ID: 998956288

View in Genome Browser
Species Human (GRCh38)
Location 5:147441788-147441810
Sequence TGGGAAAAAACAGCCTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998956288_998956291 -2 Left 998956288 5:147441788-147441810 CCAAGCAAGGCTGTTTTTTCCCA 0: 1
1: 0
2: 3
3: 18
4: 220
Right 998956291 5:147441809-147441831 CACAATTTCTCATAGCAAAAAGG No data
998956288_998956292 -1 Left 998956288 5:147441788-147441810 CCAAGCAAGGCTGTTTTTTCCCA 0: 1
1: 0
2: 3
3: 18
4: 220
Right 998956292 5:147441810-147441832 ACAATTTCTCATAGCAAAAAGGG 0: 1
1: 0
2: 1
3: 26
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998956288 Original CRISPR TGGGAAAAAACAGCCTTGCT TGG (reversed) Intronic
900093008 1:928678-928700 TGGGAAAACGCAGCACTGCTGGG - Intronic
901297601 1:8172504-8172526 TGTGAAGAAAAAGCTTTGCTTGG + Intergenic
902278171 1:15354523-15354545 TGGGAAGAGACTGCCTTTCTCGG - Intronic
902716704 1:18277753-18277775 TGGGAGAAAAGAGCCTTCCCTGG + Intronic
903295991 1:22343304-22343326 TGGGAAAATAATCCCTTGCTAGG - Intergenic
904659588 1:32074405-32074427 TGTGAAAAACCTACCTTGCTGGG + Intronic
905142498 1:35859243-35859265 TAGAAAAAAACAGTGTTGCTGGG + Intergenic
905379965 1:37554755-37554777 TGGCAACAAACAGCCTTGAGAGG - Intergenic
905929963 1:41780067-41780089 TGGGAAGAACCAACCTTGCTAGG + Intronic
906271853 1:44485542-44485564 TGGGGAAAAACGGCCTTAGTTGG - Intronic
909165463 1:72217520-72217542 TGGGAAAAAACAGCATTACTTGG + Intronic
909412233 1:75367850-75367872 TGGGAAAAAAATGCCTTTGTGGG - Intronic
910655797 1:89616643-89616665 GGGGAAAAGACAACCTTTCTTGG + Intergenic
910760508 1:90727205-90727227 TGGGTGAAAACAGCCTAGGTCGG - Intergenic
916326318 1:163563831-163563853 TGGGAAAAATCATCATTGCATGG + Intergenic
918203603 1:182289788-182289810 TGGGAAAATACTACCTTTCTAGG + Intergenic
1063332320 10:5173204-5173226 TGGGAAAAAAAACCTTTTCTAGG + Intergenic
1063841415 10:10076185-10076207 TGGTAAAAAACAGCATGGGTTGG - Intergenic
1064228505 10:13508316-13508338 TGGGAAAAAAAGGACTTGTTTGG - Intronic
1066513982 10:36134481-36134503 TGGGCAAGGGCAGCCTTGCTTGG + Intergenic
1068478906 10:57563713-57563735 TAGGAAAAAACAGTCTTGAATGG - Intergenic
1069757522 10:70782289-70782311 TGGGAAAAAACTGGGGTGCTGGG - Intronic
1069793558 10:71038872-71038894 TGGGAATCAACAGCCCTGCTGGG + Intergenic
1070000250 10:72371082-72371104 AGTTAAAAAATAGCCTTGCTTGG + Intronic
1071361204 10:84847744-84847766 TGGGCAAAGACAGACTTGATTGG - Intergenic
1072070513 10:91910669-91910691 AAAGAAAAAACAGCTTTGCTTGG - Intergenic
1073229730 10:101958988-101959010 TAGTAAAAAAAAGCCTTGCCAGG + Intronic
1073466861 10:103699338-103699360 TGCCACAAAACAGCCTTGCCAGG - Intronic
1075508330 10:123046931-123046953 TGTGTGAACACAGCCTTGCTGGG + Intronic
1075656097 10:124162269-124162291 TAGGAGCCAACAGCCTTGCTAGG + Intergenic
1076667540 10:132101787-132101809 TGGGAAAGAACACCCTTGTGTGG + Intergenic
1079296600 11:19240880-19240902 TGGGCAAATACAGCCTTCCAAGG - Intronic
