ID: 998958717

View in Genome Browser
Species Human (GRCh38)
Location 5:147463147-147463169
Sequence GTGTGCTAACAGAAAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998958717_998958724 28 Left 998958717 5:147463147-147463169 CCAGCACCTTTCTGTTAGCACAC 0: 1
1: 0
2: 1
3: 5
4: 139
Right 998958724 5:147463198-147463220 AGAAGAAAAAAATCTGAGCCTGG 0: 1
1: 0
2: 11
3: 186
4: 2088

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998958717 Original CRISPR GTGTGCTAACAGAAAGGTGC TGG (reversed) Intronic
901487696 1:9576591-9576613 GTGGGGTAACAGAAAGGAACTGG + Intronic
902750558 1:18506610-18506632 GTGGGCTAACATCAAGGTGTTGG + Intergenic
903057375 1:20645578-20645600 GTGTGTTCACACAAAGGTACTGG - Exonic
905149319 1:35914768-35914790 GTGTGCTTACAGAAATGTGAGGG - Intronic
907272137 1:53297411-53297433 GTGTCCTGACAGTAGGGTGCAGG + Intronic
908767081 1:67564046-67564068 GTGTGCTAGCTGCTAGGTGCTGG + Intergenic
909577830 1:77195193-77195215 GTGGGCGATGAGAAAGGTGCTGG + Intronic
914746404 1:150504703-150504725 GAGTGCTGGCAGAAAGCTGCGGG + Exonic
919608903 1:199720711-199720733 ATGTGCAAACAGAAAGGGGTGGG - Intergenic
1063794787 10:9501282-9501304 GTGTGCTACCAGAGGGGTGGAGG - Intergenic
1064203305 10:13302166-13302188 CTGTGCAAACAGGAAGGGGCTGG - Intronic
1064883654 10:20085160-20085182 GTGTGCTTAAAAAAAGGTGGGGG + Intronic
1067231530 10:44414950-44414972 GTGAGGTAACAGAAAGGAACCGG - Intergenic
1068178439 10:53491996-53492018 GTGAGCTAACAGAAGAGTACAGG - Intergenic
1069069518 10:63978898-63978920 GTCTTCTAACAGCAAGCTGCAGG + Intergenic
1069174412 10:65272089-65272111 GTGAGCTAGCAGAAATGTACTGG - Intergenic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1073493802 10:103873293-103873315 GTGTGGTAACAGGATGGGGCAGG + Intergenic
1074346608 10:112692399-112692421 GTGTGCTTCCATGAAGGTGCAGG - Intronic
1075532674 10:123243258-123243280 ATGTGCTAAAAGGAAGGGGCAGG + Intergenic
1076618831 10:131774061-131774083 GTGTGCTCAGAGTAAGTTGCTGG + Intergenic
1078040488 11:7857800-7857822 GATGGCTAACAGAAAGATGCTGG + Intergenic
1084842109 11:71862559-71862581 GTGTGTTAACAGGATGGTTCAGG + Intergenic
1085261939 11:75210911-75210933 ATGGGCTAACTGGAAGGTGCTGG + Intergenic
1086025905 11:82291185-82291207 GTATGCTAACAGAAATAAGCTGG - Intergenic
1087452322 11:98340873-98340895 GTGTGCCCAGAGAAAAGTGCAGG - Intergenic
1088452087 11:109993159-109993181 GTGTGATAACAGAAAATTGGAGG - Intergenic
1089216561 11:116837782-116837804 GTGGGCAAACAGCAAGCTGCGGG + Exonic
1089600445 11:119611220-119611242 GTGGGCTAAAAGGATGGTGCAGG + Intergenic
1089732842 11:120530110-120530132 GTGTGCCAACCACAAGGTGCGGG + Intronic
1091033946 11:132216464-132216486 GTTTGATGACAGAAAGGTGAAGG - Intronic
