ID: 998956626

View in Genome Browser
Species Human (GRCh38)
Location 5:147445413-147445435
Sequence GCTTATGTACAAGAACAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998956623_998956626 19 Left 998956623 5:147445371-147445393 CCTTATTTAGAAGTTAATATTCT 0: 1
1: 1
2: 3
3: 36
4: 451
Right 998956626 5:147445413-147445435 GCTTATGTACAAGAACAAATTGG 0: 1
1: 0
2: 0
3: 7
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998956626 Original CRISPR GCTTATGTACAAGAACAAAT TGG Intronic
909379784 1:74985287-74985309 GGATATGTACAAGAAAAGATGGG + Intergenic
911381123 1:97116370-97116392 GCTGATGTAAAATGACAAATTGG + Intronic
912064930 1:105725848-105725870 GCTTATGAAGAAGAACACAGTGG + Intergenic
913693882 1:121305667-121305689 GCTTAAGTTCAAAAACAGATGGG + Intronic
914143682 1:144974399-144974421 GCTTAAGTTCAAAAACAGATGGG - Intronic
916319456 1:163487338-163487360 GTTTATGAACAAAAACAAAAGGG - Intergenic
917095588 1:171396009-171396031 AATTATGTAGAAGAAAAAATTGG + Intergenic
918856842 1:189766413-189766435 GCTTATGTATAAGAAAGTATAGG - Intergenic
920481206 1:206324046-206324068 GCTTAAGTTCAAAAACAGATGGG + Intronic
924590585 1:245400350-245400372 GGTTACAGACAAGAACAAATTGG + Intronic
1063960486 10:11301764-11301786 GCTTATGTGCCAGAGAAAATAGG - Intronic
1064346425 10:14536861-14536883 GCATTTGTACAACAACATATTGG - Intronic
1064425809 10:15228309-15228331 GCCAAAGTACAAGAACAAAGTGG + Intronic
1067818653 10:49506081-49506103 GATAATGTACAAGAAAAAACAGG + Intronic
1069163311 10:65117128-65117150 GATAATGTGCAAGAACAGATGGG - Intergenic
1072913688 10:99524044-99524066 GCTTTTCTACAAGCACCAATGGG - Intergenic
1073501740 10:103945470-103945492 CCTTATAAACAAGAACAAACAGG + Intergenic
1074796848 10:116955222-116955244 GTTTATGTACAAGAAAATTTAGG + Intronic
1077657173 11:4030471-4030493 GTTTATGTAAAAGCAAAAATGGG - Intronic
1080019451 11:27544743-27544765 GCTTATGTAAAGGGAAAAATTGG - Intergenic
1080074434 11:28132422-28132444 GTTAAGGGACAAGAACAAATTGG - Intronic
1080984731 11:37448085-37448107 GTTTATGTATAAGAACATCTTGG - Intergenic
1083261010 11:61523233-61523255 GCTGATGTACAAGGACAAGCGGG - Exonic
1086616657 11:88829842-88829864 GATTATGTACAAGCAAAAAACGG + Intronic
1087646355 11:100812750-100812772 GCTAAAGCACAGGAACAAATGGG + Intronic
1087729632 11:101763852-101763874 GCTGATGTACAAAAGCAAATAGG + Intronic
1088487667 11:110356297-110356319 GATTAAGTACTAGAACAATTAGG - Intergenic
1090407136 11:126483254-126483276 GCTTATGTTCAACAAAGAATGGG - Intronic
1090513864 11:127403827-127403849 GCTTATATAAAAAAATAAATGGG - Intergenic
1090650933 11:128805344-128805366 TCTAATGAACAATAACAAATAGG - Exonic
1091119871 11:133047966-133047988 GTTTCTGGACAAGGACAAATAGG - Intronic
1102618506 12:114175342-114175364 GATTATATCCAGGAACAAATGGG + Intergenic
1102828685 12:115974110-115974132 CTTTATTTACAAAAACAAATGGG - Intronic
1103103028 12:118197092-118197114 GCTCAGGTACAAGAACTAAATGG + Intronic
1106597371 13:31157495-31157517 GCTTATGTTTAATAAGAAATTGG - Intronic
1107515062 13:41121043-41121065 GCTTATTTAAAAGAATAAAAAGG + Intergenic
1110369321 13:74721810-74721832 GCTTTTGCACAAGTTCAAATAGG + Intergenic