1080924545 11:36742759-36742781 TGGGAACCCAAAGCCTTGCTTGG + Intergenic
1082982449 11:59136122-59136144 TAGGAAGAAACGGCTTTGCTGGG + Intergenic
1083951241 11:65957656-65957678 TGGAAAAACTCAGCCTTGCTGGG - Intronic
1084521919 11:69668491-69668513 AGGGAGGAAACAGCTTTGCTGGG + Intronic
1085515335 11:77108274-77108296 AGGGAAAAGAGAGCCATGCTGGG + Intronic
1085877077 11:80421380-80421402 TGGGATAAAACTCCTTTGCTAGG - Intergenic
1089341874 11:117763605-117763627 TGGGGAAAAGCAGCCTGGCTGGG - Intronic
1090040858 11:123289975-123289997 TTGTTAAAAAGAGCCTTGCTGGG - Intergenic
1090981550 11:131726867-131726889 TGGAAAAAAATAGCCATGCATGG - Intronic
1092027307 12:5252683-5252705 TGGAAAAAAACAGACTTCATTGG - Intergenic
1092363938 12:7861462-7861484 TGGGAAAAAGCAGGTTTTCTAGG + Intronic
1092380663 12:7994238-7994260 TGGGAAAAAGCAGGTTTTCTAGG - Intergenic
1094189804 12:27686739-27686761 TCAGAAAACCCAGCCTTGCTAGG + Intronic
1094793999 12:33949527-33949549 AGCTAAATAACAGCCTTGCTTGG + Intergenic
1095669363 12:44840445-44840467 AAGGAAAAAAGAGCCTTGCTTGG - Intronic
1097323071 12:58246708-58246730 TTGTACAGAACAGCCTTGCTGGG + Intergenic
1097720460 12:63014393-63014415 TGAGAATAAAGAGCCTTTCTAGG - Intergenic
1097756385 12:63411002-63411024 TGTTAATAAATAGCCTTGCTTGG + Intergenic
1099665143 12:85619271-85619293 TGGAAAAAAACAGGCTTACATGG + Intergenic
1102707930 12:114898309-114898331 TGGGAATCAGCAGCCATGCTGGG + Intergenic
1105908034 13:24833719-24833741 TGGGAAAAGACAGTTTTGGTTGG - Intronic
1107256256 13:38431123-38431145 TGGGAAAAAAAAACCTTTCCTGG + Intergenic
1107568332 13:41629645-41629667 TGTGAAAAAACATCATTCCTAGG - Intronic
1109923341 13:69100366-69100388 TGGGAAAGAACAGCCTTATGCGG - Intergenic
1110122916 13:71905399-71905421 TTGGAATAAACCGCCTAGCTTGG + Intergenic
1111344421 13:86931531-86931553 TGGGAAAAAAAAAACTTGCCTGG - Intergenic
1111820200 13:93204588-93204610 TGGAAAAAAACAGCCTTGGTGGG + Intergenic
1112656060 13:101453703-101453725 TGGGAAAATACAGCCCTTCCAGG + Intronic
1115273677 14:31582927-31582949 CAGGAAAGAACAGACTTGCTTGG + Intronic
1115324070 14:32116891-32116913 TGGAAAATAACAGACTTGATAGG - Intronic
1116737132 14:48706191-48706213 TGGGAAAAAGCACACTTACTAGG + Intergenic
1119813852 14:77547483-77547505 TGAAAAAACACAGCCTTGCTGGG - Intronic
1120253983 14:82094783-82094805 TGTGAAGAAACAGCCTTCCGAGG + Intergenic
1121133032 14:91466710-91466732 TGGGAAAATAAACCCTTGTTAGG - Intronic
1121318327 14:92975235-92975257 TGGGCAAAATGAGCCTTGCTCGG + Intronic
1121622038 14:95356926-95356948 TGAGAAAAAAATGCCTGGCTTGG + Intergenic
1124185305 15:27520274-27520296 TGAGAAAGAACAGCCTTGCTTGG - Intronic
1126658822 15:51010999-51011021 TGGGAAAGAACAGGCCTTCTGGG + Intergenic
1126798554 15:52280296-52280318 TAGGAATAGACAGCCCTGCTGGG - Intronic
1127001000 15:54505153-54505175 AGGGAACAAACAGCCTAGCAGGG - Intronic
1128327933 15:66737259-66737281 TGGGTAAAACCAGCCTGGCAGGG - Intronic
1128741935 15:70089844-70089866 TGGAAACAAACAGCCTAGGTGGG + Intronic