1092317304 12:7431507-7431529 GTGTGCTAACAGAGAAATGAAGG + Intronic
1092601725 12:10073486-10073508 GTGTGCTTTGAGAAAAGTGCTGG - Intronic
1096517553 12:52165512-52165534 GTGAGTTAACAGACAGGAGCAGG - Intergenic
1096523585 12:52197876-52197898 GTGTGCTCACAGAGCTGTGCAGG - Intergenic
1102022384 12:109692837-109692859 CTGTCCTAGCAGAAAGGTGAAGG - Intergenic
1102037194 12:109777944-109777966 GTATGCAAACAGAGAGGTGTAGG + Intergenic
1105791542 13:23805085-23805107 GTCTTGTAACTGAAAGGTGCAGG - Intronic
1108267803 13:48730007-48730029 GTGTGCAAACAGCAGGGTGGTGG - Intergenic
1109501636 13:63243635-63243657 GTGTTTTAACAGCAAGGTACCGG - Intergenic
1110519635 13:76459973-76459995 GTTTGCAGACAGAAAGGTTCGGG - Intergenic
1113897030 13:113771132-113771154 GGGTGCTAAGAGAAGGGTGTGGG - Intronic
1116003074 14:39265278-39265300 GTGTGGAAACAGAAGAGTGCAGG + Intronic
1117047908 14:51831208-51831230 ATGTGCTAACACAAAGGAGGAGG - Intronic
1117221277 14:53608974-53608996 CTGTCCTCACAGTAAGGTGCTGG + Intergenic
1121793144 14:96713813-96713835 GTGTGCTGGGAGAAAGGTGAAGG - Intergenic
1121862638 14:97332968-97332990 ATGTGCCAACAGAAAGGCACTGG - Intergenic
1126930260 15:53640141-53640163 ATGGGCTAACTGAAATGTGCAGG - Intronic
1126963726 15:54027881-54027903 GTGTGCTACCACAAAGCTGAAGG + Intronic
1130094720 15:80847431-80847453 GTGAGCCAACAGAAAGCTTCCGG + Intronic
1130262873 15:82372687-82372709 GTGGGGTAACAGAAAGGAACTGG - Intergenic
1130976728 15:88782259-88782281 CTATGGTAACAGAAAGGTGAAGG + Intergenic
1130984841 15:88838050-88838072 GTGTGCAAACAGTCAGATGCAGG - Intronic
1133143063 16:3762510-3762532 ATCTTCTTACAGAAAGGTGCTGG - Intronic
1133786488 16:8977783-8977805 GTGTACTTAGAAAAAGGTGCAGG - Intergenic
1134636561 16:15796465-15796487 GTGTGGTAACAGAGAGGTGCAGG - Intronic
1135646723 16:24169403-24169425 GTAGGCTAACACAAAGGTTCGGG - Intronic
1136090630 16:27917355-27917377 GTGTGCTGAGAGAGAGGGGCGGG + Intronic
1136271868 16:29153405-29153427 GTGTGGAAAGAGAAAGGTGCCGG + Intergenic
1139391968 16:66610838-66610860 GTTTCCTAACAGCCAGGTGCTGG + Intronic
1140195753 16:72854045-72854067 GTGTGCTAACATGAGGGTCCTGG + Intronic
1142253094 16:89001767-89001789 GTGAGCTGACATCAAGGTGCGGG + Intergenic
1143006943 17:3843147-3843169 GTGTCCTAACACAAAGGGGAAGG + Exonic
1148136191 17:45293428-45293450 GTGTGCTCACAGAGGGGCGCTGG - Intronic
1152223197 17:79080595-79080617 GTGTGCTCACAGGCAGGGGCGGG - Intronic
1158696443 18:59708308-59708330 GTGGGCTAAAATCAAGGTGCTGG + Intergenic
1160211019 18:76879821-76879843 ATGGGCTAACAGGAAGGTGAGGG + Intronic
925141597 2:1553752-1553774 GTGTGCTGACAGCAAGGCTCTGG + Intergenic
927501585 2:23586791-23586813 GTGTGCTAAGGGAGAGGGGCAGG - Intronic
