ID: 998962972

View in Genome Browser
Species Human (GRCh38)
Location 5:147508881-147508903
Sequence GCCTCGCTTGTGTCTTAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998962972_998962973 9 Left 998962972 5:147508881-147508903 CCGTGCTAAGACACAAGCGAGGC No data
Right 998962973 5:147508913-147508935 GATTCGCGTGTTTAGTCTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998962972 Original CRISPR GCCTCGCTTGTGTCTTAGCA CGG (reversed) Intronic