1131557151 15:93409665-93409687 TGTGAAAAATAAGCCCTGCTTGG + Intergenic
1134587456 16:15424398-15424420 TGGCAAAAAACATCTTTTCTGGG - Intronic
1134680445 16:16121340-16121362 TGGGAACAACAAGGCTTGCTCGG - Intronic
1135375033 16:21938736-21938758 AGGAAAAAAACAGTCTTGGTAGG + Intergenic
1135536139 16:23296041-23296063 TGTGAAAAAACTGCCAAGCTTGG + Intronic
1135656678 16:24256248-24256270 TGGCAAAAAATAGCACTGCTGGG - Exonic
1135722553 16:24829715-24829737 TGGGAAGCAACAGCCCAGCTTGG + Intergenic
1138789861 16:59890705-59890727 TGGAAAAGAGCAGGCTTGCTGGG + Intergenic
1140923921 16:79565050-79565072 TGGAAATAAACAGCTTTGCAAGG + Intergenic
1141334367 16:83140883-83140905 TGGGAAAAAAATACATTGCTGGG - Intronic
1141596526 16:85100275-85100297 TGGGAAAACACAGCGTGGGTTGG + Intronic
1142069776 16:88085379-88085401 TACAAAAAAACAGCCTTGCGTGG + Intronic
1142069826 16:88085690-88085712 TAGAAAAAAACAGCCTTGCGTGG - Intronic
1143352395 17:6298269-6298291 TGGGAAAAAATAGGCATGCAGGG - Intergenic
1146426302 17:32742558-32742580 TTAGAAAAAACAGCCTTATTTGG - Intronic
1146627199 17:34443812-34443834 TGTGAAAAGCCAGCCTTGCATGG - Intergenic
1147930080 17:43974007-43974029 TGGGAAGCAACAGCCTGGGTCGG - Intronic
1148216171 17:45835075-45835097 TGGGAGAAGACAGCCTTGGAGGG - Exonic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149599181 17:57882176-57882198 TGGAAAAAAAAACCCTTTCTGGG - Intronic
1153591989 18:6683685-6683707 TTGACAAAAACAGCCCTGCTTGG + Intergenic
1153852598 18:9110169-9110191 CTGGAAAAAACAACCTAGCTAGG - Intronic
1155152240 18:23132665-23132687 AGAGACAAAACAGCCTGGCTGGG + Intergenic
1155317435 18:24586506-24586528 TGGGAAGCAGCAGCCTTTCTGGG - Intergenic
1155365154 18:25042255-25042277 TTAGAAAAAACAGCCAGGCTGGG - Intergenic
1157241318 18:46012247-46012269 TGGGACAAAACAGCACTGTTGGG + Intronic
1161216927 19:3099271-3099293 GGGGAGAACACAGCCCTGCTGGG - Intronic
1161932958 19:7353194-7353216 AGTGAAAAACCACCCTTGCTTGG - Intronic
1162625606 19:11882168-11882190 TGGGGAAGAACAGACTTACTGGG - Intronic
1163602025 19:18255075-18255097 GGGGAAAACCCAGCCTTCCTCGG + Intronic
1164216085 19:23150251-23150273 TGTGAAAAAACATCCTTACATGG - Intergenic
1164649669 19:29882767-29882789 TGGGGAGAAAGGGCCTTGCTTGG + Intergenic
1164813005 19:31172940-31172962 TGGGAAAAAACACCCAAGATAGG + Intergenic
1166633804 19:44431719-44431741 TTGGAGACAAGAGCCTTGCTGGG - Intronic
1168485543 19:56759201-56759223 TGGGCAAAATCACCCTGGCTTGG + Intergenic
925999490 2:9318964-9318986 CAGGAAAATACACCCTTGCTAGG - Intronic
926408993 2:12582193-12582215 TCAGAAATAACAGCCTTTCTTGG + Intergenic
926807800 2:16727528-16727550 TGGGAAAACAGAGGCTTACTAGG + Intergenic
927331514 2:21869821-21869843 TGTGAAGAGACAGCCTTGCTAGG - Intergenic
930246481 2:48988648-48988670 TGGGCAACAAAAGCCTTGCCAGG + Intronic
930614638 2:53580630-53580652 TAGGAAAAAAGAGCCATACTTGG + Intronic
931983930 2:67723366-67723388 TGGGAATTGACAGCCTTTCTTGG + Intergenic