932112654 2:69014444-69014466 GTGGGCTACCAGGGAGGTGCAGG + Intronic
938617332 2:133012895-133012917 ATGTGCTGAGAGCAAGGTGCTGG - Intronic
941221136 2:162783044-162783066 GTTGGATAACAGAAAGATGCTGG - Intronic
945424026 2:209676674-209676696 ACGTGCTAATAGAAAGATGCAGG + Intronic
946051397 2:216865600-216865622 GTGTGCTAAGAGCCATGTGCAGG + Intergenic
947712994 2:232326404-232326426 GTTTGGGGACAGAAAGGTGCAGG - Intronic
947720059 2:232364874-232364896 GTTTGGGGACAGAAAGGTGCAGG - Intergenic
1172413959 20:34749126-34749148 GTGTGCTAACAATATTGTGCGGG + Intronic
1173640855 20:44601012-44601034 GCGTCCTAACACAAAGGTCCCGG + Intronic
1174218041 20:48932224-48932246 GTTTGCTAACAGCAAGCTGAGGG + Intronic
1175559241 20:59905483-59905505 GTGTTCTAAAAGAAAGAAGCTGG + Intronic
1176137313 20:63529922-63529944 GGGTGCTCAGAGAATGGTGCAGG + Intronic
1179057865 21:37952663-37952685 GTGTGAAAACACAGAGGTGCAGG - Intronic
1183663974 22:39236855-39236877 GTGTGCAAACACACACGTGCAGG + Intronic
1184075111 22:42171889-42171911 GGGTGCCATCAGAAAGGCGCAGG + Intronic
1185023325 22:48393236-48393258 GTGTTGGAACAGAAAGGGGCTGG + Intergenic
951744774 3:25965825-25965847 GTGTTCCAACAGAAAGGAGGTGG + Intergenic
952775404 3:37041133-37041155 ATGTGCTAACAGGAAGCTTCTGG - Intronic
953375968 3:42428763-42428785 TTTTGCTAACAGAGAGGTCCTGG + Intergenic
953910277 3:46889285-46889307 GTGTGTAGACATAAAGGTGCCGG - Intronic
954975805 3:54693075-54693097 GTGTAGTAACACAAAGCTGCAGG + Intronic
955797002 3:62647915-62647937 ATGTGCTAACAGAAAGCAACAGG - Intronic
955817790 3:62864188-62864210 GTGTGGCCACAGACAGGTGCAGG - Intronic
956726738 3:72162801-72162823 GTGTGCAAACAGAGAGCTGGGGG - Intergenic
962010997 3:131390669-131390691 GTGAACTCACACAAAGGTGCAGG + Intergenic
964606336 3:158564458-158564480 GTGTGCGAACACAGAGGTTCAGG - Intergenic
968634180 4:1669393-1669415 GCGTGCTGACAGCAAGGGGCCGG + Intronic
968887470 4:3342044-3342066 ATCTGCTTCCAGAAAGGTGCAGG + Intronic
969783215 4:9428590-9428612 GTGTGTTAACAGGATGGTTCAGG + Intergenic
970233121 4:13931583-13931605 GTCTGCTAACAAACAGTTGCTGG + Intergenic
971558331 4:28041323-28041345 GTGAGATAGCAGAAAGGTGATGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972476728 4:39457642-39457664 GTGGGGTAACAGAAAGGAACTGG - Exonic
972796665 4:42428141-42428163 GTATGCTAACAGAAGGCTCCTGG - Intronic
980219602 4:129898700-129898722 TTGTACTATTAGAAAGGTGCTGG + Intergenic
981079808 4:140628071-140628093 TTGTGGTAACAGAAAAGAGCAGG - Intronic
981291136 4:143076930-143076952 GTGTGCTAAAATCAAGGTGTTGG - Intergenic
988505907 5:31822935-31822957 GTGGGGTAACAGAAAGGAGCTGG - Intronic
990716828 5:58646703-58646725 GTGTGATCACAGAAAGCTGGAGG - Intronic