1110716472 13:78710508-78710530 GCATATGTACCATTACAAATAGG - Intergenic
1114196511 14:20481805-20481827 GCCTATTTACAAGAAAAAAAAGG - Intergenic
1114343196 14:21767322-21767344 GCTTATCTACAAGAATAATTTGG - Intergenic
1118062301 14:62152870-62152892 GTTCATGAACAAGAACATATAGG - Intergenic
1118452933 14:65920315-65920337 ACTCACGTAGAAGAACAAATAGG - Intergenic
1120683467 14:87509293-87509315 TCTTAAGCACAAGAACAATTGGG + Intergenic
1120739572 14:88092834-88092856 GCTTATGTAGGAGGATAAATGGG - Intergenic
1127501794 15:59560647-59560669 TCTTAGGTACAAGAAAAGATGGG + Intergenic
1130574526 15:85080047-85080069 GCTTAAGTAAAAGAACATAGAGG + Intronic
1133079625 16:3308340-3308362 GCTTTTGTACAAGACCAGACAGG + Intronic
1144542878 17:16161595-16161617 GTTAATGTAAAAGAACAAACAGG - Intronic
1146894256 17:36529947-36529969 GCTTAGGTAGAAGAACCACTTGG + Intronic
1149130835 17:53299910-53299932 GAGTATGAGCAAGAACAAATAGG + Intergenic
1149173842 17:53845605-53845627 GCTAATGGAGAAGAAAAAATTGG + Intergenic
1149391893 17:56200144-56200166 GCTTAAGTAGAGGAACAAACAGG + Intronic
1149400730 17:56293479-56293501 GCATATGTGCAAGAATACATTGG - Intronic
1149665658 17:58363313-58363335 GTTTGTGTACAAGAACCAAAAGG - Exonic
1149829516 17:59859475-59859497 GCTTAAGTACAAAAGTAAATAGG - Exonic
1203192535 17_KI270729v1_random:203485-203507 TTTTATGTAAAAGAACAAACAGG + Intergenic
1203201900 17_KI270730v1_random:2920-2942 TTTTATGTAAAAGAACAAACAGG + Intergenic
1153093312 18:1372710-1372732 GCTCAGGTACAAGAAATAATCGG + Intergenic
1153322021 18:3782689-3782711 TCTTATTTAAAAGAACAAAGAGG - Intronic
1154928316 18:20963131-20963153 ACATATGTACAAAAACAACTTGG + Intronic
1155852145 18:30787481-30787503 GCTTATTTAGAAAGACAAATAGG - Intergenic
1156142149 18:34126892-34126914 GGTTATCTACATGAACAAAACGG - Intronic
1157745767 18:50133955-50133977 CCTTATGTATAAGAAAAGATGGG + Intronic
1159970297 18:74643268-74643290 GCTTATGTTCAGGAACTAATAGG - Intronic
1165477708 19:36040760-36040782 GTTGATGTGGAAGAACAAATTGG - Intronic
1166025137 19:40076413-40076435 GGTTATGTACATGTAAAAATAGG + Intronic
1168487168 19:56773383-56773405 GTTTATGCATAAGAAAAAATGGG + Intergenic
926566106 2:14475951-14475973 TCTAATGGAAAAGAACAAATAGG + Intergenic
927687658 2:25183108-25183130 GCTTATGAACAAGGACAGCTTGG + Intergenic
929341937 2:40830319-40830341 GCTGATGGACAAGCACATATGGG + Intergenic
937343798 2:121110098-121110120 ACATATGTACATGAACAAAATGG + Intergenic
939030320 2:137067074-137067096 GACAATGTGCAAGAACAAATGGG - Intronic
939840185 2:147177969-147177991 GCTTGTGTACAAGAAAACTTTGG - Intergenic
942691169 2:178586857-178586879 TCTTATGTACATTAACAAAGGGG - Intronic
943574404 2:189614297-189614319 ACTTAAGTCTAAGAACAAATGGG - Intergenic
944930724 2:204516461-204516483 GCTAATGGGCAAGAAGAAATGGG + Intergenic
945839528 2:214870720-214870742 GAAAATGTACAAGAAGAAATTGG - Intergenic
946741285 2:222804435-222804457 GCATATGTACCAGCACACATAGG - Intergenic
1171518174 20:25756065-25756087 GTTAATGTAAAAGAACAAACAGG + Intergenic
1171558687 20:26100137-26100159 GTTAATGTAAAAGAACAAACAGG - Intergenic
1175550605 20:59814831-59814853 GCTTCAGAACAAGAAAAAATGGG - Intronic