932453912 2:71834213-71834235 TGAGAATCAACAGCCTAGCTCGG - Intergenic
933389357 2:81651348-81651370 TGGGAGGAAACAGCGTTCCTTGG - Intergenic
934939844 2:98492771-98492793 TGGGAAAACAGAGCCTAGCCAGG + Intronic
938013487 2:127847971-127847993 TTGGAGAAAACAGCCCAGCTTGG - Exonic
938958526 2:136320275-136320297 TTGGAAAAAAACGCCTTGCCAGG + Intergenic
939653738 2:144796493-144796515 TGGGAATGAAAAGCTTTGCTAGG + Intergenic
941050696 2:160730321-160730343 TGGAAAAATACATCCTTGTTAGG + Intergenic
943370466 2:187009987-187010009 TGGGTAGAAACAACCTTGCCAGG + Intergenic
945013311 2:205487721-205487743 TGGGAAAAATAAGCCTTTGTGGG - Intronic
946198052 2:218050095-218050117 TTGGAAAAAACACCTTTGATTGG - Intronic
948267869 2:236649836-236649858 TACAAAAAAAAAGCCTTGCTGGG + Intergenic
948359109 2:237405803-237405825 GGGGAAAAAATAGACTTCCTTGG + Intronic
948772608 2:240259205-240259227 GGGGAAACAAAAGCCTGGCTGGG - Intergenic
1169481953 20:5990686-5990708 TGGGAAAAAATATCTCTGCTAGG - Intronic
1170606051 20:17875792-17875814 TGGAAAAAATCAGCCTGGCATGG - Intergenic
1172518718 20:35553731-35553753 TGGGAGAAAAGGGTCTTGCTGGG + Intronic
1173068463 20:39737285-39737307 CCTGAAAAAACAGCCTTGCATGG - Intergenic
1173328926 20:42058109-42058131 TGGAGAGAAACAGCCTTCCTAGG - Intergenic
1177580125 21:23010917-23010939 TGGAAAAAATGAGCCTTTCTGGG + Intergenic
1178380061 21:32100367-32100389 TGGGAAAGAACAGCCTTGAGGGG - Intergenic
1178746066 21:35251422-35251444 TGGTAAATAGCTGCCTTGCTAGG - Intronic
1179091408 21:38269382-38269404 TGTGAAAAAACTCACTTGCTGGG + Intronic
1181158767 22:20943647-20943669 AGGGAAAGAATAACCTTGCTGGG - Intronic
1181171026 22:21010161-21010183 AGGAAAAAAATGGCCTTGCTGGG + Intronic
1182034902 22:27190313-27190335 TGGGAAGAAAAAGCTTTGCAGGG - Intergenic
1183471238 22:38007800-38007822 TGGGGAATTACAGCGTTGCTGGG + Intronic
1184573401 22:45341711-45341733 TGGAAACAAACAGCCCTGCTTGG + Exonic
1185337844 22:50278700-50278722 TGGGAAGAGACAGCCCAGCTTGG + Intronic
950562920 3:13745994-13746016 TGTGAAAAAACACCCTTGAGAGG - Intergenic
950703452 3:14766091-14766113 TGGGAAACAGCAGCCCAGCTCGG + Intronic
952231049 3:31431576-31431598 TGGCAAAATTCCGCCTTGCTTGG + Intergenic
953550958 3:43902405-43902427 TGGAAATATACAGCCTTGCAAGG + Intergenic
954739710 3:52738735-52738757 TTTAAAAAAACAGCCCTGCTGGG - Intronic
954901082 3:54020672-54020694 TGGGAATAAAAAGCCTTTCCAGG + Intergenic
956086476 3:65616291-65616313 TGGGAAAATACAGTCATGATGGG + Intronic
956240291 3:67122550-67122572 TGGAAAAAAACAGCCTTATCAGG - Intergenic
956685638 3:71824991-71825013 TGGGAAAAAAAAGTCAAGCTGGG + Intergenic
958829327 3:99068347-99068369 TGGGAAAAAACAGGTGAGCTGGG - Intergenic
959842638 3:110996080-110996102 TGGGCAAACACATTCTTGCTTGG + Intergenic
961163514 3:124749146-124749168 TGGCAGAAAACAACATTGCTAGG - Intergenic
961549905 3:127663517-127663539 TGGGGGAAACCAACCTTGCTGGG - Intronic
961666790 3:128497738-128497760 TGGAAAAATACAGCCTTTGTCGG - Intergenic
