATGAGGGAGG + Intronic
938987208 2:136588955-136588977 TTGGTTAAGCTTAATGAGGGAGG - Intergenic
938987215 2:136589015-136589037 ATGATTAAGCTTAATGAGGGAGG - Intergenic
940012962 2:149073839-149073861 AAGCAGAAGCTCAATGAGAGAGG + Intronic
940201349 2:151154492-151154514 TAGCAACAGCTCAATGAGGTTGG + Intergenic
1169313074 20:4564144-4564166 TAGCCTAAGCTAGAAGAGGGAGG + Intergenic
1170145308 20:13167155-13167177 TAGAATAAGGTTAATTAGGAGGG + Exonic
1171003010 20:21433796-21433818 TACCATAAGCACAATGAGGGTGG - Intergenic
1177706545 21:24713721-24713743 TAGCATAAACTTAGTGAGGTGGG + Intergenic
1178132080 21:29585130-29585152 AAGAATAAGCTAAATAAGGGAGG + Intronic
1179092827 21:38283720-38283742 TAGCATAACTTTTTTGAGGGAGG - Intronic
1184966765 22:47980774-47980796 TAGCATAAAAGTAAGGAGGGAGG - Intergenic
957971458 3:87388135-87388157 TAGCTTAAACTGAATGGGGGCGG + Intergenic
958028785 3:88081929-88081951 TAACATAAGCATACTGAAGGGGG + Intronic
958126805 3:89366777-89366799 GAATATAAGCCTAATGAGGGTGG + Intronic
960584416 3:119307676-119307698 TATCATAAACTTTATAAGGGAGG - Intronic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
966334387 3:178852143-178852165 TAACATAAGCTTCAAGAGGTGGG + Intergenic
973649339 4:52982204-52982226 CAGCATAAGCATAATGGTGGTGG + Intronic
977577293 4:98688905-98688927 TAGCATTAGCTGACTCAGGGAGG - Intergenic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
981527219 4:145719068-145719090 GAACATAAGCTTTATGAGGGAGG + Intronic
985967418 5:3348184-3348206 TAGCAGAAGTATAAGGAGGGAGG - Intergenic
986735885 5:10666949-10666971 TAGCAAACTCTTAATGCGGGAGG - Intergenic
989418092 5:41204247-41204269 TAACAAAAGCTTTATGAGGTAGG - Intronic
990241850 5:53823890-53823912 TAGCTTAAGCAAAATGTGGGGGG - Intergenic
991113109 5:62924042-62924064 TAACAGAAGCTTATTGAAGGTGG + Intergenic
992010303 5:72519052-72519074 TAGCATAACCCTATTCAGGGTGG - Intergenic
994069916 5:95589246-95589268 GAACACAAGCTTCATGAGGGCGG + Intronic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
996692498 5:126355576-126355598 AAGCATGAGCTAAATGAGGCTGG + Intergenic
998582725 5:143396914-143396936 TAGCATAAACTTATTGACGAAGG - Intronic
998940468 5:147276679-147276701 TAGCATAAGCTTAATGAGGGTGG - Intronic
999777244 5:154821191-154821213 TATCAGAAGCTTAAGGAGGGAGG + Intronic
1001226340 5:169947578-169947600 AAGCATCAGCTTAATGTGGAGGG - Intronic
1002316159 5:178344999-178345021 TATCCTCAGCTTCATGAGGGTGG - Intronic
1005415927 6:25600339-25600361 TCCCATGAGCTTAATGAAGGAGG + Exonic
1008802767 6:55390275-55390297 TAGCAAAAGCTAATTCAGGGGGG - Intronic
1009663332 6:66643829-66643851 TTGCATAAACATATTGAGGGAGG - Intergenic
1010430547 6:75773619-75773641 CAACATAAGCTTGATGATGGTGG - Intronic
1011911177 6:92441414-92441436 TAGCAAAAGCTTACTGATGCAGG - Intergenic
1012477014 6:99624700-99624722 TAGCATGAGCATAGTGAGTGGGG + Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1015566987 6:134583623-134583645 TATAATATGCTTAATGAGTGTGG - Intergenic
1015835090 6:137411830-137411852 TAGCATAATTTTAATGCAGGAGG - Intergenic
1016554814 6:145324566-145324588 AAGCATAATTTGAATGAGGGTGG - Intergenic
1021013019 7:15495129-15495151 TAGCAAAAGCATCATGATGGGGG - Intronic
1022389374 7:29929797-29929819 TAGCATGAGCTTACTGAAGCTGG - Intronic
1026418273 7:70205850-70205872 TAGCATAAGCTTTAAGAGGAGGG + Intronic
1028124289 7:87094137-87094159 TAGAATGACATTAATGAGGGTGG - Intergenic
1031078860 7:117239365-117239387 GAACATCAGCTTAATGAGTGAGG + Intergenic
1032598517 7:133267605-133267627 GAACATAAGCTTCATGAGGGAGG + Intronic
1042664537 8:71191332-71191354 TAGCAAAAGCTTCAAGAGTGAGG + Intergenic
1044121671 8:88404484-88404506 TAGATTAAGGTTAATGAGGGAGG - Intergenic
1046345104 8:112913611-112913633 GAGCATAAACTTATTGAGGATGG - Intronic
1046414219 8:113890204-113890226 TAGAATAAGCTTTATTTGGGTGG - Intergenic
1047550132 8:125862194-125862216 GAGAAAAAGCTTAATGGGGGTGG + Intergenic
1048727761 8:137406476-137406498 CATCATAAGGTTAATGAAGGTGG - Intergenic
1048844806 8:138596194-138596216 TAGCAGATGCTTAGGGAGGGAGG - Intronic
1048885212 8:138904053-138904075 TAGCTTAAGCTTAAAAAGCGGGG - Intronic
1051918669 9:22237777-22237799 AAGCATGAGGTTAATGTGGGGGG - Intergenic
1058938006 9:109786816-109786838 TAGAAAAAGCTAAGTGAGGGGGG + Intronic
1059862695 9:118482590-118482612 TAGCATCAGCCTAAAGAGGGAGG - Intergenic
1060389207 9:123265251-123265273 TTGCCTAAACATAATGAGGGCGG - Intronic
1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG + Intergenic
1186124409 X:6397519-6397541 TACCACAAACTTGATGAGGGAGG - Intergenic
1186408241 X:9322744-9322766 TAGCATAAGGTTTATGAGGGGGG - Intergenic
1189150216 X:38699044-38699066 GAGCATAAGCATAATGAAGGAGG + Intergenic
1192301293 X:69905817-69905839 GACCATAAGCTCCATGAGGGAGG + Intronic
1192608099 X:72541018-72541040 GAGCATAAGCTTCATGGGGAAGG - Intronic
1193502244 X:82293221-82293243 TAGCAAAAGCTTTGTGAGAGTGG + Intergenic
1197176793 X:123494730-123494752 TAGCATAATCCAAGTGAGGGGGG - Intergenic
1197213112 X:123844489-123844511 TAGCATAACCTCAATGAAGAGGG + Intergenic
1198448301 X:136740406-136740428 TGCCATAAGCTAAATGAGAGAGG + Intronic
1200567791 Y:4788461-4788483 TAGCATTTGATTAATGTGGGAGG - Intergenic