1176652330 21:9562471-9562493 GTTAATGTAAAAGAACAAACAGG + Intergenic
1176698722 21:10015737-10015759 GAGTATCTACAAGAACAAGTAGG - Intergenic
1177690888 21:24505983-24506005 GATTATGAAAAAGAACTAATGGG - Intergenic
1180216926 21:46330095-46330117 GCTGATGTCCAAGATCCAATAGG - Intronic
950806441 3:15607373-15607395 GATTATGAAAAAGAGCAAATTGG + Intronic
951089788 3:18559145-18559167 GATAATGTATAAGAAGAAATTGG - Intergenic
951846674 3:27091988-27092010 GCTTATATACAAAATCAACTAGG + Intergenic
953576930 3:44120258-44120280 GGTGATGTACAAGAAGAAACAGG - Intergenic
954852126 3:53611647-53611669 ACTTATGAACAAGATCAACTGGG - Intronic
954894917 3:53967001-53967023 TGTTATGTATAAGAACAATTGGG - Intergenic
955515720 3:59724615-59724637 GCTGATGTACAAAGACAAAGGGG - Intergenic
955798132 3:62659020-62659042 GCTTATGTAAAAGAGGAGATCGG - Intronic
956105362 3:65811825-65811847 GCTTAAGTAAAAGAACAAGGGGG - Intronic
956285124 3:67600625-67600647 GCTTAGGAAAAAGAAGAAATGGG - Intronic
958565194 3:95801383-95801405 GCTTATGTAAAAGAATTAAAAGG - Intergenic
959157179 3:102680877-102680899 CATTATATACAAGTACAAATGGG - Intergenic
959564557 3:107821131-107821153 GCTCATATACAAAAAAAAATTGG + Intergenic
960027183 3:113022591-113022613 GCTTTTGTAATAGAACAGATGGG - Intergenic
960634569 3:119770344-119770366 TCTTTTGTACAAGGATAAATGGG - Intergenic
963047652 3:141114779-141114801 GTTTATGGACAAAAACATATTGG - Intronic
963764992 3:149325180-149325202 GCTTATTTTTAAGATCAAATAGG - Intronic
964197353 3:154080144-154080166 GCATATGAACATGAAAAAATGGG + Intergenic
966654655 3:182342114-182342136 GGTTATGTTCAAGACCTAATGGG - Intergenic
970365418 4:15353505-15353527 GCTTGTGTATCAGACCAAATCGG + Intronic
971142524 4:23939800-23939822 GTTTATCTACAAGAACAATGAGG + Intergenic
973755238 4:54067512-54067534 GCTTATCTCCAGGAAGAAATTGG - Intronic
974304982 4:60124562-60124584 AAATATGTACAAGAACAATTGGG + Intergenic
974522323 4:62998493-62998515 GACTATGTACACAAACAAATTGG + Intergenic
976252596 4:83068256-83068278 GCTTATGTACAGCAAGAATTGGG + Intronic
976671014 4:87653960-87653982 GCTTATGTCCAACAAAACATGGG + Intronic
980371191 4:131875086-131875108 GAGTATCTACAAGAACAAGTAGG - Intergenic
980710817 4:136564720-136564742 GCTTATGTACGAGAACCAGGAGG - Intergenic
980871095 4:138611843-138611865 CCTTATTTACAAAAACAAATAGG - Intergenic
982258234 4:153470648-153470670 GCTTATTTTCAAGAAGTAATTGG + Intronic
989455676 5:41640826-41640848 TCTGATGTACAATAACAAAATGG - Intergenic
990015676 5:51059175-51059197 GCTTATGGAGAAGAATAAAAGGG + Intergenic
993748468 5:91632855-91632877 GCTTAAGTAATGGAACAAATAGG + Intergenic
994090081 5:95802237-95802259 GATTATGTACAAAAGCTAATAGG + Intronic
996124861 5:119712497-119712519 GCTTTTCTCCAATAACAAATTGG + Intergenic
996414523 5:123195825-123195847 GCTTATATACAAAAATGAATAGG + Intergenic
996845121 5:127890342-127890364 GCTTATCTACAGGAGCAACTGGG - Intergenic
997211622 5:132080311-132080333 AATTATGTTCCAGAACAAATGGG - Intergenic
998671168 5:144355877-144355899 GCTGATTTACAAGAATAGATAGG - Intronic
998956626 5:147445413-147445435 GCTTATGTACAAGAACAAATTGG + Intronic
998963611 5:147513503-147513525 ACTTCTGTCCAAGAACAACTGGG - Intergenic