961989631 3:131174093-131174115 TATGAAAATACAGCCTTGATAGG + Intronic
966828762 3:183988064-183988086 TGGGAAAAAATACCCTTCCTAGG + Intronic
970682348 4:18524843-18524865 TGTGGAAAAACACACTTGCTTGG - Intergenic
973137936 4:46730229-46730251 TGTGAAAACACAGGATTGCTAGG - Intergenic
976088593 4:81431315-81431337 TGGGATATAACAGGCTTGTTGGG - Intronic
977876088 4:102151615-102151637 TGGGATAAAACAGCCCAGCATGG + Intergenic
978326600 4:107564445-107564467 TGTGCTAAAACAGCCTTGCTGGG + Intergenic
979734301 4:124063565-124063587 TGGGAAAACATAGCCTTGGAAGG + Intergenic
981028723 4:140102418-140102440 CAGGAGAAACCAGCCTTGCTTGG - Intronic
982821862 4:159950886-159950908 TGCAAAACAACAGCCATGCTGGG - Intergenic
983987774 4:174081161-174081183 TGGGAAAAAACCCTCTGGCTTGG - Intergenic
985745365 5:1643766-1643788 TGGGAAGAAACAGCTCTGCCGGG - Intergenic
985822559 5:2170115-2170137 CGGGGAATAACAGCCTTGCAGGG + Intergenic
986323760 5:6655887-6655909 TAGGAAAACAAAGCCCTGCTTGG + Intronic
986559633 5:9047677-9047699 TTGTCAAAAACATCCTTGCTAGG + Intronic
988176821 5:27737654-27737676 TGTGTAAACACAGCATTGCTGGG - Intergenic
990816314 5:59789506-59789528 TGGGGAAAAACAGTATTACTTGG + Intronic
991702787 5:69331750-69331772 TGAGAAGAAACAGCATTCCTGGG - Intronic
995390542 5:111635876-111635898 TTTGAAAATGCAGCCTTGCTTGG - Intergenic
998586428 5:143432063-143432085 GTGGTAAAAACTGCCTTGCTTGG + Intronic
998956288 5:147441788-147441810 TGGGAAAAAACAGCCTTGCTTGG - Intronic
999511405 5:152256555-152256577 TGGGAAAAATCACCCTCCCTAGG - Intergenic
1000054516 5:157593124-157593146 TGGGAGAAAACTCCCATGCTAGG - Intergenic
1001307404 5:170585532-170585554 TGGGCAGAAACTGCCATGCTGGG - Intronic
1001815302 5:174663729-174663751 TGGGACAAAAGAGGCTTGCTAGG + Intergenic
1001861288 5:175057956-175057978 CGGGAAAAAACAGACAAGCTTGG + Intergenic
1002543223 5:179920050-179920072 TGGAAACAGCCAGCCTTGCTGGG + Intronic
1003153478 6:3571987-3572009 TGGGGGAAATGAGCCTTGCTCGG + Intergenic
1003199302 6:3944223-3944245 TGGGAAAACTCATCCCTGCTGGG - Intergenic
1003523608 6:6880294-6880316 CGAGAAGAAACAGCATTGCTTGG - Intergenic
1011513831 6:88130320-88130342 TGTGAAAAAACAGCTTTGGGAGG + Intergenic
1012932044 6:105327438-105327460 TGGGAAAGTAAAGCCTGGCTAGG + Intronic
1013976960 6:116090289-116090311 TGAGAGAAAACAGCTTTGCAGGG + Intergenic
1017648712 6:156562358-156562380 TGGGAAAAACCTGCCTTGACGGG - Intergenic
1018165423 6:161089951-161089973 TGGAAAAAGACAGCCAGGCTGGG - Intronic
1018780206 6:167056910-167056932 TGGGAAACAGCAGCCTTGGGAGG - Intergenic
1019187616 6:170229997-170230019 TGGGGCAAAACTGCCCTGCTGGG - Intergenic
1019510275 7:1414216-1414238 TGGAGAAAAGCAGCCTGGCTTGG + Intergenic
1021445504 7:20729477-20729499 TGGGAAGAAGCAGCCTCACTGGG - Intronic
1023756222 7:43419774-43419796 AAAGTAAAAACAGCCTTGCTGGG - Intronic
1023760469 7:43461158-43461180 TGGGAGAGAACTGCCTAGCTGGG - Intronic
1023764913 7:43501533-43501555 TGGGAAAAAAATGTTTTGCTGGG + Intronic