992861797 5:80918821-80918843 GTCTGCTAAGTGACAGGTGCCGG + Intergenic
993269194 5:85771577-85771599 ATGTGCTCACAGAGAGGTGAAGG + Intergenic
996445462 5:123544108-123544130 CTCTGCTAATAGAAAAGTGCAGG + Intronic
998499130 5:142616782-142616804 GAGTGCTAATAGAGAGGTGAGGG - Intronic
998884132 5:146676373-146676395 GTGTGGTACCAGTAAGATGCAGG - Intronic
998958717 5:147463147-147463169 GTGTGCTAACAGAAAGGTGCTGG - Intronic
999906792 5:156149867-156149889 GTGGGCTAACGGAAATGTACTGG + Intronic
1003359176 6:5407952-5407974 GTGTCTTAACAGAAAGATTCAGG + Intronic
1009704113 6:67222542-67222564 ATGTACTAACAGATAGCTGCAGG + Intergenic
1012779611 6:103540897-103540919 GTGTACTAAAAGAAATGTGTTGG - Intergenic
1016688280 6:146905909-146905931 CTGTACTCACATAAAGGTGCAGG + Intergenic
1024390466 7:48806059-48806081 CTGAGCTAAAATAAAGGTGCTGG + Intergenic
1024419028 7:49140679-49140701 GTCTGCTGACAGAAAAATGCTGG - Intergenic
1027680864 7:81219785-81219807 ATGAGCTAACTGAAAGGTGATGG + Intergenic
1029084591 7:98001219-98001241 CAGTACTAACAGAAAGCTGCAGG - Intergenic
1029282630 7:99446226-99446248 CTGTGCTAACAGAAGGTGGCTGG - Intronic
1030221501 7:107103804-107103826 GTGTTCTAACTGAAAGATTCAGG - Intronic
1030485529 7:110162229-110162251 GGATGCTAAAAGAAAGGTGGTGG - Intergenic
1031367838 7:120925011-120925033 CTGTTCTGACACAAAGGTGCAGG - Intergenic
1031548185 7:123076404-123076426 GTGAGCTAACAGAAAACTACTGG - Intergenic
1036185831 8:6621860-6621882 GTCTGCTAACAGCAAGGAGCGGG - Intronic
1036835835 8:12065461-12065483 GTGTGTTAACAGGATGGTTCAGG - Intronic
1036857678 8:12312030-12312052 GTGTGTTAACAGGATGGTTCAGG - Intergenic
1038218462 8:25584935-25584957 GTGGGATGACAGAAAGGGGCAGG - Intergenic
1038664509 8:29526459-29526481 AAGTGCTAACAGGAAGGTGGTGG + Intergenic
1038823797 8:30978530-30978552 GTGAGCTGAGGGAAAGGTGCTGG + Intergenic
1045300037 8:100903103-100903125 GACTTCTAACAGAAAGGGGCTGG + Intergenic
1046476728 8:114755114-114755136 GTAAGCTAACAGAAAAGTACTGG + Intergenic
1055215116 9:73850300-73850322 GTGAGCTGTTAGAAAGGTGCAGG + Intergenic
1055872851 9:80905076-80905098 GTTTTCTAACAGTAAGGTGAAGG - Intergenic
1057824835 9:98364402-98364424 GTATGCCAGCAGAAAGGTGCAGG - Intronic
1187879902 X:23837119-23837141 GTGGGGTAACAGAAAGGAACTGG - Intronic
1188780407 X:34277189-34277211 ATGTGCTACCAGATAGGGGCTGG + Intergenic
1197679640 X:129368623-129368645 GTTTGCTATCAGGAAGGTGAGGG - Intergenic
1198065179 X:133089186-133089208 ATGTGCTAACAGAAAAGTAGAGG + Intronic
1202260878 Y:22969032-22969054 GTGTTATAACAAATAGGTGCGGG - Intergenic
1202413866 Y:24602773-24602795 GTGTTATAACAAATAGGTGCGGG - Intergenic
1202456918 Y:25067313-25067335 GTGTTATAACAAATAGGTGCGGG + Intergenic