ID: 998962972 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:147508881-147508903 |
| Sequence | GCCTCGCTTGTGTCTTAGCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998962972_998962973 | 9 | Left | 998962972 | 5:147508881-147508903 | CCGTGCTAAGACACAAGCGAGGC | No data | ||
| Right | 998962973 | 5:147508913-147508935 | GATTCGCGTGTTTAGTCTAGAGG | 0: 1 1: 0 2: 0 3: 0 4: 18 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998962972 | Original CRISPR | GCCTCGCTTGTGTCTTAGCA CGG (reversed) | Intronic | ||