1027192338 7:76004000-76004022 TGGAAAAAAACATCCAGGCTGGG + Intronic
1028471031 7:91206456-91206478 TGGGAAAAGAATGCCTTGCCAGG - Intronic
1028842706 7:95445342-95445364 TGGCAAAAAAAAGTCATGCTTGG - Intergenic
1032514259 7:132495186-132495208 GGGGCTAAAACAGCTTTGCTTGG - Intronic
1032680581 7:134178706-134178728 AGGGAAAAAGCAGCCTTTATAGG - Intronic
1032748628 7:134813713-134813735 TGGGAAACAGCAGACTTGCCAGG + Intronic
1034364977 7:150538468-150538490 TGGTAAAGAACATCTTTGCTGGG - Intergenic
1034391806 7:150793036-150793058 TGGGAAAAAAGAGCTGTGATGGG + Intronic
1034560963 7:151878730-151878752 TGGGACAATACAGTCTTGCTGGG - Intergenic
1035520373 8:271321-271343 CGGGAGGAAACAGCCTTGGTAGG - Intergenic
1035925796 8:3726246-3726268 TGGGAAAGAACAGCCCAGCTAGG + Intronic
1038049295 8:23793985-23794007 TGGGAAAAAAAAGTCTTACAAGG + Intergenic
1038661091 8:29497621-29497643 TGGGAGAAAACAGCTTACCTAGG + Intergenic
1038682226 8:29679468-29679490 AGGGAAAAGACATTCTTGCTTGG - Intergenic
1038956233 8:32471356-32471378 GGGGAAAAAACAGACTCACTTGG - Intronic
1039221855 8:35340423-35340445 TGGGAACTAACTGCCTTACTTGG + Intronic
1039270232 8:35872517-35872539 TGGGAAAACACAGACATGATGGG + Intergenic
1040319689 8:46286322-46286344 TGGGAAGAAACAGGCCTCCTTGG + Intergenic
1041389220 8:57334181-57334203 GGCAAAAAAACACCCTTGCTAGG - Intergenic
1046319863 8:112558369-112558391 TTTGAACAAACAGGCTTGCTGGG + Intronic
1048439918 8:134452340-134452362 TAGTAATAAACAGCCTTGATAGG - Intergenic
1051335710 9:16064232-16064254 GGGGAAAAAACGGCCTCACTGGG - Intergenic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1052965933 9:34340699-34340721 TGGGAAAAAGGAGCCCTTCTTGG + Intronic
1053104904 9:35400992-35401014 TGGGAGAAAACCGGCTTCCTGGG - Intronic
1056726347 9:89122451-89122473 TGGAAAAAAACAACCTTTGTTGG + Intronic
1057697396 9:97334653-97334675 TGGGAAAAAATAGCCTATATAGG - Intronic
1058123661 9:101167299-101167321 TTGGAAAATGCAGCCTTGCTTGG + Intronic
1059844088 9:118251857-118251879 TGGCAAAAAACTGCCTTAGTAGG + Intergenic
1059980656 9:119768221-119768243 TGGTATAAGACAGACTTGCTTGG - Intergenic
1061454296 9:130686104-130686126 TGTGAAGAAACAGCCATGCCTGG - Intergenic
1061578602 9:131523117-131523139 TGGCAAAGAACACCCGTGCTGGG + Exonic
1061696966 9:132383418-132383440 TGTAAAATAACATCCTTGCTTGG + Intronic
1061870198 9:133516344-133516366 TGGGGAACGACAGCCTTGTTGGG + Intronic
1062024533 9:134334185-134334207 TGGGAAAAAAGAGGCTGGATGGG - Intronic
1186720389 X:12297503-12297525 TGGGAAAAAACAGAATTGTGGGG + Intronic
1188745056 X:33831025-33831047 TGGGGAAAAAGAGCCTTGCAAGG + Intergenic
1189777860 X:44486213-44486235 GGGGAAAAAACTGTCCTGCTGGG - Intergenic
1190912991 X:54789108-54789130 TGGGAAACAGCAGCCTAGCAAGG + Intronic
1197850885 X:130859030-130859052 TAAGAAATAACAGCCTGGCTGGG + Intronic
1198120858 X:133591178-133591200 TGGGAATAAAGAGCATGGCTCGG - Intronic
1198483888 X:137067018-137067040 TGCCCAAAAACAGCATTGCTGGG - Intergenic