998975245 5:147638103-147638125 AATTAGGTACAAGAAAAAATAGG - Intronic
1000587301 5:163116163-163116185 GCAATTGTACACGAACAAATTGG - Intergenic
1003513853 6:6802729-6802751 GCTCATGACCAAGAACAAAGAGG - Intergenic
1004068592 6:12275842-12275864 ACTTATGTACAAATACAAATGGG - Intergenic
1004092205 6:12515211-12515233 TCTTATCTGCAAGCACAAATTGG + Intergenic
1008007828 6:46430718-46430740 AGTTATGTACAATAGCAAATTGG + Intronic
1011891637 6:92169804-92169826 GCTTATGAACAAAAAAAAGTAGG - Intergenic
1014268577 6:119310926-119310948 GCTTTTCTACAAGTACACATAGG - Intronic
1014331606 6:120073934-120073956 GCTCATGTATAAGCAGAAATAGG - Intergenic
1014813899 6:125914378-125914400 ACTTGTGGACAAGAACAGATAGG + Intronic
1015230367 6:130908213-130908235 GGGATTGTACAAGAACAAATGGG + Intronic
1023432009 7:40103446-40103468 GATTATCTACAAGAAGAAATAGG + Intergenic
1024831099 7:53458673-53458695 GCTTTTGCACATGATCAAATAGG + Intergenic
1028341703 7:89730345-89730367 GCTTTTGAATAAGAAAAAATTGG + Intergenic
1028556083 7:92126559-92126581 GACTATGTACAACAACAAAGAGG + Intronic
1030713152 7:112777305-112777327 GTTTCTGTAGAAGAAAAAATTGG - Intronic
1031467497 7:122130971-122130993 CCTTCTGTATAAGAACAAAAGGG + Intronic
1031548386 7:123078678-123078700 GAATAAATACAAGAACAAATGGG - Intergenic
1032806052 7:135355375-135355397 AGTTATGTAGAAGAAGAAATAGG - Intergenic
1033591895 7:142815862-142815884 TCTTCTGTAGAGGAACAAATAGG - Intergenic
1036817745 8:11914479-11914501 CCTTATGAACAAGAACACAGAGG - Intergenic
1037399872 8:18484752-18484774 GCTTTTTAACAACAACAAATGGG + Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1043420592 8:80094329-80094351 GCGTAAGAATAAGAACAAATTGG - Intronic
1044835989 8:96296437-96296459 CCTTATGAAAAAGAACACATGGG - Intronic
1047636873 8:126773386-126773408 GTTTTTGTACAAGGACAGATGGG - Intergenic
1047996985 8:130346410-130346432 GCTAATGAAAAAGAACAAACAGG - Intronic
1051798293 9:20901094-20901116 GTTTATATACAAGAAATAATGGG - Intronic
1052027712 9:23592261-23592283 CCTTATTTTCAAGAAGAAATTGG - Intergenic
1053635823 9:40001940-40001962 GAGTATCTACAAGAACAAGTAGG - Intergenic
1053770161 9:41462690-41462712 GAGTATCTACAAGAACAAGTAGG + Intergenic
1054316699 9:63599049-63599071 GAGTATCTACAAGAACAAGTAGG - Intergenic
1054548834 9:66374188-66374210 GAGTATCTACAAGAACAAGTAGG + Intergenic
1055599667 9:77902711-77902733 TGTTTTGTACAAAAACAAATTGG - Intronic
1056068795 9:82964467-82964489 GCCTATGTACAAGGAGAAAATGG - Intergenic
1056446683 9:86673309-86673331 GATAATGTATAAGAACAAACTGG + Intergenic
1057054824 9:91952105-91952127 GCTTACGTCCAAGGCCAAATTGG + Intergenic
1057680686 9:97180477-97180499 GTTTATGGACAAGAAAAAATGGG - Intergenic
1203630059 Un_KI270750v1:66017-66039 GTTAATGTAAAAGAACAAACAGG + Intergenic
1186170744 X:6873762-6873784 GGCAATGTACAAGAATAAATTGG - Intergenic
1186834141 X:13420593-13420615 CCTTATGCACAAGAACATACAGG - Intergenic
1187624749 X:21098310-21098332 GATTATGAAAAATAACAAATGGG + Intergenic
1194235361 X:91376636-91376658 GCTACTCTACAAGAACAAGTGGG + Intergenic
1195391791 X:104369897-104369919 TCTTATGTATAAGAACCACTTGG + Intergenic